Logout succeed
Logout succeed. See you again!

Nucleotide sequences 1986/1987 : volume IV Plants and Organelles : a compilation from the Gen Bank and EMBL data libraries PDF
Preview Nucleotide sequences 1986/1987 : volume IV Plants and Organelles : a compilation from the Gen Bank and EMBL data libraries
NUCLEOTIDE SEQUENCES 1986/1987 VOLUME IV PLANTSA ND ORGANELLES A Compilaftriotomhn e GenB ank® and EMBL datlai braries Compilbeyd EdwiJn. A tenciHoo;w arSd. B ilofsJkuyn,Beto ssienrg,Cth ristian GBruarhkasNm;. C ameron,i Michael J.C inkosk-yC,a·rE o.lE nglanVdi,c·t Io.rE sekogw•Ju a,m es W. FickeTt.tF ,o•l eByWr,ai·la tneB r.G oad,· GregorHy. H amm,Dia viJd. H azledine,i KPaahtnr,Liiec silaKi aey ;F rancIe.sL ewietrt,Nta talie Lopez; KersAt.i M acinneMsi;a J .M cLeod;D eboraLh. M elonteG ,e ralMdy ersD;e brNae lsonJ;u diLt.h NialJ,oia nnKa.N ormanE;r iDc. R asmusseAnn;d reAa. R evelWsa;y neP. RindonCea,rto Rl.S cheremr; j MaurTa. S mithG,u·e ntSetro es,s Cei.r D aviSdw indelBlr,i aLn. T ruilloa,n·dC hang-ShTuunngg• t • GenBank t GenBank 1 EMBL NucleotSiedqeu enDcaet aL ibrary T-10M ailS toKp7 10 BBN LaboratorIinecso rporateEd uropeMaonl eculBairo loLagbyo ratory Los AlamoNsa tional Labo(rLaAtNoLry) JOM oultoSnt reet PostfacJhO 2 20 9 LosA lamosN,e wM exic8o7 545 CambridgMea,s sachus0e2t2t3s8 D-690H0e idelberg FederRaelp ubloifcG ermany 1987 ACADEMICP RESS,I NC. Harcourt BraceJ ownovich, Publishers OrlandSoa nD iegoN ewY orkA ustin BostoLno ndonS ydneyT okyoT oronto COPYRIGHT© 198B7Y ACADEMIC PRESS,I NC. ALL RIGHTSR ESERVED. NO PART OF THISP UBLICATIONM AY BE REPRODUCEODR TRANSMITTEDI N ANY FORM OR BY ANY MEANS.E LECTRONIC OR MECHANICAL.I NCLUDINGP HOTOCOPY.R ECORDING.O R ANY INFORMATIONS TORAGE AND RETRIEVALS YSTEM.W ITHOUT PERMISSIONI NW RITINGF ROM THE PUBLISHER. ACADEMIPCR ESSI,N C. OrlandFol,o ri3d2a8 87 UnitKeidn gdEodmi tpiuobnl isbhye d ACADEMIPCR ESSI NC(.L ONDONL)T D. 24-28O valR oad,L ondonN W I 7DX Byp urchasoiron tgh erwoibstea inNiuncgl eotSiedqeu enc1e9s8 611r9ec8i7p,ui nendte rstands thatth ei nformatcioonnt aiinnet dh icso mpendiuwmh,i chha sb eenp roducfreodm the informactoinotna iinnet dh eE uropeMaonl ecuBliaorl oLgayb orat(oErMyB L)N ucleotide SequenDcaet aL ibraarnydt heG enBankd®a taba(s"et hien formatiohna"sc) o,m efr om a varieotfsy o urcpeusb,l isahnedpd e rhaupnsp ublisThheeid n.f ormahtaisbo ene dne posited int hGee nBankd®a tabaansdet hEeM BL NucleotSiedqeu enDcaet Lai br,aa rnydi th asb een reprodufocrei dn clusiinto hni cso mpendivuimaa reliaabnldqe u alictoyn troplrloecde dure, butn os ucphr oceissis n fallTihbelree.f oArcea,d emPicer ssI,n c(.A P),B olBte ranaenkd NewmanI nc(.B BN)L,o sA lamoNsa tionLaalb orat(oLrAyN L)T,h eE uropeMaonl ecular BioloLgayb orat(oErMyB L)a,n dt hUe. SG.o vernmemnatk en or epresentoarwt airornasn ties regardtihncego nteonrat c curaocfty h ien formatBiywo any.o fe xamplbeu,nt o otf limitation, AP,B BN,L ANL,E MBL,a ndt heU .SG.o vernmenmta ken or epresentoarwt airorna nties ofm erchantaobrif liittnyfoe rsa sp articpuulrapro soert, h atth eu seo ft hei nformiaotnw ill noti nfrianngype a tencto,p yritgrhatd,se e croertt ,r ademoafra kn yt hipredr soAnP.,B BN, LANL,E MBL,a ndt heU .SG.o vernmenatc cenpotr esponsifboiarln iyet xyp ensleoss,s es, ora ctiionnc urroreu dn dertabkyet nh er ecipiaesan tr esuolftt her eceioprut s eo ft he information. Notteh aGte nBanki®sa r egistterraedde mfoarrt kh Gee netSiecq uenDcaet Baa nke stablished byB BN andL ANL undecro ntrwaicttth h eU .SN. ationIanls titoufHt eeasl tahn ds hould beu seodn liyn t hacto ntext. Informafrtoimo nt hicso mpendimuamy b ed uplicarteepdr,o duocreo dt,h erwuisseebd y ther ecipibeuntti ,n n o evenmta y theG enBankt®r ademabrek a ssociated with such re-generated inafnodir nnm oae tvieonsnth, a tlhle rbeea nyr emedy furnishAePd,B BbNy, LANL, EMBoLr,t heU .SG.o vernmenfto rs ucrhe -generiantfeodr matiinocnl,u dbiuntg notl imitteofid n anciraelm uneraotrit oenc hniicnatle raction. Pelasneo tteh atth ep ropaetrt ribuotfNi uocnl eotSiedqeu enc1e9s8 611as9t 8h7es o urocfe yourd ataan dt hep ublaivca ilabiltihtiiysn foofr maitnic oonm puter-refaodramfrb olme BBN andE MBL wilble a ppreciated. LibraofrC yo ngress CaitnPa ulbolgiicnaDgta itoan Nucleotisdeeq uences 1986/1987. Includiensd exes. Contentvs.:1 .P rimat-evs. 2 .R odent-sv .3 . Othevre rtebraatneds inverte-br[aettecs. ] 1.N ucleotsiedqeeu nceT-ables-Collewcotrekds . I.A tencio, EJd.w iII.n GenB ank.1 11E.u ropaeiske molekylaerbiologiske laIbVo.rB aBtNo rium. LaboratoirVe.s L.o sA lamoNsa tionLaalb oratory. QP6 25.N89N851 987 547.7'9 87-1782 ISBN0 -12-512514-(3v 4. a:l kp.a per) PRINTEIDNT HEU NITESDT ATEOSF A MERICA 87 88 89 90 98 76 5 4 321 Preface This eight-cvoomlpuemned ioufmn ucleotsiedqeu ences Bothd atabaares esa vailaibnla e v arieotfyc omputer foundi nt heG enBanka ndE MBL databaisset sh et hird readafbolrem Asd.d itioinnaflo rmaatbioounot b taintihneg editiroens ultfrionmg t hec ombineefdfo rtosfa lolf t he GenBandka tabacsaenb eo btainbeywd r ititnog techniacnadal d ministrsattaiaffvt Le o sA lamoNsa tional Genbank Labora,t tohreyE uropean MolBeicoulloaLgray b ora,t ory BBN LaboratorIinecso rporated andB BN LaboratoIrniceosr porlaitsetoden td h et itplaeg e. 10M oultoSnt reet Botthh eE MBL andG enBandka tabahsaevsce o ntintuoe d CambridgMea,s sachus0e2t2t3s8 growa ta remarkarbaltewe i,t eha cdha tabase doubling in USA sizen earloyn cee achy ea.r We haveo rganiztehdi s compendiiunem