loading

Logout succeed

Logout succeed. See you again!

ebook img

PDF - BioMed Central PDF

pages12 Pages
release year2013
file size0.62 MB
languageEnglish

Preview PDF - BioMed Central

Morrisonetal.BMCGenomics2013,14:627 http://www.biomedcentral.com/1471-2164/14/627 RESEARCH ARTICLE Open Access The splice site variant rs11078928 may be associated with a genotype-dependent alteration GSDMB in expression of transcripts Faer S Morrison1, Jonathan M Locke1, Andrew R Wood2, Marcus Tuke2, Dorota Pasko2, Anna Murray2, Tim Frayling2 and Lorna W Harries1* Abstract Background: Many genetic variants have been associated withsusceptibility to complex traits by genomewide association studies (GWAS), but for most, causal genes and mechanismsof action have yet to be elucidated.Using bioinformatics, we identified index and proxy variants associated withautoimmune disease susceptibility,with the potential to affect splicing of candidate genes. PCR and sequence analysis of whole blood RNA samples from population controls was then carried out for the8 most promising variantsto determine theeffect of genetic variation onsplicingof target genes. Results: We identified 31 splice site SNPs withthe potential to affect splicing, and prioritised 8to determine the effect of genotype oncandidate gene splicing. We identified that variantsrs11078928 and rs2014886were associated with altered splicing of theGSDMB and TSFM genes respectively.rs11078928,present in theasthma and autoimmune disease susceptibility locus onchromosome17q12-21, was associated withtheproduction of a novel Δexon5-8 transcript ofthe GSDMB gene, and a separate decrease in the percentage oftranscripts with inclusion of exon6, whereasthe multiple sclerosis susceptibility variantrs2014886, was associated withan alternativeTFSM transcript encompassing a shortcryptic exon within intron 2. Conclusions: Our findingsdemonstrate the utility of a bioinformatic approach in identification and prioritisation of genetic variants effectingsplicingof their host genes, and suggest that rs11078928 and rs2014886may affect the splicing ofthe GSDMB and TSFM genes respectively. Keywords: GSDMB, Rs11078928, Asthma, Autoimmunedisease, GWAS, SNP, Alternative mRNAsplicing Background as causal for a particular disease and the mechanism Genome wide association studies (GWAS) have greatly whereby the SNP confers disease risk identified. For ex- increased our understanding of the genetic basis of ample, GWAS has identified hundreds of loci associated many complex diseases and traits by identifying single with susceptibility to inflammatory or autoimmune dis- nucleotidepolymorphisms(SNPs)thatactassusceptibil- eases such as Crohn’s disease, asthma, multiple sclerosis ity factors for these diseases [1,2]. However, the results (MS) and type 1 diabetes (T1D), furthering our under- of GWAS only give us a genomic region associated with standingofthegeneticbasisofthesediseasesandidenti- a particular disease or trait, and the causal SNP, gene fying areasofthe genomefor furtherstudy [3]. However, and importantly, mechanism of action remain elusive. apart from a variant in the immunity-related GTPase Todate, onlyahandfulofSNPshavebeendemonstrated family, M (IRGM) gene, which has been shown to confer susceptibility to Crohn’s disease by altering miRNA binding at the site of the SNP [4], the causal genes and *Correspondence:[email protected] mechanisms in most cases remain to be identified. 1RNAmediatedmechanismsofdiseasegroup,UniversityofExeterMedical School,EX25DWExeter,UK Fulllistofauthorinformationisavailableattheendofthearticle ©2013Morrisonetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited. Morrisonetal.BMCGenomics2013,14:627 Page2of12 http://www.biomedcentral.com/1471-2164/14/627 The slow rate of progress in converting advances made Results byGWASinto afuller understandingofwhichgenes are SNPsassociatedwithautoimmuneorinflammatory associated with disease, and their mechanistic actions, diseasesareenrichedforsplicesitevariants could bea reflection ofthe focus on protein coding vari- We performed a series of bioinformatic analyses to iden- ants, whereas most SNPs are in fact within non-coding tify genetic variants that could potentially alter splicing of regions of the gene [5,6]. At least 80% of the human their host genes (Figure 1). 338 SNPs associated with one genome has now been demonstrated to contain import- ormoreautoimmunediseasesorinflammatorytraitswere ant regulatory sequences such as enhancers, silencers, identified that reached genome wide significance, and small RNA binding sites and chromatinmodifiers [7-12]. 