loading

Logout succeed

Logout succeed. See you again!

ebook img

Novel Plant-Specific Cyclin-Dependent Kinase Inhibitors Induced by Biotic and Abiotic Stresses PDF

pages20 Pages
release year2007
file size3.01 MB
languageEnglish

Preview Novel Plant-Specific Cyclin-Dependent Kinase Inhibitors Induced by Biotic and Abiotic Stresses

JBC Papers in Press. Published on June 28, 2007 as Manuscript M703326200 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M703326200 Novel Plant-Specific Cyclin-Dependent Kinase Inhibitors Induced by Biotic and Abiotic Stresses* Adrian Peres‡, Michelle L. Churchman§, Srivaidehirani Hariharan¶||, Kristiina Himanen¶||, Aurine Verkest¶||, Klaas Vandepoele¶||, Zoltan Magyar¶||, Yves Hatzfeld‡, Els Van Der Schueren¶||, Gerrit T.S. Beemster¶||, Valerie Frankard‡, John C. Larkin§, Dirk Inzé¶||, and Lieven De Veylder¶||,1 From the ‡CropDesign N.V., B-9052 Ghent, Belgium, §Department of Biological Sciences, Louisiana State ¶ University, Baton Rouge, Louisiana 70803, USA, Department of Plant Systems Biology, Flanders Institute for Biotechnology (VIB), 9052 Gent, Belgium, and || Department of Molecular Genetics, Ghent University, 9052 Gent, Belgium Running title: A novel class of plant-specific CDK inhibitors The EL2 gene of rice (Oryza sativa), according to sequence similarity (2, 3). A-type previously classified as early response gene CDKs are most closely related to the mammalian against the potent biotic elicitor N- CDK1 and CDK2, contain the characteristic acetylchitoheptaose and encoding a short PSTAIRE amino acid sequence in their cyclin- polypeptide with unknown function, was binding domain, and play a role at both the G1-to- D identified as a novel cell cycle regulatory gene S and G2-to-M transition points. By contrast, the ow n related to the recently reported SIAMESE plant-specific B-type CDKs hold a divergent lo a d (SIM) gene of Arabidopsis thaliana. By cyclin-binding domain and control the G2-to-M e d performing iterative two-hybrid screens, in transition only (1). The A- and B-type CDKs fro m vitro pull-down assays, and fluorescence probably form complexes with cyclins of type A, h ttp resonance energy transfer analyses, Orysa;EL2 B, and D. D-type cyclins respond to external and ://w was found to bind the cyclin-dependent kinase internal growth signals, such as hormones and w w (CDK) CDKA1;1 and D-type cyclins. No carbohydrate levels (4, 5). They operate at the G1- .jb c interaction was observed with the plant- to-S transition point, although they might control .o rg specific CDK CDKB1;1. The amino acid motif the G2-to-M transition as well (6-9). A-type b/ y ELERFL was identified to be essential for cyclins are mainly produced from the onset of the gu e s cyclin, but not for CDK binding. Orysa;EL2 S phase until the middle of the G2 and B-type t o n impaired the ability of Orysa;CYCD5;3 to cyclins, specifically from G2 until the end of N o complement a budding yeast (Saccharomyces mitosis (1, 10). ve m cerevisiae) triple CLN mutant, whereas Because of their sessile life style, it is be recombinant protein inhibited CDK activity in plausible that plants have developed mechanisms r 17 vitro. Moreover, Orysa;EL2 was able to rescue that allow them to adjust their cell cycle in , 20 1 8 the multicellular trichome phenotype of sim response to environmental cues. Both biotic and mutants of Arabidopsis, unequivocally abiotic stress stimuli negatively affect plant demonstrating that Orysa;EL2 operates as a growth through the inhibition of the cell cycle cell cycle inhibitor. Orysa;EL2 mRNA levels machinery. Salinity inhibits Arabidopsis root were induced by cold, drought, and propionic growth by reducing the pool of dividing cells in acid. Our data suggest that Orysa;EL2 encodes the meristem (11, 12). Likewise, in leaves of a new type of plant CDK inhibitor that links wheat (Triticum aestivum) and maize (Zea mays), cell cycle progression with biotic and abiotic water stress induces a shortening of the meristem stress responses. and prolongs cell cycle duration as a result of As in other eukaryotic organisms, in plants reduced CDK activity (13, 14). On the biotic side, cell division is controlled by the timely and spatial cell cycle activity is inhibited in parsley activation of multi-subunit complexes that are (Petroselium crispum) and tobacco (Nicotiana minimally composed of a catalytic cyclin- tabacum) cell cultures upon treatment with fungal dependent kinase (CDK)2 and a regulatory cyclin elicitors (15, 16). subunit (1). The model plant species Arabidopsis Perception of biotic and abiotic stress thaliana counts up to 12 CDKs and 49 cyclins signals activates signaling cascades that trigger that have been grouped into different types ion fluxes, kinase cascades, the generation of Copyright 2007 by The American Society for Biochemistry and Molecular Biology, Inc. 2 reactive oxygen species, and accumulation of antimitogenic hormones, such as abscisic acid (ABA) and jasmonic acid. These signaling EXPERIMENTAL PROCEDURES molecules stimulate cell cycle checkpoints, resulting