i gshetl f-convtoaliunmeedes a,co hf w hich Furthienrfo rmataiboonu tth eE MBL NucleotSiedqeu ence isa vailasbelpea ra.Tt heelfi yrsste vevno lumeeasc cho ntain DataL ibracraynb eo btainbeywd r ititnog thsea mei ntroduacntdoe rxyp lanamtaotreyr ioanleo, rm ore EMBL NucleotSiedqeu enDcaet aL ibrary sectioofsn esq uenecnet riaensds, e veriandli cteots h een tries EuropeMaonl eculBairo loLgayb oratory int hat volVuomleu.mV eI IIc ontaai ndsa tabadsiere ctory PostfacJhO 2 20 9 andm asteirn dicteoas l olf t hev olumes. D-690H0e idelberg As a resuolftc ommentasn ds uggestwieo rnesc eiviend FederRaelp ubloifcG ermany respontsoet hep revioeudsi tiwoen ,h ave masdeev eral improvemeinntt sh iesd itiWoen .h opet hasto mes light adjustmiennt thsel ayoauntd p resentaotfti hoesn e quence entriiensc,l udiinncgr easuisneog f m ixed-ctaesxeat n d WayneP. Rindone improvemeinnpt usn ctuatwiiolnrl,e suilntm akingt hem CambridMgaes,s achusetts moree asirleya datbhlaein n t hep ast. Novembe1r7 1,9 86 vii Introduction Outilen 1.D1e srcipnt iofo tchoem pendium 1.I nrtodtuicno Thep rnitecdo mpenmdaikuetmsh ee nitrceo lclteni o 1.D1es cprtiin oof ctohmep endium of inoframtioinn bothd atabaasveasi latboel vee ry 1.T2h et wod atabases memboefrt hes cienitifcc omumniy twhow ishetso u se 1.N3e wf eatuorfet sh iesd int io it,i ncludiinngvt eisagtorsw ithouta ccess to 2.C onteonftt sh eC ompendium comuptesr.T hicso mpiemun,dd rawfnr omt heA merican 2.G1e neroarlg anizoaftt ihoecn o mpendium and Europedaant aebs,a sis the thdi rpritned 2.F2i ndianne gn try copmilatoifos nub snttiaalalyl ln uceliacc isde quences 3.H owt oR eaadn E ntry reportseidn ce1 96.7 Thessee quenacnedst hier 3.S1u mmaorfty h ee ntrfyei lds associaantneodt athiaovnebs e enco mpilferdo mt he 3.T2h ef ielidnds etail pubilsheldi etratuarnedf rodmi rcets ubmissfiroonms 4.T woS ampElnert ies thea uthobryts h Gee nBasntka fatfL osA lamNoast ional Laborataonrdby y t heEM BdLa tlabi rarsyt afaftE MB.L Althho utgfhoer macth osefno re ntriiens t he prnitecdo mpenddififuemsr osm ewfhraottm h aitn e tiher 1.I ntroduction datasbeae,v ery ceonnttrayii nnofsr maticoonnr tiubted bothb yE MBaLn db yG ennBk.a Thef inaplr eparaotfi on Nucelotei Sdequen1c9e8s69 /817i s the thdi r thed atian t hec ompendwiauscm ar rdi eoutb y the databcaosmep enpdubiluhimes da so ner estu lofu nai que GenBasntka faft BLBaNb oorraiteIsnc orpo(rBBaNt)e;d internaalt icoonlbloariaotnb etweetnw o laeding thefroer,e thef ormaatn dc onventuisoendis n t he nucleotsiedqeu endcaet al birar,io enseb aseidnt he compendairuem somewhatt ot hcolsouess eeirdn t he UnitSetda taensdo nei nE uro.p Tehet wod atabases arGee nBadnakt abtahsaetn o t hosues eidn theE MBLd ata theE MBNLu cleoSteiqduee DnacteLa i br,ae rsytablishedl bira.r yTechniAcpaple ndEi ixl sltuartesh owt he byt heE uropMeoalne cuBliaorly oLgabroator(yME B)L. compenfdoirummra etl atteos tfhoer mautsse di nt he andt heGe nB(aRnGk)e entiSce queDnacteBa a nkw,hi hc is two datafbraosmweh isc hi tw asc onsterdu.cO tneo f a U.S.G overnntm-espoornesdn ucelica cisde quence theg oalosft hec ollaboiroabnte tweGeennB aannkdE MBL reopstior.y Botdha tabasseersvm eo lecublilaoorig sts is contueidnm ovemetnotw arcdo mmosnt andaarndds ando theirn vesattiorgwso rldwbiyd ceo lliencgtt he conventfioorn stt whode a tasbe.as largneu mbeorf r eportDNeAda ndRN As equenacneds makitnhge amv ailaibncl oem puter-rfeoard.ma Tbhlee priamryd isbturtiionme dium boftohrd atabases is1 .T2h et wod atabases magtnietca p.e TheE MBLN ucleiodteS equence Data Library was Thed ata icn omtpheen rdeilfuemct th ei nformatione stabliisnh 1e9d8 b0y t heEu ropMeoalne cuBliaorly og founidn G enBaRnekl ea4s4.e0 o fA ugu1s9t8. 6 This Laobrat,o rayn intrneaitnoalc enteorf fundamental informhaatisbo enec no mbiwniehtd t he diantcal uidne d researwcihht itmsa ienm phiasis nt hef iledso fc ell EMBRLe lea8s.e0w ,hi cwha sm adaev ailaibnMl aey1 98.6 bioylo,gm oleculsatrr ucets,u drifferenitoinaa,nt d Regulaurpldya tdeids itbrutitoanp ecso ntaintihneg insutmrenitoa.nt EMB,L whoshee audaqrteirss i n EMBLS equence LiDbartaaar ryea v aibllaef outrmi es HeideerlgbG,e rm,a niysc urrenftulnyd ebdy the annulayl.A news eto fd isitubrtiotna pecso ntaining foolwlinmge mbesrt at:e ssAturiDae,n m,aF rrkacne, the tieern GenBadnakt abiassa el smoa daeva ibllaef our FederRaelpl uibocf G erm,aF niynnld,a Gree,c Iesra,e l tmiesa nnaull,y andu pdattea pecso ntainoinnlgy Ita,l y thNee thaenrd,ls Norway,S pai,n Swdee,n enrtietsh at bheaevaned deodrc hangaerdea vailable Swizternld,a andU nttihdee K ingd.o m Tfhries tr elease midwbaeyt weeeancf hu lGle nBarnekl e.a se oft heEM BdLa tlabi rarwya si nA pril19 8.2 Thes equenicne tsh isc ompendairuem a lso The GendBaatnakbw aassce r eatiend 1 982b y the availafbrloGeme nBaonnfk ol ppdyi sektt.e Bsecauosfe NationIanlsi ttuotefG enerMaeld icSaclin ece(sIN GMS) lmiitesdtr oagec apiatcyo,n lyt hes eqnucee,s some of tUh.eS N.at inaolI nsuttietosf H eal(tINhH ). Los basici deinyftingi nofrmiaot,n ands omeo f the AlamNoatsi aolnL abroato(rALyNL ),w hichis o perabtye d biologiacnantloa tionasr e incdleud on this theU niveiryts oCfa ilofrnifao r tDheep artmoefn t disitbrutiomne di.u mThe remainianngn otated Ener,g iysl ocatiendL osA lam,oN sewM exico.L ANL informactainb oefn o unidnt hec omnpdieu.m gathe,ra snnoets,a t anodr ganitzheesd atabaasned transmiitts t o BBNL aboorraiteIsn corporaa ted, The GednaBatnakbi assa ev ailaobnlileen on the