7322 proxies were identified to these index SNPs. Of An important mechanism of gene regulation, alternative these, 31 SNPs were annotated as ‘splice_region_variant’ splicing,isacomplexprocessrequiringover100splicing using the Biomart program (Ensembl; http://www. factors that recognise regulatory elements such as ensembl.org). When compared to 1000 sets of 338 exonic and intronic splicing enhancers and silencers randomSNPsandtheirproxies,wefoundthat0.41%vari- (ESEs, ESSs, ISEs, ISSs), which bind trans-acting splicing antsassociatedwithautoimmuneorinflammatorypheno- regulatory factors [13] that bind to the mRNA types were located in splice regions, compared with a secondary structure [14]. Regulatory elements include mean of 0.28% for randomly selected variants (one tailed the splice acceptor AG, the polypyrimidine tract, the t-testp=0.028; Figure 2), indicating that inflammatoryor splice donor GT and the branch site adenosine residue autoimmuneSNPSwereenrichedforsplicesitevariants. [13]. In addition disruption of any of these sequences has the potential to alter splicing by re-directing TwoSNPsinsplicesiteregionswereshowntoproduce the spliceosome or by altering binding of auxiliary alternativespliceproducts factors to exonic and intronic splicing enhancers and 8 variants were prioritised for further analysis on the silencers. basis that they had the potential to create cryptic splice In this study, our aim was to follow a bioinformatic sites,interrupt polypyrimidine tract sequences or disrupt pipeline in order to identify autoimmune disease- regulatory elements involved in splicing. The 8 variants associated variants with the potential to effect splicing, prioritised for further analysis using this pipeline are and to follow up interesting candidate variants by shown in Table 1. Unusual bands were identified for half mRNA analysis in whole blood, an appropriate tissue for of the variants tested upon RT-PCR (rs11078928 the analysis of autoimmune or inflammatory disorders. (GSDMB), rs2014886 (TSFM), rs1260326 (GCKR) and In this article, we report two variants in two genes that rs3764021 (CLEC2D). Two bands (GCKR, CLEC2D) exhibit a genotype-associated effect on mRNA process- wereartifactual,andtheremainingtwo(GSDMB,TSFM) ingoftheirhost genes. were further characterized and sequenced. We found no Identification of all index Identification of proxy Identification of functional autoimmune/inflammatory variants to 338 index SNPS consequence for each SNP SNPS in NIH (n = 338) using SNAP (n = 7322) using ENSEMBL BioMart Variants analysed Variants potentially 8 SNPs prioritised for bioinformaticallyusing ESE affecting Splice sites further study by RT-PCR finder, FlyBaseand Alamut identified. (n = 31) to predict splicing changes. Figure1BioinformaticpipelineusedtopredictsplicesiteSNPsthatareassociatedwithautoimmunediseasesandinflammatorytraits. IndexinflammatorySNPswereidentifiedthathadbeenassociatedbyGWASwithsusceptibilitytoautoimmunediseasesandinflammatorytraits. TheproxiestotheseGWASSNPswerepulledusingtheSNAPProxySearchtool(BroadInstitute).The‘functionalconsequencetotranscript’for eachSNPwasidentifiedasbeing‘SpliceSite’or‘EssentialSpliceSite’usingtheBiomartfunctionofEnsembl.TheseSNPswerethen bioinformaticallyanalysedtopredictwhetherasplicingchangewaslikelytooccur,usingtheprogrammesESEfinder(web-basedtoolthat predictsESEelementsequencesthatareboundbySRproteins),NNSplice(web-basedtoolthatalgorithmicallypredictscorespicesitesequences inagivensequence)andAlamut(splicingmutationpredictionprogrammethatamalgamatespredictionsfromfivedifferentsplicesiteprediction algorithmstoidentifypotentialcoresplicesitesinagivengenetranscript).AsubsetofSNPswasthenprioritisedforfurtheranalysisoftheir splicingbyRT-PCR.ThenumbersinbracketsdenotehowmanySNPswereidentifiedateachstage. Morrisonetal.BMCGenomics2013,14:627 Page3of12 http://www.biomedcentral.com/1471-2164/14/627 Figure2Enrichmentofvariantsassociatedwithinflammatoryorautoimmunephenotypesinsplicingcontrolregions.Weassessedthe numberofrandomlyselectedvariantslocatedinsplicingcontrolelementsbychance.Foreachsetof338‘index’SNPsandtheirproxies,the percentageofvariantslocatedin‘spliceregionelements’isgivenontheX-axis(simulatedpercentage),andthenumberofSNPsateach percentage(count)isgivenontheY-axis.TheobservednumberofautoimmuneorinflammatorySNPslocatedin‘spliceregionelements’isgiven bytheline. evidence of altered splicing caused by the remaining vari- Moreover, four reference transcript sequences are ants, although we cannot rule out splicing changes not described for this gene in expressed sequence tag identifiedbecauseofprimerplacementortranscriptlevels. (EST) databases; two transcripts (NM_001165958.1 and NM_001165959.1) include exon 6, whilst this exon Rs11078928causestwoseparatesplicingchangesinthe is deleted in the remaining two (NM_001042471.1 and GasderminB(GSDMB)gene NM_018530.2). Therefore, we quantified relative ex- We found two separate splicing changes associated with pression of these different isoforms according to geno- the variant rs11078928 in the gene GSDMB. These type using Taqman Assays (Life Technologies, Foster changes include production of a novel