loading

Logout succeed

Logout succeed. See you again!

ebook img

New insights into the molecular phylogeny and taxonomy of the family Issidae (Hemiptera: Auchenorrhyncha: Fulgoroidea) PDF

release year2020
file size0.43 MB

Preview New insights into the molecular phylogeny and taxonomy of the family Issidae (Hemiptera: Auchenorrhyncha: Fulgoroidea)

Proceedings of the Zoological Institute RAS Vol. 324, No. 1, 2020, pp. 146–161 10.31610/trudyzin/2020.324.1.146 UDK 595.753 New insights into the molecular phylogeny and taxonomy of the family Issidae (Hemiptera: Auchenorrhyncha: Fulgoroidea) V.M. Gnezdilov1*, F.V. Konstantinov1, 2 and S.Y. Bodrov1 1Zoological Institute, Russian Academy of Sciences, 1 Universitetskaya Emb., Saint Petersburg 199034, Russia; e-mails: [email protected], [email protected] 2Saint Petersburg State University, 7/9 Universitetskaya Emb., Saint Petersburg 199034 Russia; e-mail: [email protected] ABSTRACT The phylogenetic relationships among major lineages of the planthopper family Issidae were explored by analyzing a molecular dataset of nine fragments (COI, CytB, 12S, H3, 16S, 18SII, 18SIII, 28S D3–D5, 28S D6–D7) and 48 terminal taxa. Bayesian and Maximum likelihood analyses yielded similar and mostly well-resolved trees with moderate to high support for most branches. The obtained results suggest subdivision of the family Issidae Spinola into two subfamilies, Issinae Spinola, 1839 (= Thioniinae Melichar, 1906, = Hemisphaeriinae Melichar, 1906) and Hysteropterinae Melichar, 1906. The Issinae was clustered into the tribes Issini Spinola, 1839, with the sub- tribes Issina Spinola, 1839 and Thioniina Melichar, 1906, Sarimini Wang, Zhang et Bourgoin, 2016, Parahiraciini Cheng et Yang, 1991, Hemisphaeriini Melichar, 1906, and Kodaianellini Wang, Zhang et Bourgoin, 2016. The Hysteropterinae incorporates the rest of Western Palaearctic taxa except Issina. Chimetopini Gnezdilov, 2017, stat. nov. is elevated to tribe from the subtribal level. Most well-supported clades showed clear geographical patter- ing. Newly obtained data contradicts the scenario of an early split of American Thioniinae from other Issidae and possible origin of the family in the New World, while the combination of Palaearctic Issus Fabricius and Latissus Dlabola with Oriental and American taxa in one well supported clade may serve as an evidence for a common an- cestor for extant Oriental, American, and Palaearctic issids. Key words: Hyteropterinae, Issinae, Issina, Issini, molecular phylogeny, taxonomy, Thioniina Новый взгляд на молекулярную филогению и систематику семейства Issidae (Hemiptera: Auchenorrhyncha: Fulgoroidea) В.М. Гнездилов1*, Ф.В. Константинов1, 2 и С.Ю. Бодров1 1Зоологический институт Российской академии наук, Университетская наб. 1, 199034 Санкт-Петербург, Россия; e-mails: [email protected], [email protected] 2Санкт-Петербургский государственный университет, Университетская наб. 7/9, 199034 Санкт-Петербург, Россия; e-mail: [email protected] РЕЗЮМЕ Выявлены филогенетические отношения среди основных групп семейства Issidae по результатам анализа 9 генных фрагментов (COI, CytB, 12S, H3, 16S, 18SII, 18SIII, 28S D3–D5, 28S D6–D7) и 48 видов. Использование Байесова анализа и анализа максимального правдоподобия позволили полу- чить схожие и, в основном, хорошо разрешенные древеса с умеренной или высокой поддержкой боль- шинства ветвей. Полученные результаты позволяют подразделить семейство Issidae Spinola на два * Corresponding author / Автор-корреспондент Molecular phylogeny of Issidae 147 подсемейства – Issinae Spinola, 1839 (= Thioniinae Melichar, 1906, = Hemisphaeriinae Melichar, 1906) и Hysteropterinae Melichar, 1906. Подсемейство Issinae в свою очередь распадается на трибы Issini Spinola, 1839, с подтрибами Issina Spinola, 1839 и Thioniina Melichar, 1906, Sarimini Wang, Zhang et Bourgoin, 2016, Parahiraciini Cheng et Yang, 1991, Hemisphaeriini Melichar, 1906 и Kodaianellini Wang, Zhang et Bourgoin, 2016. Подсемейство Hysteropterinae