Logout succeed
Logout succeed. See you again!

Morphological and Genetic Evidence Confirmed Three New Records of Ghost Shark Species (Chimaeriformes) From the Andaman Sea of Thailand PDF
Preview Morphological and Genetic Evidence Confirmed Three New Records of Ghost Shark Species (Chimaeriformes) From the Andaman Sea of Thailand
Tropical Natural History 21(2): 218–233, August 2021 ©2021 by Chulalongkorn University Morphological and Genetic Evidence Confirmed Three New Records of Ghost Shark Species (Chimaeriformes) From the Andaman Sea of Thailand TASSAPON KRAJANGDARA1*, FAHMI2, DAVID A. EBERT3, 4, 5, CHANIKARN CHAORATTANA6 AND JENJIT KHUDAMRONGSAWAT6 1Phuket Marine Fisheries Research and Development Center, Department of Fisheries, Phuket, THAILAND 2Research Centre for Oceanography, Indonesian Institute of Sciences, Jakarta, INDONESIA 3Pacific Shark Research Center, Moss Landing Marine Laboratories, California, USA 4Research Associate, South African Institute for Aquatic Biodiversity, Grahamstown, SOUTH AFRICA 5Research Associate, Department of Ichthyology, California Academy of Sciences, San Francisco, USA 6Animal Systematics and Molecular Ecology Research Group, Department of Biology, Faculty of Science, Mahidol University, Bangkok, THAILAND *Corresponding author. Tassapon Krajangdara ([email protected]) Received: 06 September 2020; Accepted: 10 April 2021 ABSTRACT.– Three species of ghost sharks (Chimaeriformes) were recorded for the first time from the Andaman Sea of Thailand during a deep-sea trawl survey conducted from October 1-15, 2018. Morphological characteristics primarily revealed species described as the sicklefin chimaera, Neoharriotta pinnata (Rhinochimaeridae), longspine chimaera, Chimaera aff. macrospina (Chimaeridae) and Philippine chimaera, Hydrolagus cf. deani (Chimaeridae). The presence of N. pinnata in the Andaman Sea of Thailand provided a plausible extension of its distributional range, but the record of the other two ghost sharks were far outside their known ranges and remained tentative. Using DNA barcoding, the Chimaera aff. macrospina sample was different from Australian C. macrospina and any other Chimaera species whose DNA sequences were available in databases. The sample of Hydrolagus cf. deani showed slight differences in morphology with the known H. deani, H. mitsukurii and H. africanus. It was close to H. africanus based on the genetic information, but state morphologically, especially shape of second dorsal fin, this specimen was most similar to H. deani. KEY WORDS: Chimaera, Hydrolagus, Neoharriotta, morphological, DNA barcoding, Andaman Sea, Thailand (Didier et al., 2012; Ebert, 2014; Weigmann, INTRODUCTION 2016). In the Indian Ocean region, at least 21 species and five genera of chimaeroids are Ghost sharks or chimaeras (Chimaeriformes) known to occur in this region (Ebert, 2014; are a little-known group of cartilaginous Clerkin et al., 2017; Walovich et al., 2017). fishes consisting of three families, (Chimaeridae, As a part of the eastern Indian Ocean region and Rhinochimaeridae) of which primarily (FAO Major Fishing Area 57), information occurs in the deep-sea and (Callorhinchidae) on chimaeroids in the Andaman Sea of a shallow water family (Nelson et al., 2016; Thailand are still very few. Since 1975, studies Ebert, 2014). The deep-sea chimaerids are on deep-sea fishes in the Andaman Sea of distributed circumglobally in most oceans Thailand have been conducted. So far only except in Antarctic waters (Ebert and Winton, one family and two species (Chimaera cf. 2010). The Indo-Pacific region has the phantasma and an unidentified Hydrolagus sp.) highest diversity with at least 30 species KRAJANGDARA ET AL. — THREE NEW RECORDS OF GHOST SHARK SPECIES 219 have been