transcript of City, USA) (Additional file 2). Although there was no GSDMB and a change in isoform ratio. The novel band significant change in expression of the isoforms lacking associated with rs11078928 was found upon sequence exon 6, we found that the isoforms which include exon characterisation to be a large deletion product lacking 6 have almost no expression in homozygotes for the exons 5–8 of the gene GSDMB (Figure 3A and minor allele of rs11078928 compared with heterozy- Additional file 1). To determine whether this deletion gous individuals, and those homozygous for the A was associated with genotype and therefore caused by allele (p=0.0002; Figure 3C). This striking genotype- the variant rs11078928, we designed Taqman assays to specific expression difference suggests that rs11078928 the wild-type and novel transcripts as described above or an associated variant may be altering exon 6 inclusion from the custom assay service available from Life Tech- intheGSDMBtranscript.TheAlamutMutationInterpret- nologies (Life Technologies, Foster City, USA). We ation Software (Interactive Biosoftware, Rouen, France) found evidence to suggest a genotype-associated effect predicted that rs11078928 would result in deletion of on the expression levels of this deletion product; with exon 6. We also quantified expression of the WT tran- homozygotes for the major (A) allele, showing in- script and overall expression of GSDMB, to determine creased expression of this alternate Δ5-8 transcript, and whether these were altered by genotype. The expression homozygotes for the minor (G) allele showing negli- differences between genotypes showed decreased ex- gible expression of the transcript compared with het- pression for those individuals carrying the minor allele, erozygous individuals or those homozygous for the A although they did not reach statistical significance (re- allele (p=0.0001; Figure 3B). sults shown in Figure 3D-E). hM ttp://worriso wn w e .b ta io l. m B e M d C TPraobxlye1The8splicGeWsiAteSvSaNriPanstpsrinioritisPevdalfuoerfurtherPahnenaolytyspiseafterfollPoIDwingthr2ebioHionsftogremnaeticAplliepleeslifnoersspelticoeutConsequence Prediction/location central.com2Genomics (i.e.splicesiteSNP) LDwithSNsPpslicesite (riskallele) osiftespSlNicPe siteSNP totranscript /1471-2013,14 rs11078928 rs2872507 5×10-11 Ulcerativecolitis(A) 21297633 1 GSDMB A>G EssentSiaitleSplice Des5t:roPryesdAicGteodfsakcipceopftoerxospnli6ce(Asliatemiuntt)ron 164/1:627 4 rs2872507 5×10-9 Crohn’sdisease(A) 18587394 1 /6 2 rs9303277 2×10-9 Primarybiliarycirrhosis 20639880 0.905 7 (T) rs2290400 6×10-13 Type1diabetes(?) 19430480 0.905 rs7216389 9×10-11 (Asthma(T)) 17611496 0.905 rs2014886 rs703842 5×10-11 multiplesclerosis(A) 19525955 0.964 TSFM C>T EssentialSplice Introducescrypticdonorsplicesiteintron Site 2:Likelytoresultinalternativeexoninclusion rs1260326 rs780094 7×10-15 C-reactiveprotein(A) 18439548 0.933 GCKR T>C SpliceSite 1bpfromGTofsplicedonorexon15,alters splicesitescore rs780093 5×10-11 Crohn’sdisease(T) 21102463 0.901 rs10263341 rs886774 3×10-8 Ulcerativecolitis(G) 19915572 0.803 DLD T>C SpliceSite Mayinterruptpolpyrimidinetractintron6 rs1322077 rs2301436 1×10-12 Crohn’sdisease(T) 18587394 0.904 FGFR1OP T>C SpliceSite Mayinterruptpolpyrimidinetractintron5 rs2020854 rs2066808 1×10-9 Psoriasis(A) 19169254 1 STAT2 A>G SpliceSite Mayintroducecrypticdonorsiteintron14 rs55719896 rs8049439 2×10-9 Inflammatorybowel 19915574 0.965 ATXN2L G>A SpliceSite DestroysAGofcrypticacceptorsplicesite disease,earlyonset(G) intron20 rs4788084 3×10-13 Type1diabetes(G) 19430480 0.824 rs3764021 rs3764021 5×10-8 Type1diabetes(G) 17554300 1 CLEC2D C>T SpliceSite Mayintroducecrypticdonorsplicesite exon2 Thetableshowsthe8SNPsthatliewithinsplicesitesofthegeneslisted.TheindexGWASautoimmune/inflammatorySNPsthatareinLD(r2<0.8)withthesplicesiteSNPsareshown,aswellasthesplicesite prediction/location.PIDPubMedAccession,LDlinkagedisequilibrium. P a g e 4 o f 1 2 Morrisonetal.BMCGenomics2013,14:627 Page5of12 http://www.biomedcentral.com/1471-2164/14/627 A GSDMBWT isoforms 4 5 8 9 4 5 6 8 9 4 5 7 8 9 4 5 6 7 8 9 rs11078928 GSDMB NV isoform 4 9 Probe Primer B 2.5 *** C 6 2 *** n V 2 o 1.5 N x DMB 1.51 B + e 1 S M G 0.5 D 0.5 S 0 G 0 AA AG GG AA AG GG D E 2 2 B M 1.5 B1.5 D M G S 1 SD 1 otal 0.5 WT G0.5 T 0 0 AA AG GG AA AG GG Genotype Genotype Figure3Wild-type(WT)andNovelVariant(NV)isoformsoftheGSDMBgeneandtheirexpressionwithgenotype.A.Showingexons 4–9ofthefourRefSeqisoformsandthenovelGSDMBtranscipt(GSDMBNV),whichismissingexons5–8.HalftheReferenceSequence(WT) transcriptsincludeexon6andtwoarelackingexon6;NM001165958.1isthefulllengthtranscript.Thestarshowsthepositionofrs11078928 (acceptorsplicesiteofintron5).ThelocationoftheCustomTaqmanAssayPrimers(indicatedbyanarrow)andprobe(indicatedbyarectangle) areshown.B.ChartshowingtheexpressionofthenoveltranscriptGSDMBNVbygenotype.Homozygotesfortheminoralleleshownegligible