Logout succeed
Logout succeed. See you again!

New Holothuria species from Australia (Echinodermata: Holothuroidea: Holothuriidae), with comments on the origin of deep and cool holothuriids PDF
Preview New Holothuria species from Australia (Echinodermata: Holothuroidea: Holothuriidae), with comments on the origin of deep and cool holothuriids
Memoirs of Museum Victoria 64: 35–52 (2007) ISSN 1447-2546 (Print) 1447-2554 (On-line) http://museumvictoria.com.au/Memoirs/ New Holothuria species from Australia (Echinodermata: Holothuroidea: Holothuriidae), with comments on the origin of deep and cool holothuriids P. MARK O’LOUGHLIN1, GUSTAV PAULAY2, DIDIER VANDENSPIEGEL3 AND YVES SAMYN4 1Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia ([email protected]) 2Florida Museum of Natural History, University of Florida, Gainesville FL 32611–7800, USA (paulay@fl mnh.ufl .edu) 3Musée royal de l’Afrique centrale, Section invertebrates non-insects, B-3080, Tervuren, Belgium ([email protected]) 4Royal Belgian Institute of Natural Sciences, Global Taxonomy Initiative, B-1000, Brussels, Belgium ([email protected]) Abstract O’Loughlin, P. M., Paulay, G., VandenSpiegel D., and Samyn, Y. 2007. New Holothuria species from Australia (Echinodermata: Holothuroidea: Holothuriidae), with comments on the origin of deep and cool holothuriids. Memoirs of Museum Victoria 64: 35–52. Two aspidochirotid species, new to science, from the continental slope of southern Australia are described: Holothuria (Panningothuria) austrinabassa O’Loughlin sp. nov. and Holothuria (Halodeima) nigralutea O’Loughlin sp. nov. The fi rst represents the southernmost documented holothuriid, and is the sister species of the northernmost holothuriid species Holothuria (Panningothuria) forskali Delle Chiaje. The second is a very recent offshoot of the wide-ranging Indo- west Pacifi c Holothuria (Halodeima) edulis Lesson. Morphological and molecular genetic differences between these species pairs are detailed. Holothuria (Halodeima) signata Ludwig is raised out of synonymy with H. edulis.A lectotype for Holothuria (Halodeima) signata Ludwig is designated, The status of the subgenera Panningothuria Rowe and Halodeima Pearson is discussed. The occurrence of multiple madreporites in Halodeima is discussed. Keywords Echinodermata, Holothuroidea, Holothuriidae, Holothuria, taxonomy, new species, new lectotypes. Introduction related species, and outgroup taxa (see Table 1 for voucher information) were macerated, digested in DNAzol® and The Holothuriidae is one of the most diverse families of sea proteinase K overnight, and genomic DNA isolated using cucumbers, with the bulk of this diversity in shallow, tropical standard procedures (Meyer, 2003). Genomic DNA of most waters. Of the more than 185 species (Samyn et al., 2005) samples was cleaned using the Qiagen polymerase chain currently recognized, all but a handful thrive in the tropics, reaction (PCR) cleanup kit, following manufacturer’s protocols, predominantly on coral reefs, at less than 50 m depths. It is except that cleaned DNA was resuspended in TE buffer. Qiagen therefore noteworthy that recent surveys in Australia revealed cleanup helped eliminate problems with inhibition prevalent in two new deepwater species from subtropical to warm temperate holothurian samples. latitudes. Specimens of the two new Holothuria species were An approximately 1120 bp long (1119 bp in H. nigralutea collected from the continental slope off western and south-western G255) section of the large subunit of the mitochondrial ribosome Australia during the survey SS10/2005 by Australia’s national RNA gene (16S) was amplifi ed with a pair of overlapping primers. science agency, the Commonwealth Scientifi c and Industrial 16Sc1 (TACCTT[T/G]TGTAT[T/A]ATGG[T/A]TTAAC ) and Research