объединяет все западнопалеарктические таксоны за исключени- ем Issina. Chimetopini Gnezdilov, 2017, stat. nov. повышена в ранге до трибы. Клады с наибольшей под- держкой показывают явные географические паттерны. Полученные данные противоречат сценарию раннего отделения американских Thioniinae от других Issidae и возможному возникновению семейства в Новом Свете, в то время как комбинация палеарктических Issus Fabricius и Latissus Dlabola с ориен- тальными и американскими таксонами в составе одной, хорошо поддержанной клады Issinae, свиде- тельствует в пользу существования общего предка для современных ориентальных, американских и палеарктических иссид. Key words: Hyteropterinae, Issinae, Issina, Issini, молекулярная филогения, систематика, Thioniina INTRODUCTION The classification of the family since the group was established by Spinola (1839) was developed by The family Issidae Spinola, 1839 is a worldwide Melichar (1906), Fennah (1954), Dlabola (1987), and distributed group of planthoppers with more than Gnezdilov (2002, 2003, 2007, 2009, 2013a, 2016c). 1000 species described in nearly 200 genera (Gnez- Particularly Gnezdilov (2013a) treated the family dilov 2013a, 2016a; Bourgoin 2019) authentically Issidae comprising one subfamily Issinae Spinola, known since Eocene (Gnezdilov and Bourgoin 1839 with three tribes – Issini Spinola, 1839, Hemi- 2016). The Western Palaearctic and Oriental regions sphaeriini Melichar, 1906, and Parahiraciini Cheng harbour the richest faunas of the family while the et Yang, 1991. The tribe Thioniini Melichar, 1906 was Afrotropical issid fauna is poor and Australian one placed in synonymy under Issini (Gnezdilov 2009). is still mostly undescribed (Gnezdilov 2013a, 2016a). Later Gnezdilov (2016c, 2017a) resurrected the sub- Apparently rich Neotropical issid fauna is still in its tribe Thioniina Melichar, 1906 in the tribe Issini and initial stage of discovering (Gnezdilov 2018b, 2019a; erected the subtribe Chimetopina Gnezdilov, 2017 Gnezdilov and Bartlett 2018). In dry habitats of to accommodate African taxa with well-developed Western Palaearctic region issid species are associ- hind wings. Finally Gnezdilov and Bartlett (2018) ated with trees and shrubs, e.g. Quercus, Astragalus, and Gnezdilov (2018a, 2018b, 2019a) resurrected the Amygdalus, Atraphaxis, Spiraea, and Echinospartum subfamily Thioniinae Melichar, 1906, with the tribes species, and grasses, e.g. Alhagi, Artemisia, Festuca, Thioniini, comprising three subtribes (Thioniina, Tanacetum species etc. (Emeljanov 1969, 1978; Oronoquina Gnezdilov, 2018, Waoraniina Gnezdilov Dla bola 1980; Mitjaev 2002; Gnezdilov and Agu- et Bartlett, 2018), Guianaphrynini Gnezdilov, 2018, in-Pombo 2014; Gnezdilov et al. 2019). In tropical and Cordelini Gnezdilov, 2019 (Table 1). areas issids inhabit forest canopies (Meng et al. 2013; Despite considerable progress in taxonomic stu- Gnezdilov 2015; Gnezdilov et al. 2010; Gnezdilov dies, no phylogenetic treatment of the group had been and Bartlett 2018; Barringer et al. 2019), small trees published until recently. Starting from 2015 several and shrubs in the forests or cereals in opened places studies appeared dealing with phylogeny of Issidae (Gnezdilov 2013c, 2016b). Some species, e.g. Agal- based on morphological (Gnezdilov 2016a, 2016c) matium bilobum (Fieber, 1877) and Thabena brun- and on molecular data (Gnezdilov et al. 2015; Sun nifrons (Bonfils, Attie et Reynaud, 2001), are widely et al. 2015; Wang et al. 2016). Before these studies polyphagous and were easily distributed across the some species of the family Issidae were involved in world (Gnezdilov and O’Brien 2006; Chan et al. the molecular analysis devoted to the phylogeny of 2013). Many issid species are peculiarly subbrachy- Fulgoroidea as a whole or issidoid group of families pterous, with beetle-shaped forewings (Gnezdilov comprising Issidae, Caliscelidae, Tropiduchidae, No- et al. 2014), and flightless which makes this group of godinidae, and Acanaloniidae (Yeh et al. 1998, 2005; particular importance for historic biogeography and Yeh and Yang 1999; Bourgoin et al. 1997; Urban and evolution of terrestrial biota. Cryan 2007; Song and Liang 2013). 