expressionofthenoveltranscript.ExpressionisnormalisedtotheendogenouscontrolRPLPO,andisshownrelativetotheexpressionofGSDMB NVinheterozygotes.Significantresults(P<0.05)areindicatedbyanasterix.C.ChartshowingtheexpressionwithgenotypeoftheGSDMB transcriptswhichincludeexon6(NM001165958.1,NM001165959.1).Homozygotesfortheminoralleleshownoexpressionofexon6-containing transcripts.ExpressionisnormalisedtotheendogenouscontrolRPLPO,andisshownrelativetotheexpressionofexon6GSDMBtranscriptsin heterozygotes.D-E.ChartsshowingtotalexpressionofGSDMB(allRefSeqisoforms,includingnovel)andexpressionofGSDMBWT(allRefSeq isoforms).ExpressionisnormalizedtotheendogenouscontrolRPLPO,andisshownrelativetototalandWTexpressionrespectivelyin heterozygotes.Bothshowadecreaseinexpressionwiththeminorallele,althoughtheseresultsdidnotreachstatisticalsignificance. Rs2014886createsacrypticdonorsplicesiteandalters donor site is created by rs2014886 and which has EST splicing of the Ts translation elongation factor, mito- (expressed sequence tag) evidence of use [15], but which chondrial(TSFM)gene. is not present in the reference sequence (RefSeq) tran- We identified a novel band in carriers of the ‘T’ allele scripts. This donor site is preceded by a strong acceptor for rs2014886 which we were unable to isolate by con- site that is present 38 bp upstream of the variant, which ventional means due to the large size of the product. alsohasevidenceofuseinESTdatabases[15](Figure4A The size of the band (~530 bp) corresponded to aTSFM and Additional file 3). We therefore designed RT-PCR transcript with the inclusion of a short exon, where the primers specific to the predicted novel transcript, to Morrisonetal.BMCGenomics2013,14:627 Page6of12 http://www.biomedcentral.com/1471-2164/14/627 A TSFM WT 2 3 TSFM NV 2 3 rs2014886 Probe Primer TSFM MT B 3 *** o ti 2.5 a R n 2 o si 1.5 s e 1 r p x 0.5 E 0 CC CT TT Genotype Figure4WTandNVisoformsofTSFMandtheirexpressionwithgenotype.A.Showingexons2–3oftheRefSeqtranscript(therearefour RefSeqisoformsforTSFM,however,theyareidenticaloverthisregionofthegene)andthenovelTSFMtranscript(TSFMNV),whichhasan alternate38bpexonincludedbetweenintrons2and3.Thestarshowstherelativepositionofrs2014886(introducinganintronicdonorsplice sitewithinintron2.B.ChartshowingtheexpressionofthenoveltranscriptTSFMNVbygenotype.Homozygotesforthemajoralleleshow negligibleexpressionofthenoveltranscript.ExpressionisnormalisedtotheendogenouscontrolRPLPO,andisshownrelativetotheexpression ofTSFMNVinheterozygotes.Statisticalsignificanceisindicatedbyanasterix. confirm its identity. By this method, we were able to se- of the 8 SNPs (rs11078928 and rs2014886) on the pro- quence the product and verify that the transcript in- cessing oftheGSDMB andTSFMgenesrespectively. cludes a short 38 bp exon insertion within intron 2 of Variant rs11078928 is associated with two separate TSFM (Figure 4A). Expression of the novel transcript splicing changes in the gene GSDMB, which could pos- was found to be associated with genotype, with individ- sibly be of functional significance, whereas, the effect of uals carrying two minor (T) alleles expressing the novel rs2014886, within TSHM most likely has little functional transcript at levels approximately 2-fold higher than in- consequence, since it is not affected by genotype. For dividuals carrying two major (C) alleles (p=0.00005; the remaining 6 SNPs, we found no evidence for altered Figure 4B). However, we found no significant differences splicing. This could indicate that the SNPs in or near in expression between individuals of different genotypes these splice sites were too weak to re-direct the splicing forexpression oftotal TSFM andTSFM WT. machinery, although it cannot be overlooked that the sensitivity of the assays may have affected identification of splice variants (especially at low levels of expression). Discussion Alternatively, these genes may be differentially expressed Although hundreds of SNPs have been associated with in a tissue other than blood. Nevertheless, variation in autoimmune diseases by GWAS [1,2] the causal gene splicingregulatorysequencesleadingtoaberrant splicing and mechanism in most cases remains elusive. We is a relatively common occurrence and may explain prioritised8variantswithbioinformaticevidencetoalter some ofthesignalsidentifiedbyGWAS[16]. splicing by creating cryptic splice sites, interrupting Variant rs2014886, a C > Tchange in intron 2 of the polypyrimidine tract sequences or disrupting regulatory TSFM gene, was predicted to create a cryptic donor elements involved in splicing. Here we provide evidence splice site within the intron, and transcripts derived thatabioinformaticpipeline maybefollowedinorderto from the use of this cryptic splice site, 38 bp down- identify and prioritise variants that are likely to affect stream of a strong acceptor splice