into an impaired G1-to-S transition, Yeast two-hybrid experiments--The full- slowing down of DNA replication, and/or delayed length Orysa;CYCD5;3 open-reading frame was entry into mitosis (16-20). Still, insight is lacking amplified by polymerase chain reaction (PCR) into the molecular mechanisms that link the stress with gene-specific primers and subcloned into the perception directly to the cell cycle machinery. pBD-GAL4 Cam vector (Stratagene, La Jolla, Putative candidate proteins are CDK inhibitors CA), resulting into the pBD-GAL4:CYCD5;3 bait (CKIs). In mammals, seven CKIs have been plasmid. The Orysa;EL2 bait construct was identified, which, based on structural and obtained by cloning the Orysa;EL2 cDNA into a biochemical features, belong to two very distinct GATEWAY-modified pBD-GAL4 vector classes. Members of the INK4 family (p15INK4b, (Invitrogen, Carlsbad, CA). Orysa;EL2 cDNA p16INK4a, p18INK4c, and p19INK4d) are characterized was amplified from rice (Oryza sativa L. cv. by the presence of multiple ankyrin repeats and Nipponbare) with gene-specific primers with attB selectively inhibit G1-specific CDKs (CDK4 and adaptors, cloned into the pDONRTM201 ENTRY CDK6). In contrast, inhibitors of the Kip/Cip vector (Invitrogen) by an attB x attP (BP) family (p21Cip1, p27Kip1, and p57Kip2) bind and recombination reaction, and subsequently D o w inhibit a broader range of CDKs involved in the mobilized into the pBD-GAL4 vector by an attL x n lo control of the G1-to-S transition (21). Until attR (LR) recombination reaction. All constructs ad e recently, only one class of plants CKIs has been were confirmed by sequencing. The cDNA library d fro described whose members were designated as used for the two-hybrid screens was prepared with m h Kip-Related Proteins (KRPs), because of their RNA extracted from rice cell suspension cultures ttp similarity with the mammalian Kip/Cip proteins, harvested 0, 3, 6, 9, and 12 days after subculture ://w w but some members are also known as Interactors in fresh medium. Equimolar amounts (100 µg) of w of Cdc2 Kinases (ICKs) (21). Of late, a second total RNA from each sample were used to purify .jbc .o putative CKI was found, distantly related to the poly(A)+ mRNA with the Poly(A) Quick mRNA rg b/ ICK/KRPs, known as SIAMESE (SIM) (22). SIM Isolation kit (Stratagene). The cDNA was y g u interacts with A-type CDKs and D-type cyclins synthesized and subcloned into the HybriZAP-2.1 e s and its overproduction results into a strong λ vector according to the manufacturer's t on N inhibition of cell division activity. However, instructions (Stratagene). Approximately 2x106 o v e biochemical proof of its inhibitory activity is still independent plaque-forming units were produced, m b lacking. No plant homologs to the mammalian with an average insert size of 1 kb. The library er 1 INK4 or yeast inhibitors have been discerned so was amplified once to yield 2x109 plaque-forming 7, 2 0 far (2). units/ml. Screens were performed with the PJ69- 18 Here, we demonstrate that the Orysa;EL2 4a (MATa; 23) yeast strain according to a protocol protein of rice (Oryza sativa), recognized as a described previously (23). The cDNA inserts from novel D-type cyclin-interacting protein, interferes interacting clones were amplified by PCR and with the ability of plant D-type cyclins to sequenced. For pairwise two-hybrid interactions, complement a yeast strain deficient in its G1 different combinations between bait (pBD- cyclins, suggesting that Orysa;EL2 acts as an GAL4:OSCYCD5) and prey constructs were novel CKI. In agreement, Orysa;EL2 expression transformed into yeast cells and assayed for their was able to rescue the multicellular trichome ability to grow on histidine-deficient minimal phenotype of sim mutants of Arabidopsis, whereas media at 30°C. the recombinant Orysa;EL2 protein efficiently Sequence analysis--Conserved protein inhibited the activity of purified CDKs. The domains were detected with MEME (24), whereas Orysa;EL2 gene was transcriptionally induced by domain matches on the different protein biotic and abiotic stress treatments, implying that sequences were identified with a combination of Orysa;EL2 might coordinate stress perception and MEME and HMMer (25). Multiple sequence cell cycle progression. alignments were generated with CLUSTALW (26). 