148 Gnezdilov et al. Table 1. Current classification of the family Issidae. Subfamily Issinae Spinola, 1839 Subfamily Hysteropterinae Melichar, 1906 Tribe Issini Spinola, 1839 Groups of genera recognized by Gnezdilov (2016a, 2016c). Subtribe Issina Spinola, 1839 Phylogenetic analysis is in progress. Subtribe Thioniina Melichar, 1906 Subtribe Oronoquina Gnezdilov, 2018, Subtribe Waoraniina Gnezdilov et Bartlett, 2018 Tribe Chimetopini Gnezdilov, 2017 Tribe Guianaphrynini Gnezdilov, 2018 Tribe Cordelini Gnezdilov, 2019 Tribe Sarimini Wang, Zhang et Bourgoin, 2016 Tribe Kodaianellini Wang, Zhang et Bourgoin, 2016 Tribe Hemisphaeriini Melichar, 1906 Subtribe Hemisphaeriina Melichar, 1906 Subtribe Mongolianina Wang, Zhang et Bourgoin, 2016 Tribe Parahiraciini Cheng et Yang, 1991 Sun with coauthors (Sun et al. 2015) built the tium Emeljanov, 1971 and Hysteropterum Amyot et first phylogenetic tree of Issidae based on sequences Serville, 1843 with a support 90, which resulted later of 18S and Wg of 34 species from 20 genera using in synonymization of Hysteropterina Melichar, 1906 Bayesian analysis. In this study the monophyly and Agalmatiina Gnezdilov, 2002 (Gnezdilov 2016c). of Issidae was weakly supported (0.61), but three Wang et al. (2016) provided new phylogenetic well supported clades were recognized within the analysis and classification of the family Issidae based family which corresponds to Issini sensu Gnezdilov on 18S, two parts of 28S (D3–D5, D6–D7), COI (2009) or Sarimini + Kodaianellini sensu Wang et and CytB genes sequences from 79 species belong- al. (2016), Hemisphaeriini, and Parahiraciini. The ing to 50 genera using both Maximum likelihood two latter clades were sister groups on the tree with and Bayesian analyses. According to the resulting a support 0.84. Unfortunately several terminal taxa classification, the family Issidae was divided into were misidentified by the authors, e.g. the species three subfamilies with seven tribes. In particular, the identified as Sivaloka Distant, 1906 in fact belongs to subfamily Thioniinae, with the tribe Thioniini, was the genus Kodaianella Fennah, 1956, Jagannata sp.1 reestablished to accommodate Neotropical issids as and Jagannata sp.2 belong to the genus Eusarima an independent lineage sister to all other Issidae in- Yang, 1994, while Kodaiana sp. in fact belongs to the cluding the subfamilies Issinae, with the tribes Issini genus Thabena Stål, 1866. Correct identifications and Hysteropterini, for Palaearctic issids, and Hemi- were made by the senior author during his visit to sphaeriinae, with the tribes Hemisphaeriini, Koda- North-West A&F University in Yangling (Shaanxi, ianellini Wang, Zhang et Bourgoin, 2016, Sarimini China) (unpublished). Wang, Zhang et Bourgoin, 2016, and Parahiraciini, Gnezdilov with coauthors (Gnezdilov et al. 2015) for Oriental, Australian, and African issids. American published phylogenetic study of issidoid families genus Picumna Stål, 1864 was provisionally placed of Fulgoroidea sensu Gnezdilov (2013b) based on in the Hemisphaeriinae as well (Wang et al. 2016). sequences of COI, 28S (D4, D5, and D6), and 18S However three years later Zhao et al. (2019) describ- (helix 17 – helix 50) of 32 species from 29 genera of ing new genus of Hemisphaeriini suggested another Issidae, Caliscelidae, Tropiduchidae, Nogodinidae, topology for the family recovering subfamily rank Ricaniidae, Dictyopharidae, Flatidae, and Aphro- for Hysteropterinae – Thioniinae, Hysteropterinae, phoridae as an outgroup. Seventeen issid species from Issinae + Hemisphaeriinae (Zhao et al. 2019, fig. 22). 