researacnhd conusltingf irm in Cabmridg,e ORRI/HN/PROPcHoEmuTpt esry stewmhi,c cha nb ea ccessed Massascehtu.t s Thceo lelcteidn faortmioinsp repared overT eleetn,a n intrneationtaell emcuonmicationsf orr eleabsye B BNa ndd isbturtietdo susbcbriing netw.o rTkheo nilned atabaisseu pdateevde rsyi x isntuittniso and scinetistisn r eguluaprad te.s weekosn thes ames chedualse t hem agtniect ape Cosponosfo rstG heen Bapnrkoe jcti nclutdheeN ational relseea.s Thiosn ilnes erviaclespo r oviudseesrw sih t CancIenrsi tutt,e theNa itonaIlsn tuitteo fA llregya nd accetsos tGheen BaSnokf twaCrlee angrhio,u swehich InefctuisDo isseea,s theN atioLniablr aorfy dMiiecn,e contaiinnsf ormataiboounct o mmerciaalvlayi lable theN aitonalI nsittutoef ArhtritiDsi,at bee,sa nd softwarpea ckagfeosra nalyzianngd manuilptaign Diegsitvean dK idneDyi sseea,s andt heD ivins ioof seque.n ces ResearRcehs our(cROeRs) o fN I,H asw elal s the NatiaolnS cienFcouean tdoin.t heU .S.D epartmoefn t Form orien ofrmatoinot nh es ervsi cperovidbeyd Energayn,dt heU .SD.e partomfeD netf e.n sGeenB'ansk theGe nBaannkdE MBsLe quelnbicrea ripelse,a wsreti e: firsrtee laswea si nO ctob1e9r8. 2 GenBank BBNL abortaorsi Ien.c 10M oultSot.n 1.N3e wf eatuorfet sh iesd ition Cabmriged,M A0 2238 USA TheC itatIinodne x bheaesna ddetdo assist or readeirns f indibnigbi lorgapihcacli attiofnosr EuropMeoalne cuBliaorly oLgabroatory juornaalri tcl.e Tshinse wi ndelxsi tsj uornal NucleoSteiqduee DnacteLa i brary titlveo,l umneub me,r pagneu bmer,s ayneda orf Postafch1 0.2209 pubilcant ifooera cahr ticclidet e. D-69H0e0i delberg WesGte rmany As a resulotf lmiitedr esourcaends an ever-incrreaatsei nsgeo qfu epnucbielc anti,i ot hasn obte epno ssiblteoc olleancdtp reseanltl sequenicne tsh ef ullayn notaftoerdm wteh at woulldki e. It niesvr etheeslsv italliym portant ix INTRODUCTION thata t leasats muchr aws equendcaet aa s Indetxh,eK eywoPrhdr aIsned ,e xthAec cseisno Number possibbelp er estee.nd Theroer,few eh avea new Ind,e xtheE MBLE ntrIyn edx,a ndt heGe nBaEnnkt ry sectn ioentitdl UenantnaoteSde qnucees,w hich IndeixnV oluVmIeI aIr ema stienrd icteos aolfl the contauinnasn notaantdeu dn cliaifsesds equences volumients h iesd inti. o andc iattoin.s We htohpaeit n t hef utuwreew ill havet her esourtcoem so vet hisi nofrmiaotn 2.F2i ndianneg n try rapidilnyt oi tsp ropepors iotni in tmhanei datasbe.a Userasp prcohaintgh eda tabfaosrteh ef irstti me musdte treminweh icshet cino contatihnsese quetnhceey A separvaotleu imsen owa vailatbhlaetc ontains arel ookinfgo. r Mosto f the secitonsa re masteirn dicfeostr h ee niter databaassw ee lals sefl-exploarn,ya btuti ti sh elpftuopl o inotu tt he a matsedrir ecyt ofroarl lo ft hee nrteis int he followcionnnvgte oin:s datasbe.a Yeasatn df ungasle quenacrees in Pltahnet Sequensceecstn i.o 2.C onteonftt sh ec ompendium Plasmainddts ar nsposiosnosl atferdo mb atceria Asc ombiinnet dh icso mpiemun,dt het wod atabases arel siteidn t heBa ctearlSi equensceecst. i on contaai nt otal of8 .nm5ei alrnll biyao sefsr o6m7 00 artliecsT.h ef ollowiinndgi acrespe r ovitdoea dss ist TheS tructuRrNaAsl e ctn iionclutdheess equences users fiinnd itnhge i nformatthieoynn e e:d the of maturtern asfre RN,A rbiosomRaNl,A small KeywoPrhdr asIen dext,h eT axonoCmliacis ifsaction nucleRaNr,A a ndo thesrtr ucturRaNAlm olelce.us Ind,e xtheA uthoIrn d,e xtheC iattni oInedx,t he Alls tructurRNaAlg eneasn dm osstt urcturRaNAl AccessNiuombnIe nrd etxh,eE M BELn trIyne dx,a ndt he precursseoqru encaerse lsitedw itht heir GenBaEnnkt rIyn d.e xMosotf thter ieaenrsea nnotated oragnisimnst heipra rticsuelciatorn. s toi ndicate thew iltohtcihanert eiprootndes s equences of codinrge giaonnds oetxhperermi entadleltye rmined The nthSyetiSce quensceecsnt iioncludaensy siteosfb ioolgicsailg nciafni.c eFullb iblgiraoipch nucelica cidse quentchea ti s cerateidn a inofrmatiiso nli undceidne vereyn t,ra yndm anoyf t he laboraatnoddr oye s oncoctun rat ulryai,ln cluding enrteis alsoi nclucdoem menatbsstr actefdr om the synhtetipcl asmtihdasat r en oti ncluwdiehtd t he oriingalpa epr.s Techniacpaplde incelso cataefdt er othebarc tearlsi equees.n cThem aojre xceptions thmea idna tsae cntsii on evaoclhu cmoen tadient ailed to thisr ulea rec DNsAe queesns,ci ncteh eayr e explanaotfii 9nonfrsm atiinot nh e trein.e s regardaesd a means seoqfu encniantgu rally occruirgnR NAs eqnucee.s 2.G1e neroaralgn izatoifto hnec ompendium Thei ndiidvuaeln triweist hienac hs ecnt iaore arnrgaeda lpbheaticabyle lnyt rnaym .e Summatrayb les The reisne itnt hec ompendairuepm r esenitne d ands ectidoinr ectoarreii encsl uadte tdh eb eginning thieretns ecntsi;o witheiancs he ctn iotehne trairees ofe achs ectitoopn r ovisdoem e guifdoarln occea ting groupaecdc ordtion tgh es ourcoera gnis.m These the trein.e Tsabl1e i sa no vearlls ummatrayb le of secotnisa rea rrangiende ihgtv olu,ma essf oolwl:s thee ntidraet ab.a Tsheitsa blseh owtsh e namtehse of seciton,sa sw elals tnhuem beorfrs e protesde queesn,c VoluIm.eP raitmes distciten nrtie,as ndn ucloetei bdaseisne acshe cnti.o Theraer et ypicamlolryer eprotde sequenctehsa n Sectn i1o.P rimaSteequ ences entriebse cauosvee rlapspeiqnuge ncefsr eaqruee ntly mergiendt ao s ineg,lc ombiennetd.r y VoluImI.e Rodents A tablteh astu mrmiazetshe e ntriapepsaer sa tt he Sectn i2o.R odeSnetq uences beginninega chos fe ct.i oTnhitsa bliesc alled the SectiSuommna r.y TheS ectSiuomnm afroyrt heP rimate VoluImIe.I