3 Yeast complementation--The yeast grown in a Luria-Broth medium to an A of 1 at 600 tetracycline-repressible expression vector 37°C. Production of GST-fusion proteins was pCM190 (27) was made GATEWAY compatible. induced by the addition of 1 mM isopropyl-D- The resulting pTHGW vector contained the attR1 galactoside for 6 h. The GST-fusion proteins were site of the GATEWAY cassette, directly upstream purified with glutathione-Sepharose 4B (GE- of the tetracycline-repressible iso-1-cytochrome C Healthcare) according to the manufacturer's (CYC1) promoter. The rice cyclin protocol. Subsequently, a total of 500 µg total Orysa;CYCD5;3 full-length coding sequence was protein extracted from a 2-day-old dividing transferred into the pTHGW destination vector Arabidopsis cell culture was mixed with 3 µl of from a pDONR-CYCD5;3 entry clone by LR beads from a dilution series (100x, 10x, and 1x). cloning, yielding the pTH-CYCD5 vector. To The pull down was performed in a total volume of obtain the pADH-EL2 expression vector, the 200 µl of homogenization buffer (HB; 25 mM GAL4 activation domain was removed from the Tris-Cl, pH 7.6, 75 mM NaCl, 15 mM MgCl , 2 pAD-GAL4 (Stratagene) by digestion, and the 15 mM ethylene glycol-bis(β-aminoethyl ether) GATEWAY cassette C was inserted, resulting N,N,N',N'-tetraacetic acid, 15 mM p- into the pADHGW construct. The Orysa;EL2- nitrophenylphosphate, 60 mM β- coding sequence was introduced into pADHGW glycerophosphate, 1 mM dithiothreitol, 0.1% by LR cloning. The resulting plasmids pTH- Nonidet P-40, 0.1 mM Na VO , 1 mM NaF, and 3 4 CYCD5 and pADH-EL2 (or pTHGW and protease inhibitor cocktail P9599 [Sigma-Aldrich, D o w pADHGW as controls) were transformed alone or St. Louis, MO]) and incubated on a rotating wheel n lo in pairs into the yeast CLN mutant strain Bf305- for 2 h at 4°C. The bead-bound fractions were ad e 15d-21 (MATa leu 2-3, 112his3-11, 15ura3-52 washed three times with HB. The beads were d fro trp1 ade1 met14; arg5,6 GAL1-CLN3 HIS3::cln 1 divided in two parts: one part for kinase assay and m h TRP1::cln2) with the Frozen-EZ Yeast one fraction was resuspended in 1x sodium ttp Transformation II kit (ZymoResearch, Orange, dodecyl sulfate loading buffer and boiled. Proteins ://w w CA). The complementation analyzed according to were separated on 12% sodium dodecyl sulfate- w .jb Hsieh et al (28). polyacrylamide gel electrophoresis and blotted c .o FRET analysis--FRET analysis using onto Immobilon-P membranes (Millipore, rg b/ onion epidermal cells was performed as described Bedford, MA). Filters were blocked overnight at y g u (22). 4°C in 3% (v/v) milk powder in 25 mM Tris-HCl, e s sim complementation analysis--The full pH 8, 150 mM NaCl, and 0.05% Tween20, and t on N length Orysa;EL2-coding region was introduced incubated for 1 h at 4°C with a cdc2(anti- o v into the GATEWAY® compatible vector PSTAIRE):sc-53 (1/1000) (Santa Cruz em b e pLEELA-pGL2 (a gift from Dr. Arp Schnittger) Biotechnology, Santa Cruz, CA) or anti-GST r 1 7 by an LR recombination reaction, placing the (1/2000) (GE-Healthcare) antibodies in blocking , 2 0 Orysa;EL2 open reading frame under direct buffer. Antigen-antibody complexes were 18 control of the GLABRA2 promoter. The resulting detected with horseradish peroxidase–conjugated plasmid was introduced into Agrobacterium IgG diluted 1/10000 (GE-Healthcare) with a tumefacians by electroporation, and chemiluminescence system (Perkin-Elmer, subsequently into sim-1 plants via the floral dip Norwalk, CT). method (29). Transgenic plants were planted in Expression and purification of soil, then sprayed with 1 mM phosphinothricin Orysa;EL2--The Orysa;EL2 gene was cloned in after the first leaves had established, and. an expression vector for E. coli (30), containing a resistant plants were inspected for His-tagged NusA fusion partner. After induction complementation of the sim phenotype. at 20°C with isopropyl-ß-D-thiogalactopyranoside Glutathione S-transferase (GST) pull-down for 16 h, the cells were lysed and loaded on an assays--The open-reading frames of Orysa;EL2 IMAC column (Ni Sepharose HP; GE- and Orysa;el2ELERLF were cloned into pGEX4T-1 Healthcare). The fusion part was removed (GE-Healthcare, Little Chalfont, UK). The enzymatically with His-tagged caspase-3 at an obtained plasmids were transformed in the engineered DEVD site immediately preceding the Escherichia coli BL21-codonPlus(DE3)-RIL Orysa;EL2 mature sequence. The protein was strain (Novagen, Madison, WI). E. coli cells were further purified on a mono-Q ion exchange 4 column (GE-Healthcare) and a Ni-Sepharose Superscript III first-strand cDNA synthesis kit IMAC column. The monomeric Orysa;EL2 was (Invitrogen), respectively, according to the polished on a gel filtration column while the manufacturers' instruction. Multiplex PCR buffer was changed to phosphate-buffered saline, reactions were carried out on an LC480 Q-RT- concentrated, and stored at -80°C. For kinase PCR machine (Roche Diagnostics, Brussels, assays, Arabidopsis cells were harvested from Belgium) in 384-well plates. Specific primers actively dividing cell cultures and either used used were: 5'-CTCAGCAGCAGGGGAAGG-3' immediately or snap-frozen in liquid nitrogen and (forward primer) and 5'- stored at -70°C. The cells were ground in liquid AGGTGAAGGTTGGCATTATTGG–3' (reverse nitrogen and proteins were extracted in HB. Equal primer) for Orysa;EL2 and 5'- amounts of total protein were incubated with TTGTGTTGGACTCTGGTGATGG–3' (forward 100 µl of 25% (v/v) p10CKS1At-Sepharose beads primer) and 5'- overnight at 4°C on a rotary shaker. For CCGTCAGGATCTTCATGAGGTAAT–3' immunoprecipitations, 300 µg of total protein in (reverse primer) for Orysa;ACTIN1 HB were precleared with 30 µl of 50% (v/v) (Os03g50890). The transcript level of the protein