14 genera were involved in this study. Parsimony In the same paper reassessment of the subtribal divi- analysis revealed polyphyly of the genus Bubastia sion of the Hemisphaeriini proposed by Wang with Emeljanov, 1975. Soon after Gnezdilov (2016a) coauthors (Wang et al. 2016) was suggested. Based performed a Bayesian analysis on the same dataset mainly on the same data Bourgoin with coauthors and revealed sister positions of the genera Agalma- (Bourgoin et al. 2018) proposed a calibrated molecu- Molecular phylogeny of Issidae 149 lar tree of Issidae and suggested early Cretaceous template with the following protocol: an initial dena- origin of the group (110 Mya) with a basal split of turation 5’ at 94 °C for 5 min, followed by 35 cycles the family between Neotropical taxa (Thioniinae) of denaturation in 40 s at 94 °C, 40 s annealing at and other Issidae (Issinae + Hemisphaeriinae) which 48–58° (see Table 3), 1 min elongation at 72 °C, and is congruent with the opening of the South Atlantic a final elongation for 10 min at 72 °C. The amplifi- Ocean separating South America and Africa. cation was performed with 0.4 µM of each primer Gnezdilov (2016a, 2016b) based on the analysis of using a ScreenMix reaction mixture (Evrogen, morphological and biogeographical data proposed a Russia) containing DNA polymerase, dNTP, MgCl2 phylogeny of the subtribe Issina Spinola (all Western and enhancers at optimal concentrations. Amplified Palaearctic taxa included) and suggested Eocenian fragments were purified with a PCR purification kit origin of Issidae in the Oriental Region with the sub- (Evrogen, Russia). Purified PCR products were se- sequent dispersal to the Palaearctic region, Africa, quenced in both directions at Evrogen Inc. and Australia, and to the New World via Beringia. All sequences were checked using BLAST Aiming to get a better understanding of phy- through the NCBI database (https://blast.ncbi.nlm. logenetic relationships within Issidae and to test nih.gov/Blast.cgi). Forward and reverse sequenc- previously suggested phylogenetic hypotheses we es were concatenated and manually verified with assemble a new molecular dataset that includes 48 Geneious Prime 2019.03 (https://www.geneious. terminals representing all major issid clades and data com). The 18S gene was sequenced in two over- on nine fragments (COI, CytB, 12S, H3, 16S, 18SII, lapping parts using the coupled primers 3F-Bi and 18SIII, 28S D3–D5, 28S D6–D7). A2–9R and subsequently spliced into one sequence. Obtained sequences were aligned with data on 16 species taken from Genbank. The accession numbers MATERIAL AND METHODS for all sequences are provided in Table 2. Sequence Taxon sampling summary statistics are given in Table 4 including information on total/average length and base fre- This study incorporates 48 species out of 43 ge- quencies. Alignment was completed using the Muscle nera comprising 46 ingroup taxa representing main algorithm (Edgar 2004) and subsequently checked in tribes of the family Issidae and two outgroups from Geneious. All genes were concatenated in Sequence the families Fulgoridae and Kinnaridae. Thirty two Matrix 1.7.8 (Vaidya et al. 2011) to create a master species were directly sequenced by us for nine mark- alignment of 5587 bp. ers, including four mitochondrial (COI, CytB, 12S, 16S), and five nuclear (H3, 18SII, 18SIII, 28S D3– Phylogenetic analysis D5, 28S D6–D7) fragments. Sequences of CytB, H3, 18S, 28S D3–D5, and 28S D6–D7 for 16 included Bayesian estimation search (BI) was performed species were downloaded from NCBI and were main- using MrBayes (Ronquist et al. 2011) on the ly received by Wang et al. (2016). Voucher specimens CIPRES Science Gateway V3.1 Portal. Two runs sequenced in this study are retained in the Auchenor- with 12 chains were running simultaneously for 12 × rhyncha collection of the Zoological Institute of the 106 generations with 0.1 temperature setting; burn-in Russian Academy of Sciences in Saint Petersburg was set at 25%. We applied the most complex model (see Table 2). GTR+G+I applied to each partition, as it usually provides a better fit for real data (Arenas 2015; Abadi DNA sequencing and alignment et al. 2019). Chains were sampled every 