recorded from the Andaman Sea comparisons with description papers of related of Thailand (Ali et al., 2014; Krajangdara, species and records from other areas (Smith, 2017). The 2018 Deep Sea Expedition in the 1912; Didier et al., 2008; Jawad et al., 2012; Andaman Sea of Thailand by the Dr. Fridtjof Suresh and Raffi, 2012; Walovich et al., Nansen Research Vessel has obtained three 2015). specimens of ghost sharks that provided an Morphological measurements were taken opportunity to explore diversity of this following terms and morphometric standards group of fish in this region. from FAO (Compagno, 1999; Ebert, 2014), The objective of this study was to Didier et al. (1996), Walovich et al. (2015) identify species of these three specimens and Clerkin et al. (2017). All measurements based on their morphological characteristics. were taken using measuring tape and digital In case of uncertainty, a mitochondrial DNA vernier caliper to the nearest mm (Table 1). barcoding study was conducted for confirmation. All specimens were labelled and deposited These records not only enrich the diversity at the Reference Collection of Phuket of deep-sea chondrichthyans of Thailand Marine Biological Center (PMBC), Thailand. waters but could potentially provide information Genetic examination on the extended distribution of those species Selection of gene fragments for analyses in the eastern Indian Ocean region. was based on reference sequences available in GenBank and the Barcode of Life Data System (BOLD) databases. This part was MATERIALS AND METHODS performed in the putative Chimaera aff. macrospina and Hydrolagus cf. deani. Morphological examination Identification of the samples was based on A deep-sea survey under the Department the use of COI sequences for C. aff. macrospina of Fisheries (DoF), Thailand and FAO and ND2 sequences for H. cf. deani, using project were conducted in the Andaman Sea Basic Local Alignment Search Tool (BLAST), of Thailand using Dr. Fridtjof Nansen which were the only reference sequences Research Vessel from October 1-15, 2018. available in GenBank and the Barcode of The bottom trawl sampling was performed Life Data System databases. at various depths from 212 to 781 meters Genomic materials of the two specimens (Fig. 1). A mature male of Neoharriotta of these ghost sharks were extracted (taken pinnata (Schnakenbeck, 1931) was caught from pelvic fin). Initial amplification of on October 7, 2018 at depth 506-510 m mitochondrial COI and ND2 sequences was (Long. 97.01oE and Lat. 08.17o N), while an conducted using universal primers (Naylor immature male of Chimaera aff. macrospina et al., 2012; Ward et al., 2005) but failed to Didier, Last and White, 2008 and a female produce clear sequence information possibly of Hydrolagus cf. deani (Smith and due to tissue degradation. As DNA templates Radcliffe, 1912) were collected on October were degraded into short fragments, specific 11, 2018 at depth 772-775 m (Long. 96.99o primers needed to be designed for PCR E and Lat. 07.54o N). Identification of those amplification. External and internal primers three species was based on identification for the amplification of the COI gene were keys for chimaeroids in Didier and designed using the complete mitochondrial Stehmann (1996), Compagno (1999), Last DNA sequence of Chimaera fulva (GenBank and Stevens (2009), Ebert (2014), and accession No. HM147138.1) and the COI 220 TROPICAL NATURAL HISTORY 21(2), AUGUST 2021 FIGURE 1. Map of the record localities of Neoharriotta pinnata (●), Chimaera aff. macrospina (○) and Hydrolagus cf. deani (□) in the Andaman Sea of Thailand. sequence of C. macrospina (BOLD ID: No. KF927898.1) was used to design internal FOAF581-07), respectively. For amplification primers. Short