A-sepharose beads (GE-Heathcare) for 1 h Orysa;ACTIN1 gene was used as an internal at 4°C. After a short centrifugation, the precleared control. cDNA was amplified for multiplex PCR supernatants were transferred to new Eppendorf with SYBR Green I master mix (Roche tubes containing CDKA;1 (1/250) or CDKB1;1 Diagnostics) according to the manufacturer's D o w (1/100) antibodies (31, 32) and incubated at 4°C instructions. Relative expression levels of n lo for 2 h. In the following step, 30 µl of 50% (v/v) Orysa;EL2 were determined by the comparative ad e protein A-Sepharose was added, and the tubes ∆Ct method (34) and normalized by subtracting d fro were incubated on a rotating wheel for 1 h at 4°C. the average Ct values of the triplicate reactions for m h Thereafter, beads were washed three times with the Orysa;ACTIN1 gene under control conditions ttp 20 mM Tris-HCl, pH 7.4, 5 mM from those of the Orysa;EL2, resulting into the ://w w ethylenediaminetetraacetic acid, 2 mM ethylene ∆Ct values. The ∆Ct values of the treated samples w .jb glycol-bis(β-aminoethyl ether) N,N,N',N'- were subtracted from the ∆Ct values of the control c .o tetraacetic acid, 100 mM NaCl, 2 mM NaF, 0.2% samples, resulting into ∆Ct values. The fold rg b/ Nonidet P-40, 300 µM phenylmethylsulfonyl changes of the gene expression between two y g u fluoride, and 10 µg/ml aprotinin and pepstatin, samples were calculated with the ∆Ct in the e s and used for CDK activity reactions. Kinase formula: fold change = 2∆∆Ct t on N assays were performed as described (33). Meta-analysis of Arabidopsis EL2-like o v e Stress treatment, RNA preparation, and gene expression--With the "Response Viewer" m b e quantitative PCR--Seeds of rice were germinated tool of GENEVESTIGATOR, the expression r 1 7 in sand saturated with water in the dark. After profiles of genes to different stimuli were , 2 0 5 days, the germinating seedlings were transferred analyzed (35). For more information on the 1 8 to 24-multiwell tissue culture plates (Falcon, BD described experiments, see Biosciences, San Jose, CA) filled with tap water, https://www.genevestigator.ethz.ch. Only biotic and grown at 55% relative humidity, a and abiotic stress treatments with a more that 2- temperature regime of 28°C day/22°C night, with fold change in transcription level for at least one an 11-h day length at 3,000 Lux light intensity for of the EL2-like genes were taken into account. 2 more days. Seven-day-old seedlings at leaf Fold-change values were hierarchically clustered stage 2 were exposed to salinity, heat (37°C), cold for genes and experiments by average linkage in (4°C), drought, ABA (100 µM), or propionic acid "Multiple Experiment Viewer" of The Institute for (1.5 mM). Control plants were kept in tap water. Genome Research After stress treatment, the seedlings were cut at (http://www.tm4.org/index.html). the crown region with a clean sterile blade. The seeds, roots, and first leaves were discarded. Each RESULTS sample was collected in triplicate, each biological sample containing four seedlings. Total RNA and Orysa;EL2 is a novel D-type cyclin- first-strand cDNA were prepared with the RNeasy interacting protein--To identify novel rice plant mini kit (Qiagen, Hilden, Germany) and proteins that control the G1-to-S transition of the 5 plant cell cycle, a yeast two-hybrid screen was (NLS) and TGA5 proteins were used (39). FRET performed with a D-type cyclin of rice efficiency was evaluated by the increase in donor Orysa;CYCD5;3 (Os03g10650) as bait. For the fluorescence after photobleaching of the acceptor screening, a galactose 4 (GAL4) activation molecule, in cells that produceded YFP:CYCD5;3 domain cDNA fusion library was used, (as acceptor) together with either CFP:EL2 or constructed with RNA isolated from an actively CFP:el2ELERLF (as donors). When measuring the dividing rice cell suspension culture. A total of fluorescence intensity of CFP:EL2 before and 106 independent yeast cotransformants were after YFP photobleaching, an average increase in screened, resulting into 31 positive colonies. Most fluorescence of 11.4% was seen for CFP:EL2, cDNA clones (77%) encoded a small protein of demonstrating that Orysa;EL2 interacted in vivo 106 amino acids (predicted molecular mass of with Orysa;CYCD5;3 (Fig. 3; Table 1). No FRET 11.6 kDa), identical to the Orysa;EL2 protein was observed for CFP:el2ELERLF. By contrast, an (Os03g01740) whose gene had originally been efficient FRET signal was noticed for both identified as an early-response gene upon CFP:EL2 and CFP:el2ELERLF in the presence of elicitation with N-acetylchitoheptaose, a potent YFP:CDKA1;1. (Table 1), again indicating that biotic elicitor for phytoalexin biosynthesis genes the interaction between Orysa;EL2 and (36). Orysa;EL2 has no sequence homology with Orysa;CDKA1;1 is independent of the ELERLF any characterized functional protein but shares a motif. No significant association was observed small peptide domain of six amino acids with the between Orysa;EL2 and Orysa;CDKB1;1 or D o w ICK/KRPs (Fig. 1). Alignment of Orysa;EL2 