Organization (CSIRO), that is aiming “to characterize 16Sc2 (TGATTATGCTACCTTNGCAC) (designed new) benthic ecosystems off Western Australia”. This was commenced amplifi ed 678 bp, and 16SAR (CGCCTGTTTATCAAAAACAT) through the Marine National Facility by the RV Southern Surveyor and 16SBR (GCCGGTCTGAACTCAGATCACGT) (Palumbi, in the last months of 2005. Additional specimens were discovered 1996), amplifi ed 510 bp in H. nigralutea (G255). A 651 bp length in the collections of Museum Victoria. To ascertain the subgenera of the mitochondrial cytochrome oxidase subunit 1 gene was to which the two new species belong, comparative morphological amplifi ed with primers COIeF (ATAATGATAGGAGGRTTTGG) and molecular studies were undertaken. COIeR (GCTCGTGTRTCTACRTCCAT) (Arndt et al., 1996). PCR products were sequenced at the University of Florida’s ICBR Methods center. Electropherograms were edited in Sequencher, aligned Genetic characterization was pursued by sequencing portions with Clustal X, and adjusted by eye. Sequences are deposited in of the mitochondrial 16S (large subunit) RNA and cytochrome GenBank (see Table 1 for GenBank and voucher information). oxidase I (COI) genes. Ethanol-fi xed tissues of the new taxa, Sequence data from the two gene regions were analyzed as a 36 P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn single concatenated dataset. Parsimony trees were generated by cleared of associated soft tissues in commercial bleach. They PAUP (version 4, Swofford, 2003), with 100 bootstrap replicates. were then air-dried, mounted on aluminium stubs, coated Bayesian analyses were run using Mr. Bayes (version 3.1.2, with gold, and observed with a JEOL JSM-6480LV scanning Ronquist and Huelsenbeck, 2003), with MC3, GTR-I-Gamma, an electron microscope. uninformative prior, for 10 million generations. GTR-I-Gamma Abbreviations for institutions are: MNHN—Musée national was chosen as the simplest model of evolution that fi tted the data, d’Histoire naturelle, Paris; NMV—Museum Victoria, Australia; using the Akaike Information Criterion as implemented by the RBINS—Royal Belgian Institute of Natural Sciences; UF— program Modeltest 3.6 (Posada and Crandall, 1998), for each Florida Museum of Natural History; UH—Zoologisches gene region as well as for the combined sequences. Indels were Museum, Universitat Hamburg; UM—University of Murcia, included in the analysis. There was no evidence for pseudogene Spain; USNM—United States National Museum of Natural sequences in any of several hundred specimens of Holothuria History, Smithsonian Institution, Washington. sequenced to date; all reads were clean and unambiguous. Specimen registration number prefi xes are: MNHN EcHh; For scanning electron microscopy (SEM), ossicles were NMV F; RBINS IG; UF E; UH E; UM HO; USNM E. Table 1. Specimens sequenced. GenBank accession numbers given for gene regions. Voucher Extraction Species Locality 16Sc 16SAR COIe NMV F94742 N10 Stichopus ocellatus Papua New Guinea EU220793 EU220793 EU220814 UF E4834 G188 Actinopyga obesa Hawaii EU220794 EU220794 EU220815 UF E4901 N82 Bohadschia sp. nov. Hawaii EU220795 EU220795 EU220816 UF E1595 G80 H. excellens Palau EU220796 EU220796 EU220817 NMV F110524 G257 H. austrinabassa W Australia EU220797 EU220797 EU220818 UF E4480 G200 H. forskali Portugal EU220798 EU220798 EU220819 UF E4831 G186 H. atra Hawaii EU220799 EU220799 EU220820 UF E4460 G175 H. grisea Florida EU220800 EU220800 no UF E3359 G247 H. kefersteini Panama EU220801 EU220801 no UF E4877 G259 H. mexicana Belize EU220802 EU220802 EU220821 UF E4822 G230 H. fl oridana Florida EU220803 EU220803 EU220822 NMV F120437 N120 H. nigralutea W Australia EU220804 no EU220823 NMV F111290 G255 H. nigralutea W Australia EU220805 EU220805 EU220824 UF E3644 N3 H. edulis “brown” form Cocos-Keeling EU220806 