1000 genera- tions and the respective trees written to a tree file. Total genomic DNA was extracted from thoracic After the analysis the stdout file was checked to en- musculature of the specimens preserved in 96% al- sure that the average standard deviation of split fre- cohol using a Termo Scientific GeneJET Genomic quencies was below 0.01. Fifty-percent majority-rule DNA Purification Kit with the standard protocol. consensus trees and posterior probabilities of clades Primer pairs used for amplification are provided were calculated using the trees sampled after the in Table 3. PCRs were performed in a 20 µL reac- chains converged. The posterior probability supports tion mixture contacting 1–2 µL of genomic DNA are provided on Fig. 1. 150 Gnezdilov et al. y y y y y y y y y y Source Present stud Present stud Present stud Present stud Present stud Present stud Urban & Cryan, 2007 Present stud Wang et al., 2016 Wang et al., 2016 Present stud Present stud Wang et al., 2016 Present stud Wang et al., 2016 Wang et al., 2016 6-D7 6956 6957 6958 6959 6960 6961 6962 2864 6963 6964 6965 2811 D 6 6 6 6 6 6 6 0 6 6 6 0 S N2 N2 N2 N2 N2 N2 N2 X7 N2 N2 N2 X7 28 M M M M M M M K M M M K a, 2016c). 28S D3-D5 MN266987 MN266988 MN266989 MN266990 MN266991 MN266992 MN266993 KX761410 MN266994 MN266995 KX761412 MN266996 KX761453 KX761452 dilov 2016 18S MN165781 MN165782 MN165783 MN165784 MN165785 MN165786 DQ532543 MN165787 KX702829 KX702838 MN165788 MN165789 KX761565 MN165790 KX702824 KX702823 z Gne 704 705 706 707 708 709 710 711 712 d after 16S MN227 MN227 MN227 MN227 MN227 MN227 MN227 MN227 MN227 e m 6 5 7 8 9 0 1 2 6 6 6 6 6 7 7 7 na S 96 96 96 96 96 96 96 96 are 12 N21 N21 N21 N21 N21 N21 N21 N21 e M M M M M M M M a erin 374 376 377 378 696 379 380 381 375 opt H3 267 267 267 267 532 267 267 267 267 ter MN MN MN MN DQ MN MN MN MN s y H 1 2 3 4 5 6 9 8 2 1 oups in CytB MN19152 MN19152 MN19152 MN19152 MN19152 MN19152 KX70287 KX70288 KX70291 KX70291 r g generic COI N194180 N194181 N194182 N194183 N194184 N194185 ( M M M M M M s genetic analysi cimen identifier P_ISSID G025 P_ISSID G005 P_ISSID G017 P_ISSID G034 P_ISSID G020 P_ISSID G018 P_ISSID G012 P_ISSID G028 P_ISSID G004 P_ISSID G016 hylo Spe ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS titions used in p Taxonomy Hystero pterum-group Bubastia-group Issini, Thioniina Kervillea-group Bubastia-group Bubastia-group Issini, Thioniina Conosimus- group Sarimini Sarimini Fulgoridae Sarimini Hemisphaeriini Bubastia-group Parahiraciini Parahiraciini r Table 2. Taxa and molecular pa SpeciesLocality Agalmatium flavescens Russia(Olivier, 1791) Anatolodus musivus TurkeyDlabola, 1982 Balduza una Mexico(Ball, 1910) Bootheca taurus Bulgaria(Oshanin, 1870) Bubastia josifovi BulgariaDlabola, 1980 GreeceBubastia sp. Cheiloceps argo USA(Fennah, 1949) Conosimus coelatus FranceMulsant et Rey, 1855 Dactylissus armillarius VietnamGnezdilov et Soulier-Perkins, 2014 Darwallia barbata VietnamGnezdilov et Bourgoin, 2014 Dorysarthrus UAEmobilicornis Puton, 1895 Euroxenus vayssieresi Reunion(Bonfils, Attie et Reynaud, 2001) Euxaldar lenis VietnamGnezdilov, Bourgoin et Wang, 2017 Falcidius limbatus Italy(A. Costa, 1864) Flavina hainana China(Wang et Wang, 1999) Thabena litaoensis China(Yang, 1994) Molecular phylogeny of Issidae 151 d. y y y y y y y y y y Continue2. Source Wang et al., 2016 Present stud Present stud Present stud Present stud Wang et al., 2016 Present stud Present stud Present stud Present stud Wang et al., 2016 Wang et al., 2016 Wang et al., 2016 Present stud Present stud Wang et al., 2016 Table D6-D7 02861 66966 66967 66968 66969 02802 66970 66971 66972 02859 02856 66973 66974 02813 S X7 N2 N2 N2 N2 X7 N2 N2 N2 X7 X7 N2 N2 X7 28 K M M M M K M M M K K M M K 3-D5 1405 6997 6998 6999 7000 1441 7001 7002 7003 1402 1528 7004 7005 1455 D 6 6 6 6 6 6 6 6 6 6 6 6 6 6 S X7 N2 N2 N2 N2 X7 N2 N2 N2 X7 X7 N2 N2 X7 28 K M M M M K M M M K K M M K 4 1 2 3 4 4 5 6 7 2 7 1 8 9 6 3 9 9 9 9 1 9 9 9 3 2 6 9 9 2 8 7 7 7 7 8 7 7 7 8 8 