with Orysa;CDKD;1. Interestingly, both Orysa;EL2 n lo ICK/KRPs yielded the E[ILM][ED][EDR][FL]F and Orysa;CYCD4;1 localized specifically into a d e consensus motif (in bold, the most frequently the nucleus (Fig. 3). d fro occurring residues). Sequence similarity searches To confirm the interaction of Orysa;EL2 m h with this domain as a query identified one related with CDKA;1, an in vitro pull-down experiment ttp protein from rice (Fig. 1). Also six Arabidopsis was done with a glutathione GST-EL2 fusion ://w w proteins were found, among which the recently protein. In addition, a GST protein fused to the w described SIM protein (22). The EIEDFF domain Orysa;el2ELERLF protein with the mutated cyclin- .jbc .o resides into the mapped cyclin-binding domain of binding domain was used. After extensive rg b/ KRPs (37). To test whether the ELERLF motif is washing, bound proteins were eluted and used for y g u required for cyclin binding, it was mutated into a protein gel blot analyses with an anti-PSTAIRE e s stretch of alanine residues, resulting into the antibody, which specifically recognizes A-type t on mutant el2ELERLF protein that did not interact with CDKs. Whereas no CDKs were found to associate No v e Orysa;CYCD5;3 (Fig. 2). with the mock-treated sample, a clear CDK signal m b Orysa;EL2 binds Orysa;CDKA1;1--To was seen for the GST-EL2 beads (Fig 4A). Also er 1 identify other Orysa;EL2-interacting proteins, a the mutant Orysa;el2ELERLF associated with CDKs, 7, 2 0 two-hybrid screen was performed with the ableit the with reduced affinity. A dilution series 1 8 Orysa;EL2 protein as bait. Among the interacting of bead-bound recombinant proteins was prepared clones, Orysa;CYCD4;1 (Os09g29100) and to obtain pull downs with similar amounts of CDKA1;1 (Os03g02680) were identified. The CDKs. The CDK activity associated with the interaction between Orysa;EL2 and purified complexes was measured. More kinase Orysa;CDKA1;1 did not depend on the ELERLF activity was detected with the GST-el2 than the motif (Fig. 2). Orysa;EL2 did not associate with GST-EL2 fraction (Fig. 4B), indicating that the other CDKs tested, such as Orysa;CDKB2;1 and ability of Orysa;EL2 to interact with cyclins is Orysa;CDKD;1 (Fig. 2). essential to exert its role as a CDK inhibitor. The protein-protein interactions observed Orysa;EL2 abolishes rescue of the CLN with the two-hybrid system were confirmed by budding yeast mutant by plant D-type cyclins--A FRET experiments. As a positive-control FRET functional interaction between Orysa;EL2 and protein pair, the Arabidopsis transcription factor Orysa;CYCD5;3 was demonstrated with the TGA (At5g06960), whose self-interaction in mutant budding yeast strain BF305-15d-21 that plants had previously been detected by FRET lacks two out of its three G1-specific cyclins analysis (38), was used. As a negative control, the (CLN1 and CLN2) and is conditionally deficient noninteracting LexA-nuclear localization signal for the third one (CLN3). In the presence of 6 galactose, the CLN3 gene is expressed and cells that SIM is required to suppress cell division are able to divide. When transferred to glucose- during hair development, according to its containing media, CLN3 expression is repressed anticipated role as CKI. To test whether and cells become arrested in G1 (40). When Orysa;EL2 was able to complement the sim BF305-15d-21 cells were transformed with an trichome phenotype, sim mutant plants were expression vector containing the Orysa;CYCD5;3 transformed with a construct harboring the gene (pTH-CYCD5), cells resumed growth Orysa;EL2 construct under the control of the (Fig. 5), indicating that Orysa;CYCD5;3 encodes trichome-specific GLABRA2 promoter. In 12 out a functional cyclin able to complement a CLN of the 14 transgenic lines obtained, Orysa;EL2 mutant yeast strain. By contrast, when the was able to completely rescue the multicellular Orysa;CYCD5;3-expressing yeast strain was trichome phenotype (Fig. 6), demonstrating that transformed with an Orysa;EL2-expressing Orysa;EL2 and Arath;SIM are functionally construct, containing the Orysa;EL2 cDNA related. sequence under the control of the alcohol Orysa;EL2 is transcriptionally induced dehydrogenase 1 (ADH1) promoter, Orysa;EL2 upon stress treatment--Because of its observed hampered the ability of Orysa;CYCD5;3 to elicitation with N-acetylchitoheptaose, the complement the BF305-15d-21 strain (Fig. 5). transcriptional response of Orysa;EL2 toward Cell proliferation was completely inhibited, different stress treatments was tested in 7-day-old illustrating that Orysa;EL2 blocked the function of rice seedlings. Stresses applied included heat D o w Orysa;CYCD5;3 in yeast. (37°C), cold (4°C), and drought. Steady-state n lo Orysa;EL2 is a functional CKI in vitro-- mRNA levels were slightly reduced by heat, but ad e The observed interaction of Orysa;EL2 with remarkably strongly induced by 4 h of cold d fro CDKs and cyclins and its interference with the treatment (Fig. 7A). This induction was even more m h capability of the Orysa;CYCD5;3 cyclin to