site, are represented splicing of their host gene. We have identified a in EST databases [15]. We confirmed that the minor al- genotype-associated effect on alternative splicing for two leleoftheSNPleadstotheproductionofthisalternative Morrisonetal.BMCGenomics2013,14:627 Page7of12 http://www.biomedcentral.com/1471-2164/14/627 splice product, which includes the 38 bp short exon rs11078928, an A > G change in the acceptor splice site within intron 2. Negligible amounts of the insertion of intron 5 of the GSDMB gene, is associated with two product (referred to as TSFM NV) were expressed from separate alternative splicing events. Firstly the major (A) the transcripts carrying the major (C) allele (Figure 4B). allele of rs11078928 is associated with exon skipping, The difference in age between genotypes in our cohort resulting in a splice product missing exons 5–8 (referred for the variant rs2014886 reached statistical significance, to as GSDMB NV), whereas this does not occur in indi- so it is possible that the effects we note for TSFM spli- viduals carrying the minor (G) allele. The cause of the cing could be driven by differences in mean age rather deletion is not easy to ascertain, but could be attribut- than genotype. The insertion of the novel 38 bp intron able to changes in the RNA secondary structure induced causes a frameshift event leading to the generation of a by this SNP, which could alter binding of the splicing premature termination codon at a position 85 bp down- machinery (Figure 5). It is also possible that another stream of the insertion. This would in all probability SNP or SNPs in linkage disequilibrium (LD) with render the novel transcript susceptible to the nonsense- rs11078928 may be causing this splicing alteration. Al- mediated decay mRNA surveillance pathway [17]. TSFM though WT GSDMB and total GSDMB expression was has been identified as a likely candidate gene in multiple decreased in those carrying the minor allele, these sclerosis susceptibility [18], and its expressio14, para 2n changes did not reach statistical significance, indicating was recently found to be correlated with a variant that thatthediseasesusceptibilitymaybeattributabletoagain alters an enhancer region [19]. Therefore, since overall of function effect from the novel transcript, rather than expression of all TSFM isoforms and of the four refer- the amount of the GSDMB transcript pool (Figure 3). It ence sequence isoforms (TSFM WT) was not signifi- is difficult however to speculate as to the effect of this cantly altered by genotype, we conclude that the exon large deletion on GSDMB protein function, since little inclusion caused by the SNP is unlikely to be of func- is known about the structural function of this protein. tionalsignificance. Secondly, we identified that subjects carrying the minor The genotype-specific splicing changes of the GSDMB (G) allele of rs11078928 exhibit skipping of exon 6 of gene may be of more potential importance. Variant the gene, with homozygotes for the minor allele Figure5ShowingthesecondarystructurechangewiththemajorAallele(right)andtheminoralleleG(left),aspredictedbyMfold (http://mfold.rna.albany.edu/?q=mfold).Thearrowsindicatethepositionofthevariantrs11078928intheGSDMBtranscriptsequence. Morrisonetal.BMCGenomics2013,14:627 Page8of12 http://www.biomedcentral.com/1471-2164/14/627 expressing very little full length product (transcripts bywhich the17q12-21locusmay alter asthma andauto- containing exon 6). immune disease susceptibility comes from two studies Takentogether,these changesindicatethatwhilstindi- by the same group, who identified a 5.3 kb region over- viduals homozygous for the major (A) allele do express lapping the ZPBP2 gene, whichis associated with several the Δ5-8 deleted GSDMB product, they also express the gene regulatory marks, including allele-specific chroma- full length exon 6-containing isoforms. Conversely, indi- tin interactions, DNA methylation and promoter activity viduals homozygous for the minor (G) allele do not ex- [20,25]. It has been hypothesised that this regulatory re- press either the deleted GSDMB product or the full gion may be involved in long-range chromatin interac- length product (isoforms containing exon 6), as reflected tions and may influence the expression of any one or all in their lower overall expression. This may suggest some ofthegenesGSDMB,ORMDL3 andZPBP2[20,25]. functional importance of the region of the GSDMB pro- ZPBP2 has a well-known role in fertilisation and male teinencodedbyexon6,butthereisverylittleinformation fertility, and it has been proposed that this gene may onthenatureofthisregioninthecurrentliterature. play a role in influencing the prevalence of asthma in GSDMB encodes for the protein Gasdermin B, which the population [25]. ORMDL3 has so far been thought is a member of the gasdermin-domain containing pro- to be the most promising