regions of these genes were of the ND2 region, the whole mitochondrial then specified, and primers were designed to DNA sequence of Hydrolagus lemures cover these fragments using Primer3 (ver. 0.4.0) (GenBank accession No. HM147139.1) was (Koressaar and Remm, 2007; Untergasser et al., used to design external primers. The ND2 2012) (Table 2). sequence of H. mitsukurii (GenBank accession KRAJANGDARA ET AL. — THREE NEW RECORDS OF GHOST SHARK SPECIES 221 TABLE 1. Morphometric measurements of three chimaeroids from the Andaman Sea of Thailand, expressed as percentage of body length. Species Neoharriotta pinnata Chimaera aff. macrospina Hydrolagus cf. deani Collection number PMBC 30401 PMBC 30399 PMBC 30400 Sex Mature male Immature male Female Total length (TL) 1092 mm 508 mm 739 mm Precaudal length (PCL) 797 mm 360 mm 362 mm Body length (BDL) 478 mm 276 mm 292 mm Preorbital length (POB) 45.6 10.1 13.0 Prenarial length (PRN) 39.8 13.0 12.7 Preoral length (POR) 38.7 11.2 9.3 Snout-vent length (SVL) 105.9 71.4 56.9 Pre-first dorsal (PD1) 66.3 29.7 26.7 Pre-second dorsal (PD2) 100.8 48.2 44.9 Pre-pectoral (PP1) 68.2 33.0 25.7 Pre-pelvic (PP2) 108.2 65.9 59.9 Snout width (SWF) 5.6 8.0 3.8 Snout width at base (SWB) 9.8 9.1 7.9 Snout height at base (SHB) 9.2 9.4 7.2 Head length (HDL) 65.7 30.4 24.0 Head height (HDH) 25.7 24.3 19.9 Head width (HDW) 14.9 12.0 13.7 Eye length (EYL) 7.7 9.8 10.6 Eye height (EYH) 5.5 6.2 6.5 Interorbital space (INO) 3.8 6.9 0.3 Mouth length (MOL) 5.9 4.4 3.8 Mouth width (MOW) 10.1 8.0 6.9 Trunk width (TRW) 22.4 15.9 11.6 Trunk length (TRL) 43.9 40.2 38.4 Pectoral-pelvic space (PPS) 32.4 26.1 32.9 Dorsal-caudal space (DCS) 10.3 1.8 0.7 Anal-caudal space (ACS) 1.1 1.5 - Interdorsal space (IDS) 8.0 5.8 6.9 Pelvic-caudal space (PCA) 53.6 62.3 61.6 Pectoral fin max. length (P1L) 29.5 36.2 37.0 Pectoral fin anterior margin (P1A) 29.5 35.1 37.0 Regions of COI and ND2 were amplified 222 TROPICAL NATURAL HISTORY 21(2), AUGUST 2021 TABLE 1. (Continue) Pectoral fin base (P1B) 8.6 8.7 9.9 Pelvic fin max. length (P2L) 19.3 17.0 21.2 Pelvic fin anterior margin (P2A) 19.3 15.9 21.2 Pelvic fin base (P2B) 5.2 5.8 4.8 First dorsal fin anterior margin (D1A) 25.3 23.9 22.9 First dorsal fin base (D1B) 24.3 15.6 18.5 First dorsal fin height (D1H) 19.7 21.7 19.9 Dorsal spine height (DSA) 24.3 27.2 25.3 Second dorsal fin base (D2B) 50.2 79.7 80.5 Maximum height of anterior of second dorsal fin 5.4 6.2 6.2 (MDa2xAimHu) m height of the middle of second dorsal fin - - 1.7 (MDa2xMimHu)m height of posterior of second dorsal fin 5.4 6.2 3.8 (SDec2oPnHd) dorsal fin length (D2L) 54.2 81.2 80.8 Second dorsal fin inner margin (D2I) 2.5 2.9 0.5 Anal fin length (ANL) 14.6 6.5 - Anal fin base (ANB) 9.8 3.3 - Anal fin height (ANH) 10.9 4.7 - Dorsal caudal margin length (CDM) 36.6 19.9 26.0 Ventral caudal margin length (CVM) 49.0 22.8 37.7 Caudal filament length (CFI) 24.3 34.1 103.8 Total caudal length (CTL) 63.0 54.0 128.1 Maximum height of upper lobe of caudal fin (CDH) 2.3 2.9 2.4 Maximum height of lower lobe of caudal fin (CVH) 3.8 2.9 2.1 Origin of D1 to origin of P1 (D1P1) 19.0 17.0 12.7 Origin of D1 to origin of P2 (D1P2) 45.6 39.5 33.9 Origin of D2 to origin of P1 (D2P1) 34.7 23.2 24.0 Origin of D2 to origin of P2 (D2P2) 19.2 22.5 18.8 Regions of COI and ND2 were amplified accession Nos. MN626332 and MN626333). following standard PCR protocol. Successfully Phylogenetic trees were constructed using amplified products were visualized, purified, maximum likelihood (MEGA7). The selected and sequenced. Sequences were corrected model for ML was HKY+G (bootstrap support and aligned using MEGA7 (Kumar et al., values = 1,000 iterations). Calculation of genetic 2016; Tamura et al., 2004). Final alignments pair wise