EU220806 EU220825 UF E2065 J292 H. edulis typical form Oman EU220807 EU220807 EU220826 UF E4987 K140 H. edulis fuschia form Philippines EU220808 no EU220827 UF E4746 G104 H. edulis typical form Guam EU220809 EU220809 EU220828 UF E3884 J282 H. edulis grey form Okinawa EU220810 EU220810 EU220829 UF E3882 J296 H. edulis grey form Okinawa EU220811 EU220811 EU220830 UF E325 G50 H. signata Rangiroa EU220812 EU220812 EU220831 UF E329 G55 H. signata Rangiroa EU220813 EU220813 EU220832 Table 2. Characters distinguishing H. (Panningothuria) austrinabassa O’Loughlin sp. nov. and H. (Panningothuria) forskali Delle Chiaje Characters H. austrinabassa H. forskali Body colour Grey-brown, small brown spots Black to dark brown Papilla tubercles Distinct, ocellate, off-white Same colour as body wall Tables in body wall Abundant, fully developed Sparse to absent, reduced form Dorsal table discs > 50 μm wide < 50 μm wide Spire of tables Always fully developed Rarely fully developed Papillae rods Unbranched rods absent Unbranched rods present Tentacle tables Present, reduced form Absent Tube feet Spinous rods present Spinous rods absent Distribution W and S Australia NE Atlantic, Mediterranean Sea New Holothuria species 37 Figure 1. a, live Holothuria (Panningothuria) austrinabassa O’Loughlin sp. nov, from Western Australia, off Perth (380 mm long; NMV F110523; photo by Karen Gowlett-Holmes). b, preserved H. (Panningothuria) austrinabassa, from Western Australia, off Albany (250 mm long; tentacles at right; NMV F120438; photo by David Staples). c, d, preserved holotype of H. (Panningothuria) austrinabassa, from Victoria, off Portland (170 mm long; oral end left; NMV F120447; photos by David Staples): c, dorsal view; d, ventral view. e, live H. (Panningothuria) forskali Delle Chiaje, in aquarium in Mons, Belgium (130 mm long; photo by Didier VandenSpiegel). f, live H. (Panningothuria) forskali , from south of France, off Banyuls, showing expulsion of cuvierian organ tubules (photo by Didier VandenSpiegel). 38 P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn Figure 2. Holothuria (Panningothuria) austrinabassa sp. nov. (SEM of ossicles from NMV F120447 and NMV F120438). A, dorsal body wall; B, anal body wall; C, ventral body wall; D, tentacles; E, madreporite; F, tube feet; G, papillae. New Holothuria species 39 Figure 3. Holothuria (Panningothuria) forskali Delle Chiaje, 1823 (SEM of ossicles from HO-1854). A, oral body wall; B, anal body wall; C, tube feet; D, dorsal papillae; E, tentacles. 40 P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn Figure 4. Bayesian phylogram of species studied together with selected outgroup taxa, with posterior probability values (10 million generations, GTR-I-Gamma, and uninformative prior) above branches, and parsimony bootstrap values (100 replicates) below. New Holothuria species 41 Holothuria (Panningothuria) austrinabassa O’Loughlin sp. 52–72 μm in diameter, with 4–8 perforations, with alternating nov. narrow and wide perforations that give slightly angular, quadrate aspect to disc, sometimes with fi ne spinelet at edge; spire with 4 Figures 1– 4, Tables 1, 2. pillars, typically 40 μm high (including spines), single cross- Material examined. Holotype: Australia, Victoria, 27 miles SW of beam, crown with conspicuous spines that may extend beyond Portland, approx. 39°S, 141°E, 293–329 m, Aquarius, M. Gomon and disc margin, these spines variable in length and form, up to R. Plant, May 1979, NMV F120447. 