5 7 7 8 S 2 5 5 5 5 2 5 5 5 2 2 1 5 5 2 18 X70 N16 N16 N16 N16 X70 N16 N16 N16 X70 X70 X76 N16 N16 X70 K M M M M K M M M K K K M M K 3 4 5 6 7 8 9 1 1 1 1 1 1 1 7 7 7 7 7 7 7 S 7 7 7 7 7 7 7 16 N22 N22 N22 N22 N22 N22 N22 M M M M M M M 3 4 5 6 7 8 9 0 1 7 7 7 7 7 7 7 8 8 6 6 6 6 6 6 6 6 6 S 9 9 9 9 9 9 9 9 9 12 N21 N21 N21 N21 N21 N21 N21 N21 N21 M M M M M M M M M 2 3 4 5 6 6 7 8 8 8 8 8 8 8 8 8 3 3 3 3 3 3 3 3 H3 267 267 267 267 267 267 267 267 N N N N N N N N M M M M M M M M 84 27 28 29 02 30 31 32 82 80 10 33 34 14 CytB X7028 N1915 N1915 N1915 X7029 N1915 N1915 N1915 X7028 X7028 X7615 N1915 N1915 X7029 K M M M K M M M K K K M M K 6 7 8 9 0 8 8 8 8 9 OI 941 941 941 941 941 C 1 1 1 1 1 N N N N N M M M M M fier 13 30 19 24 09 22 33 31 06 01 nti G0 G0 G0 G0 G0 G0 G0 G0 G0 G0 de D D D D D D D D D D n i SI SI SI SI SI SI SI SI SI SI me IS IS IS IS IS IS IS IS IS IS ci P_ P_ P_ P_ P_ P_ P_ P_ P_ P_ Spe ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS ni m- ni ni ni Taxonomy Hemisphaerii Hysteropterugroup Issini, Issina Issini, Issina Kervillea- group Kodaianellini Kervillea- group Bubastia- group Bubastia- group Issini, Issina Hemisphaerii Parahiraciini Hemisphaerii Mycterodus- group Mycterodus- group Hemisphaerii Locality Philippines France Italy Italy Slovenia China Bulgaria Greece Greece Slovenia Vietnam China China Greece Armenia China Species Hemisphaerius coccinelloides (Burmeister, 1834) Hysteropterum dolichotum Gnezdilov et Mazzoni, 2004 Issus coleoptratus (Fabricius, 1781) Issus lauri Ahrens, 1814 Kervillea conspurcata (Spinola, 1839) Kodaianella bicincti-frons Fennah, 1956 Latematium latifrons (Fieber, 1877) Latilica antalyica (Dlabola, 1986) Latilica oertzeni (Matsumura, 1910) Latissus dilatatus (Fourcroy, 1785) Macrodaruma pertinax Fennah, 1978 Macrodarumoides petalinus Che, Zhang et Wang, 2012 Mongoliana triangu-laris Che, Wang et Chou, 2003 Mycterodus drosopou-losi Dlabola, 1982 Mycterodus goricus (Dlabola, 1958) Opthalmosphaerius trilobulus (Che, Zhang et Wang, 2006) 152 Gnezdilov et al. d. y y y y y y y y y y y y Continue2. Source Present stud Present stud Present stud Present stud Wang et al., 2016 Present stud Present stud Wang et al., 2016 Wang et al., 2016 Wang et al., 2016 Present stud Present stud Present stud Present stud Present stud Present stud Table D6-D7 66975 66977 66976 66978 02808 66979 66980 02807 66981 66982 66983 66984 66985 66986 S N2 N2 N2 N2 X7 N2 N2 X7 N2 N2 N2 N2 N2 N2 28 M M M M K M M K M M M M M M S D3-D5 N267006 N267008 N267007 N267009 X761447 N267010 N267011 X761457 X761445 N267012 N267013 N267014 N267015 N267016 N267017 28 M M M M K M M K K M M M M M M 00 02 01 03 19 04 39 41 17 05 06 07 08 09 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 S 5 5 5 5 2 5 2 2 2 5 5 5 5 5 5 18 N16 N16 N16 N16 X70 N16 X70 X70 X70 N16 N16 N16 N16 N16 N16 M M M M K M K K K M M M M M M 0 2 1 3 4 5 6 7 8 2 2 2 2 2 2 2 2 2 7 7 7 7 7 7 7 7 7 S 7 7 7 7 7 7 7 7 7 16 22 22 22 22 22 22 22 22 22 N N N N N N N N N M M M M M M M M M 2 3 4 5 6 7 8 9 8 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 S 9 9 9 9 9 9 9 9 2 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 N N N N N N N N M M M M M M M M 9 1 0 2 3 4 6 7 8 9 8 9 9 9 9 9 9 9 9 9 3 3 3 3 3 3 3 3 3 3 H3 267 267 267 267 267 267 267 267 267 267 N N N N N N N N N N M M M M M M M M M M 5 6 7 2 9 6 7 8 9 0 1 3 3 3 5 8 1 0 3 3 4 4 CytB N1915 N1915 N1915 X7615 X7028 X7029 X7029 N1915 N1915 N1915 N1915 M M M K K K K M M M M 2 1 3 4 5 6 9 9 9 9 9 9 OI 941 941 941 941 941 941 C 1 1 1 1 1 1 N N N N N N M M M M M M fier 10 29 27 02 11 08 15 21 14 07 32 03 nti G0 G0 G0 G0 G0 G0 G0 G0 G0 G0 G0 G0 de D D D D D D D D D D D D n i SI SI SI SI SI SI SI SI SI SI SI SI me IS IS IS IS IS IS IS IS IS IS IS IS ci P_ P_ P_ P_ P_ P_ P_ P_ P_ P_ P_ P_ Spe ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS ZIS na m- na Taxonomy Bubastia- group Kinnaridae Issinae Issini, Thionii Sarimini Phasmena- group Kervillea- group Kodaianellini Parahiraciini Parahiraciini Mycterodus- group