candidate at this locus, since it tein family. Although the exact function of GSDMB re- has a role in mediating inflammation, and also has ex- mains unclear, members of the gasdermin-domain pression in bronchial epithelial cells, where slightly containing family have roles in epithelial cell apoptosis higher ORMDL3 expression was found in individuals and in maintaining a differentiated state of epithelial with asthma compared to controls [26,27]. GSDMB cells [20]. GSDMB has also been shown to be important shows a diverse expression pattern in tissues, including in cancer pathogenesis, with alternative splicing of the expression in the lung, liver, intestine and colon, but gene being involved in gastrointestinal and hepatic can- with very low expression in bronchial epithelial cells. cers [21]. The GSDMB gene contains several conserved However, it has been suggested that the effect of the amino acid sequences in the N and C terminal regions chromosome 17q12-21 locus on multiple diseases may as well as several conserved leucine-rich motifs through- reflect a more direct role on immune function rather out the sequence [22]. The deletion product described than any tissue-specific effect [20,28]. The expression of here, GSDMBNV,isinframe sowouldnotbesubject to GSDMB in the thymus and CD8+ and CD4+ T-cells nonsense-mediated decay and could plausibly be trans- would increase the plausibility of this inference, espe- lated into theprotein. cially given the involvement of type 1 and type 2 im- Variant rs11078928 is located on chromosome 17q12- mune responses in autoimmune and allergic disease 21, in an area which was identified in 2007 to be associ- respectively [20,29]. ated with asthma susceptibility (rs7216389), as well as Although genome-wide analysis of transcript isoform susceptibility to developing several autoimmune dis- expression in the CEU HapMap population found no eases, including ulcerative colitis (rs2872507), Crohn’s differences in the expression of GSDMB isoform ratios disease (rs2872507), type 1 diabetes (rs2290400) and pri- associated with the asthma haplotype in LCLs mary biliary cirrhosis (rs9303277) (seeTable 1) [23]. It is (lymphoblastoid cell lines) [30], the splicing of GSDMB interestingtonotethattheriskallelesforallergicdisease has been shown to be associated with genotype of the susceptibility are the alternative to that for autoimmune related variant rs7216389 in brain and in peripheral disease susceptibility, indicating opposite effects of the blood mononucleated cells [31]. rs7216389 is in the variants on pathogenesis of these diseases [24]. The same LD block as rs11078928 (r2 0.905, D’1.0), and our minor allele for rs11078928, increases risk for develop- data thus suggest the effect on splicing noted in this, ing these autoimmune traits (risk allele for type 1 dia- and in our study may be an effect of the splice site SNP betes not known) and confers a decreased risk to rs11078928. Interestingly Heinzen et al. found an over- developing asthma. This association has been replicated representationofautoimmunetraitsassociatedwithspli- several times by independent groups and in different cing quantitative trait loci (sQTLs), which could indicate populations, and there has been much debate over po- the importance of splicing differences in these diseases tential mechanisms of action and which is the causal [31]. Finally, LCLs may not offer a realistic representa- gene(s)inthatlocus. tion of regulation of in vivo gene expression [32], GSDMB, ORMDL3 (ORM1-like 3) and ZPBP2 (zona explaining the differences in GSDMB splicing patterns pellucida binding protein 2) have all been considered seeninprimarycelltypes andLCLs. good candidates, as they are all expression quantitative Thesedata are of course preliminary innature,andre- trait loci, with opposite directions of expression seen quire further work to assess the potential consequences with genotype for ORMDL3/GSDMB and ZPBP2. At of a reduction in GSDMB expression, or an alteration to present, the best functional evidence of the mechanism the pool of transcripts expressed from the GSDMB gene Morrisonetal.BMCGenomics2013,14:627 Page9of12 http://www.biomedcentral.com/1471-2164/14/627 to the function of tissues involved in immune function France),andFlybasefromtheBerkeleyDrosophilaGenome andinflammation. Futurestudiesshouldfocusonthe ef- Project (http://www.fruitfly.org/seq_tools/splice.html) [36], fectofalterationstotheGSDMBisoformpoolonfactors in order to predict how likely a splicing change would such as the inflammatory milieu in other appropriate occur as a result of the SNP (Figure 1 and Table 1). cell types to prove causality and further define mechan- Variants demonstrating good evidence of the capacity ism. It remains to be seen also if GSDMB splicing to modify splicing patterns were prioritised for further changes are also noted in individuals