32 μm long, straight, curved, forked, with side branch. Dorsal Paratypes: Type locality and date, F109370 (2). papillae with tables, perforated plates, spinous spherical bodies; Other material. Western Australia, Southern Surveyor, tables as for body wall, but some larger, with discs to 96 μm Nov/Dec 2005, SS10/2005 stn 90, off Abrolhos Is, 389–407 m, F110525 across, spires up to 64 μm high; plates irregularly rectangular (up (1); SS10/2005 stn 78, off Jurien Bay, 414–401 m, F110524 (3); SS10/2005 to 144x128 μm) to narrowly oval (184x80 μm), plates formed stn 6, off Two Rocks (Perth), 329–370 m, F110523 (2); SS10/2005 stn 32, around thick central rod, with large perforations centrally with off Bald I. (Albany), 728–710 m, F111301 (1); SS10/2005 stn 34, off Bald angular edges and smaller perforations marginally with angular I., 431–408 m, F111286 (2); F110526 (2); SS10/2005 stn 39, off Bald I., edges, and bluntly spinous marginal edge; reticulate spinous 97–99 m, F120438 (1); off Cervantes, 30º16’ S, 114º30’ E, 600–800 m, 8 Feb 1991, F120441 (2); Great Australian Bight, 33º19’ S, 127º24’ E, spherical body at apex of papilla, 320 μm wide. Ventral body 300–310 m, 27 Feb 1976, F120442 (1); South Australia, SW of Beachport, wall with tables only, tables similar in form to dorsal ones, but 37º49’ S, 139º45’ E, 24 Dec 1981, F120439 (1); Victoria, 20.5 miles S of often smaller, discs to 48 μm wide only, spire to 32 μm high only. Cape Nelson, 403 m, 10 Mar 1977, F120440 (1). Tube feet with endplates, support plates, support rods; endplates Comparative material examined. Holothuria (Panningothuria) irregularly oval, up to 600 μm long, of complex form, partly forskali Delle Chiaje, 1823. NE Atlantic Ocean, Portugal, Algarve, single-layered plate with small perforations or mesh-like, partly Estrajada, 20 m, between rocks, UM HO-1854 (1). with incomplete mesh-like secondary layering; support plates Description (preserved specimens). Body up to 250 mm long, more elongated and more fi nely perforate than in papillae, up to up to 70 mm wide (F120438); elongate, not tapering from mid- 200 μm long; support rods rare, thick, curved, with some thick spines on outer edge, up to 120 μm long. Body wall around anus body, rounded anteriorly and posteriorly, oval in transverse with tables and rods; tables as dorsally, but many larger, disc to section, longitudinal, deep, mid-ventral furrow frequently 80 μm wide, spire 48 μm long; rods rare, thick, bent, with rugose present. Body wall fi rm-leathery, up to 20 mm thick (F120438). spinous surface, up to 552 μm long. Tentacles with rods, reduced Dorsal and lateral body surface pustulose, wrinkled; tubercles tables; rods thick to thin, rarely with terminal perforations, rarely scattered irregularly dorsally and laterally, fl at, ocellate, “wart- branching, with thick spines, up to 652 μm long; tables irregular, like”, oval to round, variable size, up to 2–10 mm across, mostly lacking a spire, discs 48–80 μm wide, spire up to 24 μm sometimes contiguous, with papillae extending as small nipple- long if present, disc with 4–18 perforations, disc variably with like projections, 1 mm high 0.5 mm wide, 3–12 mm apart, bluntly spinous margin. Stone canal/madreporite with massed lacking ampullae. Ventral surface soft, pustulose, wrinkled, tube irregular rods, some branched, some branches anastomosing to feet hard to discern, arranged in very irregular, scattered, paired form perforations, some with irregularly perforated mesh. series along ventral radii, about 5 mm apart (F110524), tube feet Tentacle ampullae, polian vesicles, gonad tubules, lacking ampullae. Mouth ventral, surrounded by irregular collar respiratory trees, longitudinal muscles, circular muscles, wall of about 50 inconspicuous oral papillae evident only in largest of cloaca and cuvierian organ devoid of ossicles. specimen (F120438); tentacles 20, peltate, with long, thin, tubular tentacle ampullae extending off calcareous ring plates, Colour. Colour (live): background colour grey dorsally and subequal, up to 25 mm (F109370) long. Anus terminal, lacking dorsolaterally, yellowish laterally, and off-white