OtheVrer tebraandtI ensv ertebrates Sequensceecst ,i ofnore xamep,ll sit,s byo ragnism (e.,gA p.)e,t hec orrespondoirangngi sm c(oed.,eg . Sect3io.nO thMearmm aliSaenq uences APE), theb erno ufm reproteds equenfcoerst hat Sectn 4io.O ther Vertebrate Sequenceosra gnistmh,en u mboefre ntri,et shen umbeorf baess, Secti5o.nI nverteSberqauteen ces andt hep agen umbeorn whicthh igsr ouopfe nrties begi.n s VoluImV.e PlanatnsdO ragnelles Notteh atth e pnaugmeb etrhsr ougahroeau rtnr gaed Sectn 6io.P lanSteq uences separatfeolrey a cshe ctni.To hen umbearrsep rnited Sectn i7o. OrgaSneeqluleen ces one acpha gwei ht sah rots ectn pirofei.x For exapmle, thef irtshtr peaeg eosfS ecti1o:nP raitmSee quences VoluVm.eB acterainadB atcerpihoage aren umrbeedP RIM-AI,T EPRIMA,T Ea-n2d PRIMAT.E -3 Tabl1e shows tnhubem erppr afegiexf o re acshe cnti.o Sectn i8o.B acteiraSle quences Sectn 9io.B atcerpihoagSee quences A tdaeidl aelpbheatizdeirde cyt orfor stehcetn io appeairmsm ediaatfteelryt heS ectiSuomnrm y.a The VoluVmI.e Viurses secnt diiorecyt coorntaoinnels i noefi nofrmatifoonr eache ntriyn t hes ectiaonnd searsva ecsom eptle Seciton10 . Viral Sequences tabloefc ontefnottrsh aste ct,i olnsitgi n thfeu ll entrnya m,e thed escripatnidl oenn gotfhe acehn try VoluVmIe.I StructRuNr,AaS ly netthi, c (i.,ne u.mboefr bpaasrise ),a ndt hep ageo n which andU nantnaoteSedq uences eacehn trapyep ar.s Sectn i11o. StructuRrNaASl e quences 3.H owt oR eaadn E ntry Secti12o.n S ytnhetSiecq uences Secti13o.n U nantnaoteSedq uences Thee nrtiefso re achs ectiboeng ianf tetrh e sectidoinrc teyor. Each einsts reyp araftreodm the VoluVmIeI. I DatabDairseec yt aonrdM astIenrd ices nexbty a dashlenide r unnitnhgew idtohf thep ag.e Theraer etw ot ypeosfe ntrieins tchoem pen:d (i)u1 m Each voolfut mhee c ompendciounmt aitnhsi s sefl-conta,ia nned(d 2s)e gnmtee.d Segmenetnetdsr ie inrtoduico,tn oneo rm orsee cntsio ofd at,a technical areu sewdh enno nciougnotupsi ecoefs tshaemn euc leic appecned,sia ndi ndicteos t hatv olmue. TheA uthor acimdol ecuhlaevb ee esne quenacnedtd h eo rderionfg Indetxh,eC itatiIonnd etxh,eT a xonoCmliascsif ication the piieskc neos.w n x Tabl1e:S ummarSye qoufe nPcreess enitne dE Saecch tn io SecitoSne ctn ioSectn io NumboefrN umboefrN umboefr NumbeCro de Desrcitpion SequenEcntersi esB ases -- ---- ---- ----- -- 1 PRIMATEP riatmeSe quences 1492 10281 204779 2 RODENT RodeSnetq uences 1638 1272l l6l212 3 MAMMAL OtheMarm amliaSne quences 293 245 244554 4 VERT Other VerSteeqbureantcee s 557 474 400509 5 INVERT InverteSberqauteen ces 696 605 435280 6 PLANT PlanSte quences 717 594 643365 7 ORGANELOLrEg aneSlelqeu ences 434 368 485666 8 BACT BactreiaSle quences 1310 749 1034165 9 PHAGE BacteprhiaogSee quences 338 160 271817 10 VIRAL ViraSle quences 1748 10931 517025 11 RNA Structural RNA Seq7u3e4n ce6s3 7 69232 12 SYNTIHCE TSynhtetSiecq uences 259 224 72029 13 UNANNOTUAnTanEnoDt atSeedq uences 1377 1374 919833 OveraSlumlrm y:a 14113 88238 442357 3.S1u mmary eonft rftyih eel ds 3.T2h ef iledsi nd etail Eache ntriys c omposoefds everal koifn ds ENTRNYA ME ifnormiaotnr,e efrdr etoh erae sf iel.d Nsote very EMBL" DI"N ameasn dG enBa"nLko cuNasm"e s fiealpdpa ersi ne vereyn t,r ybutt he flusiltl o f possibfliee l,di snt heo rdeirnw hicthh eayp epa,r is Thee ntrnya mei s a shor,t uniqunea met hat asf oll:o ws providtehse lfaobaren le nt.r yIno rdetroo ragnize thicso mpenidnia u cmo herfeansitho ni,tw asn ecessary EntrNya me s-hoar, tu niqunea mep rovidtihneg to choosae u nfiormm ethofdo rn aminagl lo ft he label feonrt .rt yhe entire,s regardlewshisc dhao tfa batsheei nofrmation was extrfarco.tm eBdy mutuaalg renetm,ew eh ave Defiintni o-bar ideefs cripotft ihoens equceen, presenttheeed n triunedse trh en ameass sigtnoe tdh em beginnwiihnt tgh en amoef t hes ourocreang is.m in thGee nBadnakt asbe.a Thec onventiocnhso osfionrg thesnea ems,w hichi ncluadbber evioantsf ior the Segme-nitn dicawtheiscs he gmetnhti s enitnr y iso ragnismfsr omw hich nutlcheei acc idwse ries olated, a serioesfs eparasteeqdu enfcreosm stahmee ared escriibnde edt aiinlT echniAcpaplen Ad:iE xn try moleec.u l Namaen dM olecTuylpee Coinovn.es nt EMBILD - entrnyaem (si)nt heEM BdLa tabatshea t TheG enBaennkt rnyam es havec alblee"edlnc o us corsrpeontdot hee ntry namesw orikn. this namest"h roughtohuitbs o o,k andt heraer em any occasiwohnesro en ee ntrryee frst oa noth"elcrou s"o r AccessNiuomnb e-rss horcto detsh atp rovide anothgerro uopf" lcoi";t hitser mniolyo igss ipmlya uniq,u uenchangiidnnetgfi ise rfor dtahteia n way roefef rirngt oo theernt ri.e sThee ntrnya mes each entthrefy i;r nsutm bienrt hel isits k nown usedf ort hec orrespondiinonfrgm atiiontn h eEM BL ast hep rimaarcyc essniuombnoe frt hee nt.r y SequeLnicber aarryeg iveanf tetrhe l abe"lME BLI D:" int hes ecolnnide o fe acehn t.r yNot eantllr si ehave Date -yetah,rem on,ta hndd ayw hetnh ifso rmo f beeans sigEMnBeLd I D nameast thiss tagoef our thee ntrayp peairne d tGheen Bavnekr siooftn h e colbloariaotnb,u te ventuaalllly reisne twilble dataasb,ep luisn ofrmatoinow nh ethtehree ntriys assignnaemdei snb otdha tabsa,as ned we acatriev ely preilmairnyo rc omeptl.e movintgo waar cdo mmnoanm ing sfyosrct oeermsr ponding entrietsh eti wnod atasbe.as Refere-ncctieast iofnosra llr eferenucseesd to constreuaccehtn t.r y TheG eBnanEkn try lInsidtesx l alof GtehneB ank entrnya measl pheatibcal,lt yogetwhitehrt hes ecnt io Keywo-rsdhso rpth rasdeessr