with asthma and transcriptomic analysis in mRNA derived from whole autoimmunediseases. blood samples from subjects of defined genotype. Conclusions AssessmentofsplicesiteenrichmentforSNPsassociated To conclude, we have demonstrated that a proportion of withinflammatoryorautoimmunediseases genetic variants identified as susceptibility loci for inflam- To determine the likelihood that SNPs associated with matory or autoimmune disease may act by disrupting the autoimmune or inflammatory phenotypes were located nativesplicingpatternsoftheirhostgenes.Usingbioinfor- in elements responsible for splice site choice by chance matics to identify variants likely to interfere with splicing alone, we selected 1000 sets of 338 random SNPs patterns,followedbyfunctionalevaluationinwholeblood, matched on allele frequency (± 5%) and gene proximity we have demonstrated alterations in the splicing of the (± 10 kb). For each set we retrieved all variants in link- GSDMB and TSFMgenes, whichisassociatedwithgeno- age disequilibrium (r2 >0.8 in 1000 Genomes Phase 1 type at rs11078928 and rs2014886 respectively. Although data in Europeans) and used them to query the BioMart the exon inclusion caused by the variant in TSFM is un- database using the‘biomaRt’ package. In each set we cal- likelytohaveanyfunctionalsignificance,ourdatasuggest culated the proportion of SNPs identified by BioMart as that rs11078928 is associated with the production of a ‘splice_region_variant’. Finally, we compared the propor- novel GSDMB transcript lacking an internal segment, to- tion of splice site variants in 338 autoimmune disease getherwithachangeintheratioofsomeknownisoforms. SNPs with proportions identified in 1000 sets of This is predicted to result in an almost complete lack of matched proxies and observed enrichment for splice site fulllengthGSDMBmRNAinindividualshomozygousfor variantsbyonetailed t-test. the minor allele. Although the functional significance of these changes remains to be determined, our study pro- Cohortinformationandsamplecollection vides further evidence that GSDMB is a promising candi- The samples used were from the Exeter 10,000 cohort date gene at the 17q12-21 locus, in altering susceptibility (http://www.exeter.crf.nihr.ac.uk/). GSDMB and TSFM tovariousautoimmunediseases,andasthma. total expression, expression of wild-type (WT) and novel (NV) transcripts, as well as GSDMB isoform specific Methods expression, were compared between 8–10 individuals Identifyingcandidategenesforsplicinganalysis homozygousforthemajoralleles,8–10heterozygousindi- We searched the National Institutes of Health (NIH) viduals,and5–8individualshomozygousfortheminoral- GWAScatalogue(http://www.genome.gov/gwastudies)[5] leles.Theindividualsincludedinthecohortwereofmixed to identify SNPs associated with known autoimmune dis- gender and were of predominantly White British origin. eases at genome wide significance (P<5×10-8). We fo- 20% of the GSDMB WT, NVand isoform-specific expres- cussedoninflammatoryandautoimmunetraitsaswehad sioncohorthaddiagnosedautoimmunedisease(AAn=2, access to an appropriate tissue, i.e. lymphocyte RNA, to AG n=2 and GG n=2), as had 23% of the GSDMB total assess splicing. We defined autoimmune diseases/ inflam- expressioncohort(AAn=3,AGn=2andGGn=0)and matory traits as those described in the literature as ‘auto- 21%oftheTSHMcohort(CCn=3,CTn=1andTTn= immune disease’ or ‘chronic inflammatory disease’. 1). The median ages were as follows: GSDMB WT, NV Next we identified proxy SNPs to these candidates that andisoform-specificexpression:62(AAn=10)61(AGn had r2 >0.8, and located within 500 kb of the index =10) 60 (GG n=5); GSDMB total expression (expression variant, using the SNAP Proxy Search tool (http://www. ofWTandalternativetranscripts)60(AAn=8)56 (AG n broadinstitute.org/mpg/snap/ldsearch.php) [33]. The =8) 54 (GG n=6); TSFM WT, NVand total expression functional consequence of each SNP on transcription 46 (CC n=8) 63 (CT n=8) 37 (TT n=8). The median was then identified using the BioMart function of ages between genotypes were compared using the Ensembl(http://www.ensembl.org)(HomosapiensVariation Kruskal-Wallis H test and did not reach statistical (dbSNPbuild135;ENSEMBL).SNPslabelledas‘SpliceSite’ significance (P<0.05) in the case of GSDMB. However, or‘EssentialSpliceSite’wereidentifiedandtheseSNPswere when comparing the median ages for theTSFM cohort, analysed in silico using ESE Finder [34,35], Alamut Muta- the differences between the groups of eachgenotypedid tionInterpretationSoftware(InteractiveBiosoftware,Rouen, reach statistical significance (P=0.04). The median BMIs Morrisonetal.BMCGenomics2013,14:627 Page10of12 http://www.biomedcentral.com/1471-2164/14/627 were as follows: GSDMB WT, NV, isoform-specific ex- GSDMB forward (5′- ACCCTTTTCATTCCGATCAA-3′), pression:27(AA)25(AG)26(GG);GSDMBtotalexpres- GSDMB reverse (5′- AAGTCCAGAATGGCTTTTGC-3′); sion 25 (AA) 26 (AG) 25 (GG); TSFM WT, NVand total TSFM forward (5′- GGTGTTTATCGCGGCTAGAG -3′), expression 25 (CC) 29 (CT) 22 (TT). The median BMIs TSFMreverse(5′-CAGAGGGTTGATCCTTTAGGG-3′); were compared using the Kruskal-Wallis H test and did TSFM NV forward (5′- GACCTCAAACAGACGGAG not reach statistical significant for any of the groups. Me- TCTTGCT-3′),TSFMNVreverse(5′-TCTTTGGTCTTC dian white blood cell counts were compared using CTCCCTTGGAGC-3′), GCKR forward (5′- GGCTTTCT Kruskal-Wallis H test and did not reach statistical signifi- CATTGGTGATCACAGTGA-3′),GCKRreverse(5′-AGC cance across any of the groups. Data and statistics for TTGGAGTTGCTAATCCGAAGGT-3′);DLDforward(5′- these parameters are given in Additional file 4. Current CTTGGTGGAACATGCTTGAA-3′),DLDreverse(5′-CC medication and past medical history were known for ATCTGACTTCTTGGTAGCAC-3′), FGFR1OP forward the donors. 2.5 ml peripheral blood specimens were (5′-TCCTTTAGTTAATGAGAGCCTGAAA-3′),FGFR1OP collected using PAXgene technology [37] and extracted reverse (5′ CAGACTTCCTGCTTGCTTCC-3′); STAT using the PAXgene Blood mRNA kit (Qiagen, Crawley, 2 forward (5′- TCCTCCTCAATTACAAGGCTTC-3′), UK) according to the manufacturer’s instructions. Re- STAT2 reverse (5′-TGCTCAGCTGGTCTGAGTTG-3′); search was carried out in accordance with the Helsinki ATXN2Lforward(5′-CCAAGCCCTTTATGCCACT-3′), Declaration, and ethical approval was granted by the ATXN2L reverse (5′- GAAGCTGCTCTGAGGGGACT-3′); Bristol Regional Ethics Committee (study number 09/ CLEC2D forward (5′- AACCCAGGTTGTCTGCATTC-3′), H0106/75). Written informed consent was obtained for CLEC2D reverse(5′-TTCAGTACCATTTATCCATTTCC all participants. A-3′). 100 ng peripheral blood RNA from individuals of known genotype, was reverse transcribed using SNPgenotyping SuperScript®III First-Strand Synthesis System following PCRprimersweredesignedtotheareasurroundingtheSNP. the protocol as recommended by the manufacturer The primer sequences were as follows: GSDMB forward (5′- (Invitrogen by Life Technologies, Foster City, USA). GGTGCGTCTTACCACATCCT-3′), GSDMB reverse (5′-G The cDNA was then amplified by PCR using MegaMix GGACTGGAGAAAGGGAACT-3′); TSFM forward (5′-GG Royal (Cambio, Cambridge, UK) under the following CGAAACCCCATCTCTACT-3′), TSFM reverse (5′- CCCC conditions: 95°C for 5 min; followed by 30 cycles of: CACACTGTCTGACTTT-3′);GCKRforward(5′-CCCTCC 95°C for 30 s, 60°C for 1 min, 72°C for 1 min; followed CCTTCTCCTAGACA-3′), GCKR reverse (5′- GCTGATG by 72°C for 10 min, and the products were separated ATGGAGGGAAAGA-3′); DLD forward (5′- CCTGAAAT on a 2% agarose gel. Novel bands were identified, iso- AGATTTCCCTGACA-3′),DLDreverse(5′-GCCATCAGC lated and amplified using the respective PCR primers TTTCGTAGCAG-3′); FGFR1OP forward (5′- GAAGGTT and conditions already described. The amplification TTTGAGGGGGTAAA-3′),FGFR1OPreverse(5′-TTTCCC products were then sequenced to confirm identity and TCTGGTGACTTTGG-3′); STAT2 forward (5′- CACAGA characterise any unusual products. CTCTGGTGGAGCAA-3′), STAT2 reverse (5′- TGCAGTT CCTCTGTCACACC-3′);ATXN2Lforward(5′-TGGCCAG Real-timePCRtoquantifyrelativeexpressionofisoforms AAGAAGGGATAGA-3′), ATXN2L reverse (5′-AGATTCT bygenotype GCTGTGGCTGTCC-3′); CLEC2D forward (5′-GGTGCCA Real-time PCR primers were designed to the reference CTTAAAAAGTTATTGG-3′), CLEC2D reverse (5′- AGTG sequence (wild-type; WT) and any novel (novel; NV) TGTGGAATGGTTGCTG-3′). 50 ng DNA from the transcripts. Where alternatively expressed isoforms were peripheral blood of healthy controls was amplified by present in the region of interest, inventoried Taqman PCR using MegaMix Royal (Cambio, Cambridge, UK) Assays were purchased (Life Technologies, Foster City, under the following conditions: 95°C for 5 min; USA), information for which is shown in Additional file followed by 40 cycles of: 95°C for 30s, 60°C for 1 min, 2. Assays for total expression of all wild-type transcripts 72°Cfor 1min; followed by 72°C for 10min.PCRprod- as well as the novel transcripts were also purchased. Pri- ucts were then sequenced to confirm genotype. Se- mer and probe information for Custom Taqman Assays quence analysis was carried out using the Mutation are given in Additional file 5, and their relative positions Surveyor software package (SoftGenetics, Pennsylvania, are indicated in Figures 2 and 3. RNA was reverse tran- USA). scribed as described previously, and real-time quantita- tive PCR was performed using the ABI Prism 7900HT RT-PCRandbandisolationtoidentifynovelsplice platform. RNA from 5–10 individuals of each genotype products was amplified by this method (10X heterozygotes, 10X PCRprimersweredesignedtoatleast2exonseithersideof homozygotes for the major allele, 5-10X homozygotes the SNP of interest. The primer sequences were as follows: for the minor allele). Results were analysed using the

See more

The list of books you might like