Hysteropterugroup Issini, Thionii Mycterodus- group Mycterodus- group Mycterodus- group y Localit Portugal UAE Mexico Mexico China Kazakh-stan Bulgaria Vietnam China China Turkey Portugal Mexico Turkey Italy Greece Species Palmallorcus punctulatus (Rambur, 1840) Perloma brunnescens (Emeljanov, 1984) Picumna sp. Proteinissus bilimeki Fowler, 1904 Sarima bifurca Meng et Wang, 2016 Scorlupaster heptapotamicum Mitjaev, 1971 Scorlupella discolor (Germar, 1821) Tetricissus philo (Fennah, 1978) Tetricodes songae Zhang et Chen, 2009 Tetricodissus pandlineus Wang, Bourgoin et Zhang, 2015 Thalassana ephialtes (Linnavuori, 1971) Tingissus guadarramense (Melichar, 1906) Traxus fulvus Metcalf, 1923 Tshurtshurnella bicolorata Gnezdilov et Oezgen, 2018 Tshurtshurnella zelleri (Kirschbaum, 1868) Zopherisca penelopae (Dlabola, 1974) Molecular phylogeny of Issidae 153 Table 3. Primer sequences and annealing temperatures. Region Primer Direction Sequence Source Tm 2183 Fwd CAACATTTATTTTGATTTTTTGG Simon et al. (1994) COI 48 UEA8 Rev AAAAATGTTGAGGGAAAAATGTTA Lunt et al. (1996) Cytb_F Fwd GTTCTACCTTGAGGTCAAATATC CytB Song & Liang (2013) 56 Cytb_R Rev TTCTACTGGTCGTGCTCCAATTCA AF Fwd ATGGCTCGTACCAAGCAGACVGC H3 Ogden & Whiting (2003) 48 AR Rev ATATCCTTRGGCATRATRGTGAC ai Fwd AAACTAGGATTAGATACCCTATTAT 12S Simon et al. (1994) 48 bi Rev AAGAGCGACGGGCGATGTGT Full_16S_F Fwd CCGGTTTGAACTCAGATCATGTAA 16S Song & Liang (2013) 48 Full_16S_R Rev ATTTATTGTACCTTTTGTATCAG 3F Fwd GTTCGATTCCGGAGAGGGA Giribet et al. (1996) 18S II 56 Bi Rev GAGTCTCGTTCGTTATCGGA Urban & Cryan (2007) A2 Fwd ATGGTTGCAAAGCTGAAAC Urban & Cryan (2007) 18S III 58 9R Rev GATCCTTCCGCAGGTTCACCTAC Giribet et al. (1996) 28S 28S Ai Fwd GACCCGTCTTGAAACACG Belshaw & Quicke (2002) 54 D3-D5 28S D4D5r Rev GTTACACACTCCTTAGCGGA 28S 28S EE Fwd CCGCTAAGGAGTGTGTAA Cryan et al. (2000) 54 D6-D7 28S MM Rev GAAGTTACGGATCTARTTTG Table 4. Summary statistics of genes used for phylogeny. Sequence length Base frequencies Number Identical Pairwise Region of taxa sites, % identity, % Longest Shortest Average %A %T %C %G COI 17 584 550 571.5 60.6 85.1 36.0 34.3 15.9 13.8 CytB 35 639 592 610.3 40.4 78.9 38.1 33.5 18.6 9.6 H3 27 370 249 344.8 64.3 88.3 23.0 16.7 31.8 28.0 12S 25 346 260 319.5 20.8 78.4 23.9 47.5 7.0 15.6 16S 25 583 397 500.5 51.8 84.1 29.3 44.4 9.1 17.1 18S 46 1856 651 1475.8 31.5 87.5 22.5 23.7 24.5 28.4 28S D3-D5 43 712 611 677.3 58.9 94.1 23.1 18.6 25.3 32.1 28S D6-D7 40 810 671 752.8 60.1 90.6 20.4 19.2 26.9 33.2 Maximum Likelihood (ML) analysis was per- strap iterations and a subsequent thorough ML search, formed using RAxML (Stamatakis 2016) via the using the General-Time-Reversible (GTR) algorithm CIPRES Science Gateway V. 3.3 (http://www.phylo. with gamma distributed substitution rates and invari- org/sub_sections/portal/) (Miller et al., 2010). We able sites (GTR+I+G) for each partition independent- used RAxML-HPC BlackBox tool with 10000 boot- ly. The bootstrap supports are provided on Fig. 2. 154 Gnezdilov et al. RESULTS digitate processes on the inner side of the dorsolateral lobes of the phallobase (Gnezdilov 2016c, figs 1–4). Tree topologies recovered by both BI and ML This group retained many ancestral characters with- analyses were largely congruent (Figs 1, 2). The ML in Western Palaearctic Issidae (Gnezdilov 2016a, tree shows less resolution and did not recover Issini 2017a) including bi-lobed hind wings, with vannal and Parahiraciini as monophyletic groups, while the cleft only and anal lobe reduced to a small appendage BI analysis recovering both tribes with high support with simple second anal vein. Issus pospisili Dlabola, (93% and 100% respectively). Nodes of the major 1958 has hind wing with partly fused Pcu and anteri- clades are numbered from 1 to 12. or branch of first anal vein (Gnezdilov 2017a, Fig. 22) Node 1 (BI: 100; ML: 77) supports the monophy- which apparently relates Issina to Oriental issid taxa ly of the subfamily Issinae (= Thioniinae, = Hemi- and to American subtribe Thioniina sensu Gnezdilov sphaeriidae Melichar, 1906) sensu Gnezdilov (2009, (2018a). 