distance based on Kimura 2- of COI and ND2 were 641 base pairs (bp) parameter (K2P) using bootstrap support and 1,044 bp, respectively. All sequences values of 1,000 iterations was performed in were deposited in NCBI database (GenBank MEGA7. KRAJANGDARA ET AL. — THREE NEW RECORDS OF GHOST SHARK SPECIES 223 TABLE 2. Lists of primers used for gene amplification. DNA barcode region Name of primer Primer sequence (5'→ 3') ChiCOI_L1 CGCCTAAACTCAGCCATCTT ChiCOI_R1 AGTACCCGCACCTGCTTCTA ChiCOI_L2 CGCCCTAATGGGAGATGAT COI ChiCOI_R2 ACCGGCTGCTAGAACAGGTA ChiCOI_L3 CCCTCTAGCAGGGAATCTAGC ChiCOI_R3 TCCAAATCCGGGTAGAATTAAA HydND2_L1 GGCCCATACCCCAAACAC HydND2_R1 GTGGAGAGAAGTGCCAAGGT HydND2_L2 AGCCTTAAAACTGGGCCTTG ND2 HydND2_R2 TGTTGTCATTGAGAGGGAGTTG HydND2_L3 ACCTTGGCACTTCTCTCCAC HydND2_R3 TGTCTGGGTTGCATTCAGAG RESULTS AND DISCUSSION reaching the origin of pelvic fins. Pelvic fins relatively small, broadly rounded on the Neoharriotta pinnata posterior margin; the maximum length 1.5 A mature male of longnose chimaera times in pectoral maximum length. First specimen (PMBC 30401; 1,092 mm TL) dorsal fin small, its base 24.3% BDL and was initially identified as the sicklefin the height 0.2 times BDL. Dorsal spine chimaera, Neoharriotta pinnata (Schnakenbeck, straight and relatively long, about 1.2 times 1931); Family Rhinochimaeridae Garman, first dorsal fin height. The origin of the 1901 (Fig. 2). It was obtained on October 7, dorsal spine just opposite the pectoral fin 2018, Andaman Sea, Thailand (Long. 97.01o E origin. Second dorsal fin low, prolonged and and Lat. 08.17o N) at the depth of 506-510 m. slightly convex; its height 3.7 times in first A longnose chimaerid with characteristics dorsal fin height; the base 50% BDL and 2.1 as follows: body flabby, elongate, tapering times first dorsal fin base. First dorsal and to a caudal fin with a filamentous tail. Head second dorsal fins are well separated, large, its length about 0.4 times precaudal connected with a low membrane; the length and 65.7% of body length (BDL). interdorsal space 8% BDL. Anal fin present, Snout long and pointed, widely based; the position of anal fin origin is in front of preoral length 58.9% of head length and 2.6 the second dorsal fin insertion. Anal fin times in body length; snout width at base separated from lower caudal fin lobe by a 1.8 times snout width. Eyes relatively large, deep notch; its base 0.2 times the lower eye length 11.7% head length and its height caudal fin lobe. The lower caudal fin longer 0.2 times head height. Oral and preopercular and greater than upper lobe, its length 1.3 lateral line canals well separated; lateral line times and height 1.7 times the upper lobe. on trunk relatively straight, not undulating. Tail filament 24.3% BDL and 0.7 times the Pectoral fins relatively broad and short, not length of upper caudal lobe. 224 TROPICAL NATURAL HISTORY 21(2), AUGUST 2021 The adult male specimen has a pair of like, its base anterior of supraorbital. Body long and slender claspers (122 mm; 25.5% coloration uniformly dark brown, without BDL) equipped with a pair of prepelvic any spots or stripes. All fins have similar tenaculae and a frontal tenaculum (Fig. 3). color with the body. Prepelvic tenaculae prominent, blade-like, The sicklefin chimaera, Neoharriotta pinnata with five denticles along the medial edge of can be distinguished to its congeners by left tenaculum (no scar of missing denticles) having well separated between oral and and seven denticles on the right one (Fig. 3); preopercular lateral line canals, rounded frontal tenaculum well developed, knob- pelvic fins, and uniformly second dorsal fin FIGURE 2. Neoharriotta pinnata (PMBC 30401), from Thailand-Andaman Sea FIGURE 3. Prepelvic tenaculae of Neoharriotta pinnata (PMBC 30401), from Thailand-Andaman Sea KRAJANGDARA ET AL. — THREE NEW RECORDS OF GHOST SHARK SPECIES 225 height (Didier and Stehmann, 1996). This lateral line canal originating at level of species was previously known to occur from upper eye, forming a notch anteriorly below the East Atlantic (from the southern Bay of the dorsal spine origin; lateral line on trunk Biscay to West Africa) to the Indian Ocean relatively straight, not undulating and (from the Gulf of Aden, the Arabian Sea, running along to caudal filament. Pectoral the southwest of India to the Bay of Bengal) fins relatively broad and long, semi-falcate, (Manilo and Movchan, 1989; Ali et al., with slightly convex on anterior margin; its 2009; Suresh and Raffi, 2012; Diez and length 36.2% body length and reaching Mugerza, 2017). The record of N. pinnata in slightly posterior to the origin of pelvic fin. the Andaman Sea is an extended distribution Pelvic fins moderately broad and large, of this species to the eastern Indian Ocean. paddle-shape with angular apex; its Chimaera aff. macrospina maximum length about 2.1 times in pectoral An immature male chimaerid specimen maximum length. First dorsal fin relatively (PMBC 30399; 508 mm TL) was initially long with narrow base, its base 15.6% body identified as the longspine chimaera, length and its height 4.6 times in body Chimaera macrospina Didier, Last and White, length. Dorsal spine straight and long, its 2008; Family Chimaeridae Bonaparte, 1831 length more than 1.3 times first dorsal fin (Fig. 4). It was obtained on October 11, height and 1.1 times in head length. The 2018, Andaman Sea, Thailand (Long. 96.99o origin of the dorsal spine just over the E and Lat. 07.54o N) at the depth of 772-775 m. pectoral fin origin. Second dorsal fin This short nose chimaerid showed moderately low and prolonged, the upper characteristics as follows: body elongate, margin relatively straight with similar tapering to a caudal fin with a filamentous height; its height 3.5 times in first dorsal fin tail. Head large, its length 0.2 times height; its base 79.7% body length and 5.1 precaudal length and 30.4% BDL. Snout times first dorsal fin base. First dorsal and short, bluntly pointed; preorbital snout 0.1 second dorsal fins are well separated, times body length, preoral length 2.7 times connected with a low membrane; the in head length. Eyes relatively large, eye interdorsal space 5.8% body length. Anal fin length 32.2% head length and eye height 0.6 present, the position of anal fin insertion times its length. Body slightly compress, slightly behind the second dorsal fin FIGURE 4. Chimaera aff. macrospina (PMBC 30399), from Thailand-Andaman Sea 226 TROPICAL NATURAL HISTORY 21(2), AUGUST 2021 insertion. Anal fin separated from lower (Didier et al., 2008; Kemper et al., 2014). It caudal fin lobe by a deep notch; its base differs from C. notafricana, a species of 14.5% lower caudal fin lobe. The lower Chimaera distributing in the Indian Ocean, caudal fin slightly longer than upper lobe, in head length, eye size, pectoral and first its length about 1.1 times but the height is dorsal fin shape, and the coloration (Kemper similar to the upper lobe. Tail filament longer et al., 2010; Ebert, 2014). However, as the than caudal fin lobes, 1.7 times the length of sample was an immature male, several upper caudal lobe and 34.1% body length. characteristics were not fully grown making The immature male specimen has a pair morphological identification tentative. of undeveloped and short claspers, equipped Although this sample revealed similarities with a pair of not well developed prepelvic with Chimaera macrospina and morphologically tenaculae. Denticles on the medial edge not distinct from other congeners, the presence