ventrally. Dorsal anal teeth. Left dorsolateral radial plate of calcareous ring 7 mm and lateral tubercles white “wart-like” fl at papillae cones with wide 5 mm high, with 4 anterior points, posterior margin with green margin and small dark central spot. Body with grey-brown shallow rounded indentation. Left dorsolateral interradial plate spots in addition to dark papillae spots. Colour (preserved): 3 mm high, 3 mm wide, anterior spire, posterior margin with background colour grey-brown dorsally and dorsolaterally, brown rounded indentation (F110526). With single dorsal stone canal/ to pale brown ventro-laterally and ventrally. Tubercles off-white madreporite, stone canal 1 mm long with attached madreporite with small dark brown or off-white central papilla. Body with 2 mm long (F109370), to stone canal 2 mm long with attached scattered grey-brown spots in addition to papillae spots. Tube feet madreporite 3 mm long (F120441, F120442, F120438). With 1 similar colour to body surface. Tentacles yellow-brown. Coelomic or 2 sac-like polian vesicles, 12 mm (F110526) to 33 mm wall with closely paired series of radial dark spots radially, spots (F120441) long, narrowed distally; 2 polian vesicles in holotype, scattered interradially, not associated with papillae or tube feet. 30 and 15 mm long. Longitudinal muscles fl at, broad, thin An exceptionally large specimen (F120438) has extensive, brown, median groove, dorsal bands up to 12 mm wide, ventral bands dorso-lateral patches, and papillae not conspicuously ocellate. up to 30 mm wide (F120438). Gonadal tubules long, thin, Distribution. Australia, Western Australia, Abrolhos Is (29°S), multiple branching, extending to mid-body. Respiratory tree to Victoria, Portland (39°S, 141°E); southern continental slope, extending to anterior end. Cuvierian organ present, tubules up to 97–800 m. 25 mm long, 1.5 mm in diameter, not branched. Gut contents calcareous detritus, fragments up to 10 mm long. Etymology. From the Latin austrinus (southern) and bassus Ossicles. Dorsal body wall with numerous tables only; tables (deep), referring to the unusually high latitude and deep variable in size, variable in form of disc and spines; disc occurrence for the genus (feminine). 42 P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn Remarks. The new species is assigned to Holothuria Linnaeus, Mediterranean species also have a cuvierian organ. Koehler 1767, and provisionally referred to the subgenus Panningothuria (1921) also noted the white papillae, although not all specimens Rowe, 1969, as diagnosed in Rowe (1969). Rowe (1969) erected of H. forskali have white papillae. All three characters are true the monotypic sub-genus Panningothuria for Holothuria of the specimen examined here and judged to be H. forskali forskali Delle Chiaje, 1823, the principal diagnostic character (UM HO-1854). being the sparse presence in the body wall of very reduced H. austrinabassa resembles H. forskali in several tables only. Molecular data (discussed below) indicate that morphological characters, such as: maximum length of 25 cm H. (Panningothuria) austrinabassa sp. nov. and (H. forskali in Koehler, 1921); well-developed tuberculated H. (Panningothuria) forskali are sister species. Fully developed papillae dorsally and laterally; collar of inconspicuous oral tables are abundant in the body wall of H. austrinabassa sp. papillae; single dorsal stone canal and madreporite (pers. nov., but reduced tables, similar to those in H. forskali, are comm. for H. forskali by Giomar Helena Borrero Perez); tables present in the tentacles. Both species lack buttons and rosettes the only ossicles in body wall; stout cuvierian tubules. in the body wall. Rowe (1969) also noted a collar of oral papillae VandenSpiegel et al. (1995) noted and illustrated three- in