2013a). This clade includes Issini, Thioniinae and Node 5 (BI: 100; ML: 78) corresponds to the Hemisphaeriinae sensu Wang et al. (2016) or Issina subtribe Thioniina sensu Gnezdilov (2018a) with sensu Gnezdilov (2002) + Hemisphaeriini + Para- inclusion of American taxa, characterized by reduced hiraciini sensu Gnezdilov (2013a) (Table 5). In this or rudimentary hind wings, and to the subfamily combination of taxa the subfamily Issinae is defined Thioniinae sensu Wang et al. (2016) (Table 5). for the first time. Many taxa of this subfamily are Node 6 (BI: 100; ML: 100) the tribe Sarimini characterized by furcating CuA on forewings and sensu Wang et al. (2016) was not recovered in our well-developed hind wings. analysis (Figs 1, 2). However all genera currently Node 2 (BI: 100; ML: 69) represents the subfam- assigned to this group (Wang et al. 2016; Gnezdilov ily Hysteropterinae and comprises Hysteropterini 2019b) are characterized by tri-lobed hind wings sensu Wang et al. (2016) or Issina, excluding Issus with deep cubital cleft and often with CuA and Cup Fabricius, 1803 and Latissus Dlabola, 1974, sensu fusing apically with flattening. The genus Euroxenus Gnezdilov (2016a, 2016c), or Hysteropterina + Agal- Gnezdilov, 2009 also shares these characters and matiina sensu Gnezdilov (2002). This clade includes might belong to this group from the morphological Western Palaearctic taxa with rudimentary anal lobe standpoint. of hind wings, without vannal cleft or with reduced Node 7 (BI: 100; not recovered in ML) corre- hind wings (Gnezdilov 2016a). sponds to Parahiraciini sensu Wang et al. (2016) and Node 3 (BI: 93; not recovered in ML) forms the Gnezdilov (2017b). Most included genera are charac- tribe Issini and combines Western Palaearctic Issus terized by bi-lobed hind wing, with deep cubital cleft Fabricius and Latissus Dlabola together with all and more or less reduced anal lobe. American taxa involved in the current analysis viz., Node 8 (BI: 90; ML: 88) represents the tribe Balduza Gnezdilov et O’Brien, 2006, Proteinissus Hemisphaeriini sensu Wang et al. (2016) and con- Fowler, 1904, Cheiloceps Uhler, 1895, and Traxus tains genera with hemisphaerical fore wings and Metcalf, 1923. In this combination of taxa the tribe single-lobed or rudimentary hind wings. Issini is defined for the first time. The composition of Node 9 (BI and ML: 93) forms the tribe Kodai- this clade may serve as a confirmation of the syno- anellini. Members of this tribe are united by the three- nymy of Issini and Thioniini proposed by Gnezdilov lobed hind wings, with large remigial lobe and small (2009) since Cheiloceps Uhler belongs to the subtribe remigio-vannal and anal lobes (Wang et al. 2016). Thioniina Melichar sensu stricto (Gnezdilov 2018a) Node 10 (BI: 100; ML: 92) corresponds to the and was previously treated in Thionia sensu lato. Kervillea group of genera sensu Gnezdilov (2016a, However the clade is not supported by morphological 2016c). These genera are characterized by a peculiar data and requires further study. structure of the phallobase with a pair of long folds Node 4 (BI: 100; ML: 100) corresponds to the which frequently conceals ventrally its ventral lobe subtribe Issina sensu Gnezdilov (2002) and Issus and separated lobes of gonoplacs (Gp 1 and Gp 2) group of genera sensu Gnezdilov (2016a, 2016c). (Gnezdilov 2016a, 2016c). This clade includes two genera Issus Fabricius and Node 11 (BI: 69; ML: 59) represents the Myctero- Latissus Dlabola which are morphologically related dus group of genera sensu Gnezdilov (2016a, 2016c). by a unique synapomorphy – the presence of paired This group is united by the structure of penis with Molecular phylogeny of Issidae 155 Fig. 1. Bayesian 50% consensus tree based on combined dataset (BI). Nodes of the major clades are numbered and refer to text. Each node is documented with its posterior probability supports.

See more

The list of books you might like