cibignegn ep roducts namaen dp agneu mboenr whtihceeh n trbye gi.n sThe ando thre informapteritoeinnn tt ol ookinugpa n otheirn dicreesf etroG enBaennkt rnyaem sn,o tp age ent.r y nubmerss.ic net hesaer et hen ameuss ed oirng anizing theb oo.k The pnaugbmee rmsu sbte louopki endt he Sour-cem oscto mmounsleydn ameo f tshoeu rce GenBaEnnkt rIyn d.e x orangismf,olo wlebdy a formsacli teinifcn am.e Commenitn f-ormatthiadtoo ne s rneoatd iflayl l DEFINITION intot heo thefri led,s includiinnofgr mation abstractferdo m the referenceasn d Thed efiinointo f an entry prao vbirdeiefs crosesef-rrencteoos t heern tires: desrciptiont heso efq nuce.e Thisd efiinoiint su sed toc onstrtuhcelt si tinfgo r etnhteri yn thes ection FeatureSsi sta Tenadb le-st abledse sniegdt o dirteocr.y pTicyalliyt i ncludesn amteoh eft he descrilbcoea tioannsd r egioonfsb ioliocgal organainsdom t heirm portianonfrtm atdieosrnci bgi tnhe singificwanicteht ihnes equcee.n ent.r yInofrmatiaobnou tth et ypeo fm olecaunlde whether setqhuee npcree senitse cdir culaorr a Orig-idne scritbheess t arotf sae quenicne complettaen derme peiasti ncluidneb dr ackaettt sh e relattioao nne xpreimentally sdeitt.ee rminede ndo f tdheef iinoint for moste ntr.i eTshe conventuisoendis n s pceiyfign them olectuylpeae r e Seque-nscteai tstiocnst h en umrbsea ndk indosf descriibnde edt aiinlT echniAcpaple ndAi:x E ntry baseisn t hes equee,nf collobwyet dh es equence Namaen dM oleculeC onTnvytepoien. s itsfe.l SeeEx almep1 foar ne xampolfae t ypicpaailr o f entrsie. xi INTRODUCTION ANIMTlC:Ya Bn.idulmatna sp oyctochrbo (moceb) ag enee;x o.n [lNDA] SEGNMT:E 1 of 2 EMBILD: M IAN02 ACCESSNIUOMNB :ER JS0138V80 0651 DAT:E update8d3 -11-01 REFERE:N CE[Sl(]ab se1s t o8 38W)ar inRg.,,BD .avi,eRs.,WL ee.S,.G,r iis,.E,B ersk,M.aMn.dS cazzhoicCoc,.";ht e mosaoircg anizoaftt ihoeanp ocytocbh greonmee a soprfeg illnuidsu lraenvse ablyed dn as equencCienlgl" ; 274.- 1(11 98)1 KEYWO:R cDSytoch;ra opmoecyrtoom.ce h SOURCEa:s pregilulsn idunls.a MitochoinodAnrs pregilsl nuidulans COMM:E NSTingilnet roofn aboutb po 1c0cp5ui0e ssa mpeo stiino asI 3i n" olngS". c erevei gsein.ae Opreena ding frmaeo fe xo1n c ontinautle aess t2 00bipn tiov .s TGAc odefso r .t Srepe<h ummatn>d< ystmbt>.c Syee othelro cbie ginn<ianngi mt.c yb> SIT:E S FEATU:R ES key sitsep and ecsription key from to cdreispnt io refnumbr 1 1n ubmere-d1 25 [il;n] z ernoo tu se.dp ept 126 631 apocytocbh (rxeoomn1e ) + ->eppt 126 1 cobcao disnegq uesntcaer t FEATU:R ES pept/IV6S3 2 0 cobiav sslt ar(txe onl ) end key from to cdreisipnot CDS 126 631 apoyctochrbo pmaer t( 361i s 2nd bascoeod ni)n IVS 632 >388 intrIo n ORIG:I N nehaidrn i isii et ibng li if ragm4e.n t SEQUE:N C8E38 b3p2 0a 11c2 132g 274t 1 ataataaacgat aattaaaattaaa atattaacat tcttatatatat gttt taaatcttgaaa ataaaaa aaaaaataatatagat gaaaatga aataaa 10a1a aaaaaataaaaaa aaaaaaaata aatagtatgat ataaa gtcatctcatctt aaaagataata attcg taatttactaacaaccttcacagag ctaat 201t taagtttaattgta acagtgtaattt cttat agctgttttatta ggatcaata ataacgatgag tcgattttaa ggccttaatttaa ccac tagtgtat 301ca gaagtcaaatttt cgtaggatctaa tttgaa gagatgt atagaattataatggcttctaaac c tcttacctaa agtcatctac atgcctttttct ttt 401a gtataccatctaat aggaggagat ttttaatgtaag tctta caaaacctaacg atatac atcatgaatgtgcagta ctaaga tacatgatatta tgatg 501 gccacatgcctctt agtggtttatact cttta gtgtcatagaa gtttaagtggt gcgttatcaat taacccttaa attggcatga ttagcacatt aggtc 601a agatattgtaggtt tttgaatgtg atgagcttaatc atgagaa ccactagac ggttgaatcttgga taaaa tcctagacttgtc tagagtacac ccaat 701c ttagggactattta ctgaatcttc tatattaatg ttattaattaa ggtcgga atacga atagtacacgggga aaactacgaggg gataggattgat cat 801a cttcacgcatacgt caacgtaagc agtggacgaa tct ANIMBT2C:Ya n.idulmatna sp oyctochrbo (moceb) ag en;ee xo.n [2DN]A SEGNMT:E o2f 2 EMBILD M:I AN03 ACCESSNIUOMNB :E RJS0138V90 0652 DATE: update8d3 -11-01 REFERE:N CE[Sl(]ab se1s t o1 08)2W ariRn.g,B,D .avsi,eWR.,.L eeS,.G,r i,sEi,.B ersk,M.aMn.dS cazzhoioc,cC".t;eh mosaoircg anizoaft itoahnpe o cytocbh rgoemneea sproegfil ulsn idulraenvse ablyed dn as equencCienlgl" ; 27,4 -1(191 8)1 KEYWDOS:R cytochraopmoec;yr toom.ce h SOURCEa:s eprgliulsn idul.a nsMitochoinodAnrs preglilsu nidulans COMM:E NSTingilnet roofan b ou1t0 5b0p o ccpuiessa mes tipiono asI 3i n" lnog"S .c eriesvigaeen .e Opreena ding framoefe xo1n c ontinautle aess t2 00bipn tiov .s TGAc odefso r .t Srepe< hummatn>d< ystmbt>.c Syee othelro cbie ginn<ianngi mt.c yb> SIT:E S FEATU:R ES key siet spand ecsriipnot key from to decsription IVS/pep7t7 0 cobeax ons2t ar(tvi sle n)d pept + 77 734 apocytocbh (rxeoomn2e ) pep-t< 734 1 cobcao disnegq ueenncde FEATU:R ES key from to decsription CDS 77 731 apocytocbh praor2mt e( 7 7 is 3rbda sien c oodn) IVS <l 76 inotnrI ORIGINa:b out bp7a 5f0t eanrmi tcybl SEQUE:N C1E08b2p 373a 123c 140g 446t 1 gatcaagtaaaataatt atgtcg tataaggatgatg taaat tatttattaaata tcatcgttaat ctaaaacaat ggcttacata tcaaaatcgt ttaaa 10c1a agttctgtctatt acattctt tacctt ttatttagttgact cgtttacga ttacaatt ttgaataagtccgta tgactaag tagaggagttca atcct 201t taggtcattgtctt acagtattaaat gtcac ttttcgtctttatcat tt attataagattat ataatcattat tacttatttta ttttgattac aatat 301 ttgtctttttt actcgtagactt ttaagtgatgagta gatat atgttgacttaga ttcgcctaaa aacctcctcg cgttattcac aggaataatt ctttt 401a cctttctgactat ttttagaa tctattaaactca atattatgag tgtta ttaggccttgacttttgaacttagtat ttagag tgtcactt ataactgat 501 tttactaataata gagagcaagatt tctcatgtat aaaaggttaa gtcattattt atttgtt agcttacatctta aataattgtc agagattgac