pronounced after 24 h of cold (Fig. 7B). At this ttp complement the yeast CLN mutant suggested that time point, Orysa;EL2 was also induced by ://w w Orysa;EL2 could operate as an inhibitor of drought. Transcript levels did not change upon w .jb CDK/cyclin complexes. To test this hypothesis, treatment with the antimitogenic hormone ABA c .o CDK/cyclin complexes were purified from cell (Fig. 7A,B), suggesting that induction of rg b/ suspension culture extracts either by affinity Orysa;EL2 by cold and drought occurred in an y g chromatography with p10CKS1At-Sepharose beads ABA-independent manner. Orysa;EL2 was also ue s or by immunoprecipitation with specific upregulated by propionic acid that triggers t on N antibodies for CDKA;1 and CDKB1;1. cytoplasmic acidification, a downstream effect in o v e Recombinant Orysa;EL2 was added to the N-acetylchitoheptaose elicitation (41). m b e affinity-purified CDKs and kinase activity was With the GENEVESTIGATOR toolbox, r 1 7 measured with histone H1 as substrate. CDK the expression pattern of the six Arabidopsis , 2 0 activity did not decrease significantly upon SIM/EL2-like genes in response to different biotic 18 addition of Orysa;EL2 to p10CKS1At-Sepharose- and abiotic stress treatments was examined in purified complexes (Fig. 4C,D). By contrast, more than 2,500 publicly available microarray Orysa;EL2 was found to be a potent inhibitor of experiments (35). The different family members immunopurified CDKA;1 complexes (Fig. 4C, were induced under various stress conditions, D). CDKA;1 activity was only partially inhibited. albeit with different specificity (Fig. 7C). Addition of a higher quantity of Orysa;EL2 did Arath;SMR5 A(t1g07500) and Arath;SRM3 not result in a stronger inhibition of CDK activity (At5g02420) were activated by all or most stress (data not shown). Orysa;EL2 inhibited only conditions, respectively, whereas other EL2-like slightly B-type CDK activity at the highest dose genes responded more specifically. Interestingly, applied (Fig. 4C,D). distinct family members reacted often in a Orysa;EL2 complements the Arabidopsis complementary manner; for example, Arath;SIM sim phenotype--Orysa;EL2 shows sequence (At5g04470) and Arath; SMR1 (At3g10525) were similarity to the recently reported SIM gene (22). induced by the nematode Heterodera schachtii, In Arabidopsis, trichome cells are unicellular. By but down-regulated upon infection with the contrast, recessive mutations in the SIM gene pathogen Pseudomonas syringae, whereas gives rise to multicellular trichomes, indicative Arath;SMR2 (At1g08180) and Arath; SMR3 7 (At5g02420) had the opposite behavior. model has been put forward for plants in which D- type cyclins act as primary sensors linking external and internal growth signals with cell DISCUSSION division activity, as illustrated by the cytokinin- independent growth of Orysa;CYCD3;1- We identified the Orysa;EL2 protein as a overexpressing calli or the delayed activation of potent key regulator in the series of events that the cell cycle machinery in seeds of D-type cyclin might transduce the early response of biotic and knockout lines when sown under favorable abiotic stresses directly to the cell cycle. conditions (48, 49). The specific interaction of Orysa;EL2, previously characterized as a gene Orysa;EL2 with D-type cyclins suggests that the induced within minutes after addition of the signaling cascades that arrest the cell cycle in elicitator N-acetylchitoheptaose or purified response to biotic and abiotic stress signals flagellin protein of the pathogen Ps. avenae (36, directly impinge on the CYCD/CDK complexes. 42), was demonstrated here to encode a D-type In such a model, the balance between cyclin-binding protein that inhibits CDK activity. CYCD/CDK complexes and EL2-like proteins EL2-like proteins can be found in mono- and might be a critical parameter to decide whether dicotyledonous plants, but no homologs are cells divide or not. known in non-plant species, indicating that this In mammals, interaction between Kip/Cip family of CKIs is plant specific. proteins and cyclins is controlled by the presence D o w Recombinant Orysa;EL2 protein in the CKIs of one or more ZRXL amino acid n lo specifically inhibited CDKA;1, but not CDKB1;1 motifs (with Z basic or cysteine and X a d e activity, a feature shared with the previously preferentially basic). This ZRXL motif is found in d fro described ICK/KRPs (23). The interaction with other cyclin-interacting proteins, such as E2F1, m h CDKA;1 must probably be direct, because both p107, and p130 (50, 51) and is present in most ttp the wild-type Orysa;EL2 and its mutant isoform Orysa;EL2-related sequences, but only in some of ://w w with deleted cyclin-binding domain pulled-down the ICK/KRPs. Moreover, mutation of the ZRXL w the CDK subunit. However, compared to the wild- motif does not impair the binding of ICK2/KRP2 .jbc .o type isoform, the mutant Orysa;el2 was less with D-type cyclins (unpublished results), rg b/ efficient in pulling down CDKs, indicating that suggesting that a motif