prominent and a frontal tenaculum that is of this species in Thailand was initially not fully developed. Body coloration uniformly considered as a new record for Thailand dark brown, without any spots or stripes. All since this species was usually recorded only fins have slightly darker color than the body. in Australia waters, eastern Indian Ocean Morphological characteristics of this and south-western Pacific Ocean. The result sample revealed many similarities to from DNA barcoding study challenged Chimaera macrospina, whose distribution morphological identification. The maximum was recorded in Australia waters (Didier et likelihood tree showed that the C. macrospina al., 2008; Kemper et al., 2014; Last and sample formed a separate clade and did not Stevens, 2009) and eastern Indian Ocean cluster with Australian C. macrospina nor and south-western Pacific Ocean (Ebert, 2014; with any other Chimaera species whose Weigmann, 2016). It was distinguished to its sequences were available for comparison congeners by having long dorsal spine and (Fig. 5). The pair wise distance value between uniformly chocolate brown coloration this sample and the reference C. macrospina FIGURE 5. Maximum likelihood tree based on mitochondrial COI sequences representing the relationship of the unidentified Chimaera aff. macrospina (PMBC 30399), from Thailand-Andaman Sea. Numbers at nodes indicate posterior probability. KRAJANGDARA ET AL. — THREE NEW RECORDS OF GHOST SHARK SPECIES 227 was 10.3%, while between our sample and follows: body elongate, tapering to a caudal other Chimaera species ranged from 10.7 to fin with a long filamentous tail. Head 16.0%. Based on this result, the specimen moderately large, its length about 0.2 times from the Andaman Sea of Thailand is precaudal length and 24.0% body length. identified as “Chimaera aff. macrospina” as Snout obtuse; preorbital snout 13.0% body it may represent an undescribed taxon. length, preoral length 2.6 times in head The use of DNA barcoding showed length. Eyes very large, eye length 44.2% contradictory result with the morphological head length and eye height 0.6 times its identification. The sample formed its own length. Body rather slender, lateral line cluster separating from other congeners, canal originating at level of upper eye, especially C. macrospina. Unfortunately, forming a shallow notch in front of the because of limited number of reference dorsal spine origin; lateral line on trunk sequences available in public databases, the relatively straight, not undulating and analysis that depended on these references running along to caudal filament. Pectoral may not be thorough. It was suspected that fins broad and triangular, its apex pointed, the Chimaera specimen from Thai Andaman with posterior margin slightly convex, waters was an undescribed taxon, although broadly rounded on base; its length 37.0% was not temporarily labelled as “Chimaera body length and reaching beyond to the aff. macrospina” for future references. origin of pelvic fin; anterior margin 1.8 Hydrolagus cf. deani times pelvic anterior margin. Pelvic fins A female specimen of a long tailed rather long, paddle-shape with pointed apex, chimaerid (PMBC 30400; 739 mm TL) was posterior margin slightly concave; its obtained on October 11, 2018, Andaman maximum length about 1.8 times in pectoral Sea, Thailand (Long. 96.99o E and Lat. maximum length. First dorsal fin moderately 07.54o N) at the depth of 772-775 m (Fig. 6). long, triangular and short-based; its base This specimen has some characteristics as 18.5% body length and its height 5.0 times FIGURE 6. Specimen of Hydrolagus cf. deani (PMBC 30400) from Thailand-Andaman Sea (A), and photo of the fresh specimen taken on the Research Vessel (B).