aaaac 601a cgtatagatcc acttatttg aatgtgtaaca attttcattatca tttttacttag tattctt ttgatgatattc cgttgttatg tttttagaaaa atac 701t ttagtatgatagag aaacataaa aatatcatatt tgcttctcat cttag gcaaaaatatataaaaataataaa c aagatactgt ttaaattgta aaatg 801a taatgtacaaa aaatttataaa agagaatttaag ctttaatctgat ataat caatttattaaatt ttgttgttt catactta cttgttgttaaa tcata 901a gtatgaaattgata aataatgatt cttatatatg ttatgagaccct ttaaa atttttattaaaa tattattatt cttatggatg ttaattaaaat acaa 1010 tataattaatttaggt gtaga ttatggcaaat ggttgttttgatctt tggca ataagtaat ataggcggaattttct ccgcg Exapmle1 Twos egmenetnetdr iferosm Otrhgea neSlelqeue nsceecisto. n . xii SEGMENT KEYWORDS Int hoscea sewsh eraen entriys segmentae d, Thek eywofridescl odn tasihnrostw ordosrp hrases segmefnite lids used idntioc ate wsheigcmhet nhti s thati deinyft genep roducts and other useful entriysi na serioefsn onocntuioguss equenfcreosm ideinyftingc hacrtaerisotfi tchse entri.e sThe thes amem olelce.u Segmenetnetdsr cioentaa ilna bel KeywoPrhdr asIen depxr oviad emse ansl oofkoiurpn g aftetrhe m olectuylp,eea t tehnedo ft hef ristl nie alle ntritheasht a vceo mmokne ywoprhdrs ae;s ifa oft he enwthriyc,ih n dicatthepeso istioofnt his partuilcaern trhays no kpehyrswaeo,sr tdh iisn dicates entryt hiegnr ouopfs egmenetnetedrs. i Then ubmera t thanto noef t hpeh rasients h eke ywoirndd eapxp ltyo thee ndo ft hee ntrnaym ael sion dicawtheiscs he gment it.A smalnlu mbeorf p ree-ntrisehso wt hweo rd ofa comeptlsee queinscc eo ntaiinnte hdi esn t.r y "unaisngsedi"n p lacoef anyk eywoprhdr asetsh;i s woridn dicattheatsth ee nthrays n ot byeeetrn e viewed tod etmeirnweh cih,if a ny,o f the keyword phrases ACCESSNIUOMNB ERS appltyoi t. Accessniuobmne rsh aveb eena ssigneda ltlo entriienst heE MBSLe queLnicber aryt haeGen ndB ank SOURCE datbaas.eu sina gs ysttehma t was wjoirokneytd bl y out thet wdoa tabase. Ttheeasamers briatrlya beflosrt he Thes uorcfei elisda nE nglilsahn guasgteam teent datian lcudeidna ne ntrcyo nsios·f t as ignlel etter aboutth eo ragnisamn dt issuef rowmh icthh es equence follobwyed fdiiviget su;n like thnea m,eP.t nshteryy wasi sola.t Iefdt hee nyt rcontaai vnirsa ls eqeunce. carrnyoi nofrmataiboonut th et ypoer n aturoef the the hosto ragnisims u sualallys on am.e dThis ent.r yAccessniuobmne rsn evecrh an,g beutr atrh e statemiesfn otllo webdy a formadle signaotfit ohne follaolwo nwgi tthh e datap oitt nhetnyoo m attehro w sourcoer gnais.m tpyicalcloysn istg ionf thef ull thee ntroyr e nrtieisnq uetsoinm ihgtb er eoarngized scieiniftcn am.e TheT axonoCmliascsif icianot Index inf utuvreer sioofne sti hedra taasb.e Fore xapmlei,f listasl le ntriacecso rdtiotn hge iforr mtaalx onomic twod iffereenntt rwiiehts d iffereacncte ssniubmoenr s classiifcaotni.s armee rgiendt ao s nigleen trbyo,t ahc cessniuobmne rs arei ncdleudi nt he enneytwr. COMMENT Thef ristn umber ilni sottfa h cec essniuobmne rs ist hep riarmya ccessniuomnbf eorrt h ee nt.r yIfy ou Thec ommeinntc ludienosfr amtin othatd oesn ot citien formactoinotna ineadn enitnr iyn e tiher readiflayl li n otfhielerd ,s sucha s statements datbaas.e youa ree ncouratgoie ndc lutdheep riamry abtsractferdot mh er efecreesan nd cross-retfoe rences accessniuombnie nry oucri attnio. sincteh insu bmer otheernt ri.e s wileln ablyeo ur retaodf eirntsdh e dianqt ueas tion inf uturreel eaosfee sih terda tab.a sTeheA ccession NumbIenrd elxsi tsa lla ccessniubomenr tsh at bheaevne FEATUARNEDSS ITETSA BLES assigtnoed da te tahneed n tsr iteow hicht heyh ave beeans sig.n ed Thredei efrfentta blecsa n appear eainc h compenedniytur:m t heEM BfLe atutraebesl, t heGe nBank featutrbaels.e a ndt hes iets talbe. Allt hreaer e desginedt o descrirbeeg ions loacniadnots of DATE biolioaclgs ingifainccwei thtihnes equcee.n Thet wo featurteasb lsehso rwe gi.ow nistsht artainndeg n ding Thed atef ielcdo ntaian dsa te in fotrhme poinftoser a cfhe atuorfie n teesr.t Thes iets talbe, yea-rmondtahy-,p recedbeyd thew ord" entde".r e on theo thehra nds,h owisn diuvaildl ociaotnso f "upadte,d ""p-reetnry," or "unatnandto"e. Thed ate inteesrwti thtihnse e uqen.c teogethweirt ha number giveinst hdea te thoemfo srte ceGnetn Barnekal seei n thati ndicawtheetsh etrhe l coatni iosa singploien t whicthh iesn truynd erwaennymt ao jrr veisnis.o Ift he ore ncompamsulstpeilse b aess. Thef eaturteasb les wor"de nterapepde"a brefso rteh eda t.et himse antsh at presentceodm e fbrootmhd ataebs;a sthoswei th thiesn twrays feinrtsetr iend t hed atabaosne the lowerckaesyew oirndt sh e kceolyu mna rei nG enBank dateg iv.e nandt hati t hnaost u ndergaonnye formawthi.l teh oswei tuhp perckaesyew ordisn E aMrBLe substanrteivaoilns sis incteh arte le.a sIeft hehraes foarmt. TheE MBfLe atutraebsl aersei nlcudeidnt hose beesno mseu bsnttail arveiiso,n sucahs t hea dditni oof casewsh erteh enu mrbiensgy stuesme idn t heEM BeLn try anothreefre rceen, dtahteoe f tmhoesr te cernetv ision correspotnodt sh enu bmeriunsge idn t heGe nBaennkt ry isg ivepnr ecedbeytd h weo r"du pda.t"Ie fdt hweo rd andt heE MBLt ablper ovidseosm ei nofrmattihoant "pre-enatpeprayr,"si ti ndicatesa ltthhoauttgh he augemnttsh ei nfrmoaitofno unidnt heo thetrw ot albe.s comeptles equenacneds ompeo rtiooftn h ea nntoatniso Therei s otfenc onsiderraebudlned anicny t he appeianrt hiesn t,rt yheraere a dditniaol taannotonis inoframtiocno ntaiinnet dh esteh retea lbe.s Full thatw illb e includoendcr ee viewt heao rft icinl e inoframtioanb outth ec