different from ZRXL y g u beside a direct interaction Orysa;EL2 also controls the interaction of ICK/KRPs and EL2- e s partially interacts indirectly with CDKs, probably like proteins with D-type cyclins. By mutational t on N through the binding of cyclins. Remarkably, CDK analysis, we identified the EIEDFF domain that is o v complexes purified on p10CKS1At beads were not shared by all EL2-like proteins and ICK/KRPs as em b inhibited, suggesting that either CKS1At and a cyclin-binding motif. This particular domain er 1 7 Orysa;EL2 compete for the same CDK-binding resides into the presumed cyclin-binding domain , 2 site or that p10CKS1At lacks affinity for the of ICK/KRPs (37). Moreover, its mutation 01 8 Orysa;EL2 target complexes. Human p9CKShs1 and hampers the association between Orysa;EL2 and yeast p13SUC1 do not bind the mammalian G1- Orysa;CYCD5;3 and is probably important for specific CDK4 and CDK6 complexes (44, 45). CDK inhibition. The EIEDFF motif can be found Analogously, fission yeast (Schizosaccharomyces also in other potential plant cyclin-interacting pombe) cdc2 associates only to p13SUC1 during proteins, such as retinoblastoma-binding protein mitosis (46). Selective CDK binding by p13SUC1 2-like proteins and the DNA mismatch repair has been demonstrated for maize as well, where protein PMS2. EL2-like and ICK/KRPs share only M- but not S-associated CDK complexes some other small peptide sequences proteins, but, were found to bind p13SUC1 (47). Therefore, the because they are only shared between a few lack of inhibition of p10CKS1At-associated CDKs members of each protein class, they might play a complexes by Orysa;EL2 might indicate that the role in fine-tuning the activity of specific family main targets of Orysa;EL2 can be found among members. G1/S-phase-associated CDK complexes. In Orysa;EL2 was able to complement the support for a role during G1-to-S, Orysa;EL2 sim trichome phenotype, illustrating that both interacts only with D-type cyclins and not with A- genes are functionally related. Interestingly, in sim or B-type cyclins. Analogously as for mammals, a mutants, the trichomes do not only undergo 8 mitotic cell division, but display as well an inhibition of their endoreduplication program (52). These data point toward a role for the SIM protein at the mitosis-to-endocycle switch during trichome development. Our results on Orysa;EL2 suggest that this transition might be achieved through inhibition of specific CDK/cyclin complexes. Therefore, the EL2/SIM genes might not only operate as sensors of antimitogenic stimuli, but also play important roles during developmental processes. REFERENCES 1. Inzé, D., and De Veylder, L. (2006) Annu. Rev. Genet. 40, 77-105. 2. Vandepoele, K., Raes, J., De Veylder, L., Rouzé, P., Rombauts, S., and Inzé, D. (2002) Plant Cell 14, 903-916. 3. Wang, G., Kong, H., Sun, Y., Zhang, X., Zhang, W., Altman, N., dePamphilis, C. W., and Ma, H. (2004) Plant Physiol. 135, 1084-1099. D o w 4. Oakenfull, E. A., Riou-Khamlichi, C., and Murray, J. A. H. (2002) Phil. Trans. R. Soc. Lond. B n lo 357, 749-760. ad e 5. Soni, R., Carmichael, J. P., Shah, Z. H., and Murray, J. A. H. (1995) Plant Cell 7, 85-103. d fro 6. Schnittger, A., Schöbinger, U., Bouyer, D., Weinl, C., Stierhof, Y.-D., and Hülskamp, M. (2002) m h Proc. Natl. Acad. Sci. USA 99, 6410-6415. ttp 7. Kono, A., Umeda-Hara, C., Lee, J., Ito, M., Ichimiya, H., and Umeda, M. (2003) Plant Physiol. ://w w 132, 1315-1321. w .jb 8. Koroleva, O. A., Tomlinson, M., Parinyapong, P., Sakvarelidze, L., Leader, D., Shaw, P., and c .o Doonan, J. H. (2004) Plant Cell 16, 2364-2379. rg b/ 9. Menges, M., Samland, A. K., Planchais, S., and Murray, J. A. H. (2006) Plant Cell 18, 893-906. y g u 10. Menges, M., de Jager, S. M., Gruissem, W., and Murray, J. A. H. (2005) Plant J. 41, 546-566. e s 11. Burssens, S., Himanen, K., van de Cotte, B., Beeckman, T., Van Montagu, M., Inzé, D., and t on N Verbruggen, N. (2000) Planta 211, 632-640. o v e 12. West, G., Inzé, D., and Beemster, G. T. S. (2004) Plant Physiol. 135, 1050-1058. m b e 13. Schuppler, U., He, P.-H., John, P. C. L., and Munns, R. (1998) Plant Physiol. 117, 667-678. r 1 7 14. Granier, C., Inzé, D., and Tardieu, F. (2000) Plant Physiol. 124, 1393-1402. , 2 0 15. Logemann, E., Wu, S.-C., Schröder, J., Schmelzer, E., Somssich, I. E., and Hahlbrock, K. (1995) 18 Plant J. 8, 865-876. 16. Kadota, Y., Watanabe, T., Fujii, S., Higashi, K., Sano, T., Nagata, T., Hasezawa, S., and Kuchitsu, K. (2004) Plant J. 40, 131-142. 17. Reichheld, J.-P., Vernoux, T., Lardon, F., Van Montagu, M., and Inzé, D. (1999) Plant J. 17, 647- 656. 18. Kadota, Y., Watanabe, T., Fujii, S., Maeda, Y., Ohno, R., Higashi, K., Sano, T., Muto, S., Hasezawa, S., and Kuchitsu, K. (2005) Plant Cell Physiol. 46, 156-165. 19. Šwiątek, A., Azmi, A., Stals, H., Inzé, D., and Van Onckelen, H. (2004) FEBS Lett. 572, 118-122. 20. Šwiątek, A., Lenjou, M., Van Bockstaele, D., Inzé, D., and Van Onckelen, H. (2002) Plant Physiol. 128, 201-211. 21. Sherr, C. J., and Roberts, J. M. (1999) Genes Dev. 13, 1501-1512. 