H. forskali. An inconspicuous irregular collar is evident only dimensional, irregularly spherical, mesh-like, “bud-supporting in the largest of the H. austrinabassa specimens. It is premature ossicles” for H. forskali. Similar ossicles are present in the to either raise Panningothuria to generic status or create a papilla apices of H. austrinabassa. Both species occur at synonymy (discussed below). Types were not designated for Holothuria forskali Delle exceptional depths for holothuriids. Perez-Ruzafa et al. (1987) Chiaje, 1823, and the author of the species referred to the reported H. forskali from the Mediterranean at depths of image of an undescribed species illustrated by Forsskål (1776). 0–193 m, and the Canary Is at a depth of 348 m. H. austrinabassa Koehler (1921) stated that the two characters that distinguish has been taken as deep as 800 m. Sequence data indicate signifi cant H. forskali amongst Mediterranean species are the very dark separation of these sister species (discussed below). Signifi cant colour and presence of a cuvierian organ, although other morphological differences also are detailed in Table 2. Table 3. Characters distinguishing H. (Halodeima) nigralutea O’Loughlin sp. nov. and H. (Halodeima) edulis Lesson Characters H. nigralutea H. edulis Colour Discontinuous black over yellow Dorsal black, ventral fuschia (red); or dorsal “grey”, ventral cream Ventral black stripe Present Absent Dark brown spots Only at papillae and tube feet Additional to papillae and tube feet Depth 100 m, on continental slope 0–20 m (Rowe and Gates, 1995) Table 4. Characters distinguishing H. (Halodeima) signata Ludwig and H. (Halodeima) edulis Lesson Characters H. signata H. edulis Colour Grey brown with cream spots Dorsal black, ventral fuschia (red); or dorsal “grey”, ventral cream Length Mostly 5–15 cm Mostly 10–25 cm Tables Narrower spire (10–15 μm at narrowest) Broader spire (15–20 μm at narrowest) Rosettes Mostly simple (mostly 2–5 perforations) Simple to complex (2–15+ perforations) Habit Cryptic in reef during day Exposed on sand during day Table 5. Pairwise uncorrected p-distances among specimens of H. edulis complex 1 2 3 4 5 6 7 8 9 1. H. nigralutea N120 2. H. nigralutea G255 0.002 3. H. edulis brown N3 0.028 0.028 4. H. edulis typical J292 0.024 0.024 0.010 5. H. edulis fuschia K140 0.013 0.011 0.023 0.016 6. H. edulis typical G104 0.011 0.010 0.024 0.021 0.008 7. H. edulis grey J282 0.015 0.013 0.024 0.018 0.005 0.010 8. H. edulis grey J296 0.013 0.011 0.023 0.016 0.003 0.008 0.005 9. H. signata G50 0.062 0.060 0.058 0.058 0.058 0.057 0.058 0.055 10. H. signata G55 0.066 0.065 0.066 0.063 0.063 0.062 0.063 0.060 0.023 New Holothuria species 43 Figure 5. a, live paratype of Holothuria (Halodeima) nigralutea O’Loughlin sp. nov, from Western Australia, off Point Cloates (220 mm long; NMV F111290; photo by Karen Gowlett-Holmes). b, preserved holotype of H. (Halodeima) nigralutea, from Western Australia, off Point Cloates (148 mm long; upper dorsal, lower ventral; oral end right; NMV F120437; photos by David Staples). c, lectotype of Holothuria edulis Lesson, 1830 from Indonesia, Moluccan Is (160 mm long; MNHN EcHh 543; upper dorsal, lower ventral; photos by Yves Samyn). d, live H. (Halodeima) edulis, from Japan, Okinawa (not collected, photo by Gustav Paulay). e, live H. (Halodeima) edulis, from northern Australia (not collected, photo by Neville Coleman). f, live atypical “grey” form of H. (Halodeima) edulis, from Japan, Okinawa (UF E3882, photo by Gustav Paulay). 44 P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn Figure 6. Holothuria (Halodeima) nigralutea O’Loughlin sp. nov. (SEM of ossicles from NMV F111290). A, dorsal body wall; B, ventral body wall; C, anal body wall; D, tube feet; E, tentacles; F, respiratory trees; G, madreporite.