onventuisoeindns c onstructing questiisoc no meptlde. Pren-teriessom etimes undetrhgeost ea blaepsp eairnTs e chniAcpaple ndCi:x S ist e severraolu nodfsu pdataensdr evionssbi eforteh ey are andF eatuTraebesls. upgratdoef du leln tr.i Tehsed atfei elidna llo ft he entriienst heU nantnaoteSde quences bseegcitniso n witthh weo r"du nanno.t ated" ORIGIN Theo rgiinf ieldde scritbheess tart thoef REFERENCES sequen(chtee 5't emrin)u sin relatitoons o me expreiemntallyr midnesetidet. se ucahs a restrioinc t Thisf ielidn cludtehsen umbe(rni bractks)e enzycmuet tg isnit.e assignteod e achc itepda pre;a brisetfa temoefn t whicihn formaitnit ohne e ntrcyo mesf rome ach refere(nhscoew ni np arenets)he;sa nd the actual SEQUENCE citatioofn tahret liec.S equendcaet as umbitted directtlo y tEhMeB Lo r GenBadnakt abaasnedns o t Thef isrtl niei n tsheeq uenfciee lgdi vetsh e pubilshede lsewheraer e lsiteda s unpbulihesd totanlum boefrb aspeai r.sa ndt he numbadeneri noefs . referen.c Tehsesreef erengceense rallnyo t hilatev;e cytoess,ig nuani.n tehsymi(nroe usr cail)s.a ndo ther thesyi mplliys tth ec onitbrutoasr thea uthoarn d basesr eoprtedi n the seqnuce.e Aftert his inclutdhee w"oUrnudpb lishfeodol"wl ebdy t he yiena r inoframti,o tnhe acsteuqaule inscl ei sdt.eT heb ases parenthaensdte hsae dd resosf t hec onturtio.br See in tsheeq ueanrcee numlbnieerb eyld ni e,a ndt heayr e TechniAcpaple ndBi:xR eferenCcieti aotCno nvteinnos presenotneed hubnadsreepsder lien.i ng rouopfst e.n forf urthienorfr matoinor nef erenfcoear mt. xiii INTRODUCTION 4.T woS ampElnter ies regi.o nTshestew oe ntriaelss iol ulstratthee uosfe someo ft hes pecisaylm botlhsac ta na ppeianrb oth Exapmle i1s a reporduicoton fa typicpaailr o f styloefs f eaturteasbe ls. The sings int he "+" segmenetnterdsi efounidn t heO rganeSlelqeue nces GenBafneka tutraebsl iensd ictahtaett h ec odirnegg ion setcionI.nt hiesx amep,tl hef iresntt rcyo nisstosf resumienas n othseemreg n.t The" "<a nd" >c"h arearcst the5 'p ortn ioofa particsuelqaure anncdte h ese cond in theE MBLf eaturteasbel s indicatthea tt he conisstosft he3 'p ortioofnt hesa mes eque.n cTehe intveernisnegq ueenxctee nbdesy ontdh ee ndso f the twoe ntriiens t hise xcerhpatv eo nly pbaeretnl y reprotesde quees.n cThea ppraendtif efrneceisn t he covnertetdo fullm ixd-ecasree preastenino.t When nubmerrse poritnet dh et hreteab les in entthreisees theraer ef retee xpto rotniso fa ne ntrtyh aatr en ot ared uet o systemdaitefirfcne ceisn t hceo nventions covnertteodm ixecdas et,h eayr es howinn lowre-case thahta vbee euns eidn t heEM BaLn dG enBadnakt asbe.as chacrtae.r sThec ommporne ffioxrt h et woe ntrnyam es For exapmle,t heG enBafneka tutraebslr ee prottsh at isA NIMT;C tYhBefroer.e thef irsetn triys c alled the cosdeiqnuge inncA eN IMTCtYerB2m inataets b ase ANIMTCaYnBdtl h es ecoAnNdI MBT2C.YT hes emgenfti eld 73,4 whilet hec orrespondEiMnBgLf eaturteasb le att hee ndo ft hef irlsntie o fe acohf t heseen rteis reportthsee ndo f tchoed irnegg iaosbn a s7e3 .1 This stateesxp ilciyt tlhatth ef irst entthrefy i riossft apparedniftf enrcee merelryef lecttsh eG enBank twos emgentasn dt hen exti s tsheec onodf t wo convenotfii onnc ludtihnetg em rinaticoond on thien segemnt.s reportceodd inrge gion anEdM BLct ohnev enotfi on excludtihnetg e rminn actodi.oo n Thee ntrnaym eisnt hiesx apmlceo nsiosfst e veral par.t sThef irstth rcehea crtaerisnb otnha measr e Theo riglinines ,w hicfhol lwo thfee aturaneds "AIN", an abbreviatfioortn h ef unguAss pregliuls siets tableisn t heseen tr,i eisndicatthea tt he nidul.a nTshel etter"sM T"i ndictahtaett h esaer e sequenicneA NIMTCsYtBal rtnse ara particular mitochonsderqiuaelne cnter ieasn,d " CYB"i s an resitcrtni oenzymceu t sitteh atathn esde queinnc e abbreviatfioora np otcoychrbo.mT eh el ascth aracter ANIMTCiYsBs2 eparaftreodm tihnaA tN IMTCbYyB l ine ache ntrnya mei st hes emgentn umrb.e See approxima7t5e0b lays. e s TechnicAaplpn edixA fora decsriptioonf the connvtenisoa ndab breviatuisoeindns a ssigning entry Thes equefniceeli sd tlhaesf ti elind tehnet .r y naems. Thef irlsntie o f tfhier esntt rsyh owtsh atth earree 838 bpaaisreis n t hiss eque,n wcheicihn cludes 320 Thed efiniftoilolno wtihnee gn trnyam gei vetsh e adeniens,1 12 cytoseis,n 132g unain,e asnd2 74 nameo ft hes ourcoera gnisamn do theirno frmation thymsi.nF einlay,l thea ctusaelq ueinsc lesi tedan d descritbhiesn egq ue.n Fcoere xamep,"l a.n idaunlsm t clearnlumyrb ee.d apocytocbh r(oocmbea )g enee;x oln" i ndicattheast thee ntrcya lleAdN IMTCcYoBnlt aienxso n1 oft he Plearseef teort het echniacppaeln diacfetset rh e micthoondrcioabla gceondeifn ogar p otcoychrbo imne datas ectioinnse ach voflouarmdd ei tniaold etails Aspergilnliduusl .a Tnhsen otat"iD[oNnA ]i"mm ediatelya boutth eco nnvteoinsu seidn p resegn tthieen ntsr iine followtihnegd efitninio indicattheatsth es equence thicso llteinco.T he inadti ceteshn edo fe acvho lume represae dnotusb le-stDrNaAmn odleedec .u l inclubdrei eexfp laatninsoa ndi nsutcrtiofnosr t hier us.e On thsee conldni e of eache nrty, the corerpsondiEnMgB LI D naamreesg ievn. Thee ntry callAeNdI MTCcYorBerls pontdots h eEM BLe ntrcya llde MIA0N2,a ndA NIMTCcYoBre2sr pontdosM IAN.0 3The acecssinounbm erasp penaerx. t Eacohf theseen rteis has tawceocs sionunm rbs,e sicne thespear tuilcar entrwieersoe r iingallye nteriendd ependienne talcyh datasbe.a The dfaiteeal tdt hee ndo f tsheec olnnide indicattheatsth eseent