9 22. Churchman, M. L., Brown, M. L., Kato, N., Kirik, V., Hülskamp, M., Inzé, D., De Veylder, L., Walker, J. D., Zheng, Z., Oppenheimer, D. G., Gwin, T., Churchman, J., and Larkin, J. C. (2006) Plant Cell 18, 3145-3157. 23. De Veylder, L., De Almeida Engler, J., Burssens, S., Manevski, A., Lescure, B., Van Montagu, M., Engler, G., and Inzé, D. (1999) Planta 208, 453-462. 24. Bailey, T. L., and Elkan, C. (1994) In Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, R. Altman, D. Brutlag, Karp, P., R. Lathrop, and D. Searls (Eds.). AAAI Press, Menlo Park, pp. 28-36. 25. Eddy, S. R. (1998) Bioinformatics 14, 755-763. 26. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-4680. 27. Garí, E., Piedrafita, L., Aldea, M., and Herrero, E. (1997) Yeast 13, 837-348. 28. Hsieh, W.-L., and Wolniak, S. M. (1998) Plant Mol. Biol. 37, 121-129. 29. Clough, S. J., and Bent, A. F. (1998) Plant J. 16, 735-743. 30. Mertens, N., Remaut, E., and Fiers, W. (1995) Gene 164, 9-15. 31. Hemerly, A., de Almeida Engler, J., Bergounioux, C., Van Montagu, M., Engler, G., Inzé, D., and Ferreira, P. (1995) EMBO J. 14, 3925-3936. 32. Porceddu, A., Stals, H., Reichheld, J.-P., Segers, G., De Veylder, L., De Pinho Barrôco, R., Casteels, P., Van Montagu, M., Inzé, D., and Mironov, V. (2001) J. Biol. Chem. 276, 36354- 36360. D o w 33. De Veylder, L., Segers, G., Glab, N., Casteels, P., Van Montagu, M., and Inzé, D. (1997) FEBS n lo Lett. 412, 446-452. ad e d 34. Livak, K. J., and Schmittgen, T. D. (2001) Methods 25, 402-408. fro 35. Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., and Gruissem, W. (2004) Plant Physiol. m h 136, 2621-2632. ttp 36. Minami, E., Kuchitsu, K., He, D.-Y., Kouchi, H., Midoh, N., Ohtsuki, Y., and Shibuya, N. (1996) ://w w Plant Cell Physiol. 37, 563-567. w .jb 37. Wang, H., Qi, Q., Schorr, P., Cutler, A. J., Crosby, W. L., and Fowke, L. C. (1998) Plant J. 15, c .o 501-510. rg b/ 38. Cheng, Y., Kato, N., Wang, W., Li, J., and Chen, X. (2003) Dev. Cell 4, 53-66. y g u 39. Kato, N., Pontier, D., and Lam, E. (2002) Plant Physiol. 129, 931-942. e s 40. Xiong, Y., Connolly, T., Futcher, B., and Beach, D. (1991) Cell 65, 691-699. t on N 41. He, D.-Y., Yazaki, Y., Nishizawa, Y., Takai, R., Yamada, K., Sakano, K., Shibuya, N., and o v e Minami, E. (1998) Mol. Plant-Microbe Interact. 11, 1167-1174. m b e 42. Che, F.-S., Nakajima, Y., Tanaka, N., Iwano, M., Yoshida, T., Takayama, S., Kadota, I., and r 1 7 Isogai, A. (2000) J. Biol. Chem. 275, 32347-32356. , 2 0 43. Verkest, A., Weinl, C., Inzé, D., De Veylder, L., and Schnittger, A. (2005) Plant Physiol. 139, 18 1099-1106. 44. Azzi, L., Meijer, L., Ostvold, A.-C., Lew, J., and Wang, J. H. (1994) J. Biol. Chem. 269, 13279- 13288. 45. Vogel, L., Baratte, B., Détivaud, L., Azzi, L., Leopold, P., and Meijer, L. (2002) Biochim. Biophys. Acta 1589, 219-231. 46. Booher, R. N., Alfa, C. E., Hyams, J. S., and Beach, D. H. (1989) Cell 58, 485-497. 47. Grafi, G., and Larkins, B. A. (1995) Science 269, 1262-1264. 48. Riou-Khamlichi, C., Huntley, R., Jacqmard, A., and Murray, J. A. H. (1999) Science 283, 1541- 1544. 49. Masubelele, N. H., Dewitte, W., Menges, M., Maughan, S., Collins, C., Huntley, R., Nieuwland, J., Scofield, S., and Murray, J. A. H. (2005) Proc. Natl. Acad. Sci. USA 102, 15694-15699. 50. Adams, P. D., Sellers, W. R., Sharma, S. K., Wu, A. D., Nalin, C. M.,and Kaelin, W. G. Jr. (1996) Mol. Cell. Biol. 16, 6623-6633. 51. Chen, J., Saha, P., Kornbluth, S., Dynlacht, B. D., and Dutta, A. (1996) Mol. Cell. Biol. 16, 4673- 4682. 10 52. Walker, J. D., Oppenheimer, D. G., Concienne, J., and Larkin, J. C. (2000) Development 127, 3931-3940. FOOTNOTES * The authors thank Matthew Brown of the Socolofsky Microscopy Center at the Louisiana State University for assistance with microscopy and Martine De Cock for help in preparing the manuscript. This work was supported by grants from the Institute for the Promotion of Innovation by Science and Technology in Flanders (TraitQuest grant 000391), the European Research Training Network DAGOLIGN project HPRN-CT-2002-00267, and the National Science Foundation Grant IOB 0444560 (to M.L.C. and J.C.L). A.V. is indebted to the Institute for the Promotion by Science and Technology in Flanders for a predoctoral fellowship. L.D.V. and K.V. are postdoctoral fellows of the Research Foundation-Flanders. 1 To whom correspondence may be addressed: Department Plant Systems Biology, VIB, Ghent University, Technologiepark 927, B-9052 Gent, Belgium. Tel.: 32-9-3313800; Fax 32-9- 3313809; E-mail: [email protected]. 2 The abbreviations used are: ABA, abscisic acid; ADH, alcohol dehydrogenase; CDK, cyclin-dependent kinase; CKI, CDK inhibitor; FRET, fluorescence resonance energy transfer; GAL, galactose; D o w GST, glutathione S-transferase; HB, homogenization buffer; His, histidine; ICK, interactor of n lo Cdc2 kinase; KRP, Kip-related protein; PCR, polymerase chain reaction; SIM, SIAMESE; SMR; a d e SIAMESE RELATED d fro m h ttp ://w w w .jb c .o rg b/ y g u e s t o n N o v e m b e r 1 7 , 2 0 1 8

See more

The list of books you might like