rsi weermeo srte cenrtelvyi sed int heGe nBarnekal seed ate1d N ovem1b9e8.r3 Thel isotfr eefrencbeesg ionnst het hirlndie o f theseen rtise. Then otati"o[nl( ]abs e1s t o8 38)" indicattheatsth er efeenrcei nt hef irsetn triys refreerdt oa sr efeenrc[el a]n dt haitt tihses ource oft he bnausbmeesr efdr o1m t o8 38i nt hee nt.r yThe remaindoefr t her eerfenclesi tgi nisa fairly conventciiotniaaotlnf ort hpea rticruefleanrrce .e Thek eyworfdise ladp peanresx .t Theset wo entriceasnb e looukpe uds intgh et wo keywords "cytocharnod"m aep"o cytocihntr hoKeme ey"w oPrhdr ase Ind.e xThen extf ie,l tdhes our,cl esitsf irtshte commounsleynd a moef t hes ourocreg aniAssmep,r gliuls nidul,a fnosllobwye dt hes cinetfiicn ameu setdo classtihfoeyr ganiinst mh et axonocmliacis fsciation indeMxi,t ochonAdsrepirognui sl nlidul.a nIsnm any caess,s ucahs t hoset hiiensx amep,tl het wop artso f thes ourfciee alrdes omewrheadtu nnt.d a Thec omemn,tb eginnointn hge nlenixet of the ent,r ygivebsr iienff ormaatboiuotn entther( yat ken from rteehrfee ncaen)dr eefrsth er eadteoro thelroc i (netreis)t hat nhaamvebese ginn"iNAnIgM TBC".Y Thretea blaepsp enaerx t eaicnoh f t heseent ri:e s a siets tablaen dt wof eatutraelbse. s Atlhlr eoef thestea bliensd ictahtpeeo rtioofnt sh essee quences thacto dfeo arp oyctochrbo;mt eh iisn clutdheebsa ses numrbeedf ro1m2 6t o1 31i nA NIMTCaYnBdbl a se7s7 to 734i nA NIMBT2.C YTheE MBLf eaturteasb lewse re incluidnet dh estew oe nrteiss incteh eye xpilcitly statteh er eadifnrga mfeo rt hec odonisn these xiv NucleoSteiqduee n1c9e8s6 /1987 Secito6n :P lanSte quences SectiSounmm ary ------ Code Source of SequenceR eporEtnst rieBsa sePsa ge ---- --- --- ---- -�--- AAW Aspregisl luamwoari 2 1 341P1L ANT-9 AMA Antirurmhm ianjus 5 3 1614P LAN1T0- ANG Aspregisl nliuger 2 1 260P2L AN1T1- ANI Aspregillniudsu lans 4 4 434P6L ANT-12 ATH Arabidotphsailnsai a 1 1 3915P LANT-14 BLY Barley 12 12 853P5L ANT-14 BNA Brassniacpau( saR peese)d 2 2 127P9L ANT-18 CAR Convolvaurlvuesn sis 1 1 570P LANT-19 CEN C.e nsifo(raJmcikbs e a)n 1 1 102P7L ANT-20 CRE Chalmydomsopn.a s 7 7 727P8L ANT-20 FLX Flax 5 5 172P6L ANT-23 FSO Fusarsioulma (nufin g)u s 1 1 883 PLANT-24 LGI Lemngai bba 3 3 1010P LANT-25 LLU Lupinluust eus 1 1 346 PLANT-26 MCA Medicsaagtoi va 1 1 276P LANT-26 MZE Maize 43 36 5185P2L ANT-26 NEU Neurospora 42 36 1814P2L ANT-42 PEA Pea 11 11 18196P LANT-53 PET Petunia 6 6 231P4L ANT-57 PHO Petroisneuhlmo rtsee(n aprsl)e y 1 1 1431 PLANT-60 POT Potato 1 1 143P7L ANT-60 PVU Phaseovluulsg aris 10 7 905P8L ANT-61 RIC Rice 1 1 181P2L ANT-64 RYE Rye 1 1 649P LANT-64 SAL Sinapis( uMasltba)ar d 2 2 344P LANT-64 sco Schizophcyolmlmuumn e 1 1 103P4L ANT-65 SLM SlimMeo ld 97 70 6535P1L ANT-65 SOY Soybean 44 37 5257P3L ANT-92 SSI Scilsliab erica 4 4 204P LAN1T0-8 TOA Thaautmococdcanuisel li 1 1 931P LAN1T0-8 TLA Thermomlyacneusg inosus 1 1 557P LAN1T0-9 TOB Tobacco 2 2 124P9L AN1T0-9 TOM Tomato 2 2 1711P LAN1T01- VFA Viac ifab(arB oabde a)n 2 2 384 P-L1A1N0T WHT Wheat 30 24 2943P3L A-N1T11 YSC Yeas(taS ccharocmeyrceevsi )s ia2e86 227 P2L7A7N11T28-19 YSD Saccharodmiyacsetsa ticus 1 1 275P3L AN1T3- 2 YSG Yeas(taS ccharocmayrclessb esr)g e1n5s i 12 24173 PL1A3N T-2 YSH Yeas(taH nsensup)l a 3 3 720P LAN1T9- 2 YSK Yeas(tlK uyverosmp)y ces 11 1212 29P2L ANT-220 YSP Yeas(tcS hiozsaccharpoommy)bc ees 30 30 2470P3L ANT-225 YSQ Yeas(tiP chpiaas otrsi) 1 1 350P LANT-236 YSR Yeas(taS ccharormoyescie)s 1 1 278P LANT-236 YST Yeas(tnU knoswpenc i)e s 18 17 366P3L ANT-236 YSU Yeas(taC ndiudtaii ls) 1 1 384P LANT-241 Sumamr:y 717 5946 43365 Entry DNeamsec ripatnidL oenn gth Page -- ---- --- - AAGWIGIIA .awraimg olucoamgyelenassG,el a ndG 2.3 411.BP. ... . . . . . . . .. . .P.LA.NT.-9. AMACHSTSAnla pdr(angAtonih rirnummau js; n5i3)v/ inseretlieomneT nAMt1 ,l etf jnucti.o2 n62B.P PLANT-10 AMACHSTSAn2a pdr(angAtoinr rhinmuamuj s; niv/ in5s3e)retleimoennT tA M1 ,r ihgtj nucti.o6 n01B.P PLANT-10 AMACHSYS narpadgo(nnA tirrhinmuamuj s)A m3( hcalcosnyen th)ag seen,ew itThA M1 inesrito3n0 1BP PLA-N1T1 ANGGGIII An.igegrl ucoamgyelna,esG sela nd .2G 2602.BP. . . ........ . . . .. . .PL.AN.1T1- ANIADH3A spelrlguinsi dulAaDnHsg3 e neen codailncgo hdoelh ydrog3e,cn oamsep leedt.se 1676BP P.L ANT-12 ANISPOCAln. idulSapnosCg le ncel ustiencrl udrienpge arte-g3i aonnd Rm2R-NCcA o dirnegg i.o1 n280BPP LANT-13 ANISPOCA2n. idulSapnosCg le ncel ustienrcd liunrge pearte-ig3o na ndR 2-C* psemuRdNo1Ag2 e8n8eB P PLANT-13 ANITRPCA n.idultarnpsgC e n,ep artisaelq ucee.n1 02B.P . . . ... . . PLANT-13 ATHADH At.hailanaal cohdoelg ydroggeenn,aec soem pleedt.se3 159BP. . PLANT-14 BLYAMYABAa rlaelypa h-almaystey pAe i sozymmReN,A c ompleedt.se1 588BP PLANT-14 BLYAMYABBaAr laelyp -haamlyastey pBe i sozymmReN, Ac lon1e0. 35 95B.P . PLANT-15 BLYAMYABBaBr laelyp -haamlyastey pBe i sozymmReN,A c lnoe1 6.85 12B.P . PLAN1T5- BLYAMYABBaCr laelyp -haamlyastey pBe i sozymmReN,A c lon96e. 1 58B.P . . . . PLAN1T5- BLYAMYABBaDr laelyp -haamlyastey pBe i syomzem RN,Ac ompleedt,sec lonpMe/ .C1 479BP PLANT-16 BLYAMYABBaEr laelyp -haamlyastey pBe i sozymmReN,A c ompleedt,sec lnoep HV1.91 119BP PLAN1T6- BLYAMYGB arlheiyhg pli sozyomfae lp ha-yalmasgee n,e clonlema bday-3a2m.b3 25BP PLAN1T7- BLYlBHOR barlbelyh oridnem rn(aap rti)a 1l.5 2B.P . . . . . . . . . . PLAN1T7- BLYlBHORDB arl(eoHyr devuuml rge)aB l-hormdReN,iAc nl onpBel l.8 68B.P PLANT-17 BLYB3HOBRaDr l(eoHyr devuuml gaLr.)eB 3h-ordemiRNn,A c lnoep B.79 54B.P . . .. . PLAN1T7- PLAN1T -