Logout succeed
Logout succeed. See you again!

Pilostyles coccoidea (Apodanthaceae), a new species from Western Australia described from morphological and molecular evidence PDF
Preview Pilostyles coccoidea (Apodanthaceae), a new species from Western Australia described from morphological and molecular evidence
Nuytsia 18: 273-284 (2008) 273 Pilostyles coccoidea (Apodanthaceae), a new species from Western Australia described from morphological and molecular evidence Kevin R. Thiele!, Stephen J. Wylie9, Linda Maccarone9, Penelope Hollick? and Jennifer A.M cComb? 'Western Australian Herbarium, Department of Environment and Conservation, Locked Bag 104, Bentley Delivery Centre, Western Australia 6983 2Murdoch University, South Street, Murdoch, Western Australia 6150 8Corresponding author Abstract Thiele, K.R., Wylie, S.J., Maccarone, L., Hollick, P. & McComb, J.A. Pilostyles coccoidea (Apodanthaceae), a new species from Western Australia described from morphological and molecular evidence. Nuytsia 18: 273-284 (2008). Pilostyles coccoidea K.R.Thiele, a new species of holoparasitic flowering plant found on the legume genus Jacksonia R.Br. ex Sm., is described and illustrated. The new species is related to P. collina Dell and P. hamiltonii C.A.Gardner, both also from south-western Western Australia but growing on different hosts. The three species differ in morphological features of flowers and fruits. In addition, analysis ofnad/, 16S and matR gene sequences confirms the distinctness of P. coccoidea from P. hamiltonii. Pilostyles coccoidea appears to be a relatively common species within its restricted range of distribution between Eneabba and the Moore River, north of Perth. Introduction Pilostyles Guill. is a genus of c. 18 species of holoparasitic flowering plants found in tropical to temperate, arid to semi-arid regions of North and South America, the Middle East and south-western Australia. Previously included in the Rafflesiaceae, recent molecular studies (Barkman ef al. 2004; Nickrent ef al. 2004) have indicated that Pilostyles and related genera are not closely related to Rafflesia, resulting in the segregation of the small family Apodanthaceae Tiegh. ex Takht. for the genera Pilostyles, Apodanthes Poit. (seven species, tropical South America) and Berlinianche Harms| de Vattimo (two species, tropical East Africa). Berlinianche is very similar to Pilostyles (Bouman & Meijer 1994) and should probably be included within it (Nickrent 2006). Allspecies of Apodanthaceae are achlorophyllous, comprising a filamentous mesh-like, endophyte which usually grows isophasically within stems oft he host. Flowers are unisexual and develop from primordia formed endogenously within the host cortex just beneath the bark, emerging by rupturing through the stem surface. The flowers comprise one to several series of scale-like bracts and a series of bract-like tepals surrounding a large, central, column-like synandrium (in male flowers) or gynoecium (in female flowers) (Dell ef a/. 1982; Blarer et al. 2004). 274 Nuytsia Vol. 18 (2008) Pilostyles and Berlinianche species parasitise several genera of legumes, while Apodanthes is found on a wider range of host families including Salicaceae, Burseraceae and Meliaceae (Blarer et al. 2004). Pilostyles hamiltonii C.A.Gardner was described from Western Australia (Gardner 1948) from material collected on Daviesia Sm. at Mundaring. Subsequent collections recorded Pilostyles on Jacksonia R.Br. ex Sm. in the northern sandplains district between the Moore River and Eneabba, and on several Gastrolobium' R.Br. species from the Stirling Ranges (Kenneally & Pirkopf 1979) and on Peak Charles and Peak Eleanora in southern south-west Western Australia. Dell and Burbidge (1981), in a survey of patterns of sexuality of Pilostyles flowers growing on different hosts, noted that mixed male and female Pilostyles flowers occurred on all stems on Jacksonia and Gastrolobium hosts, while on Daviesia most plants carried only male or female flowers. They concluded from this that the Pilostyles individuals on Jacksonia and Gastrolobium are monoecious, while on Daviesia they are dioecious. Occasional Daviesia individuals were found in which some stems bore male flowers while other stems bore female flowers, suggesting that the host individuals were probably infected by several Pilostyles individuals of differing sexes. In addition to the difference in sexuality, Dell and Burbidge (1981) noted that Pi/ostyles flowers on different hosts differed in colour, being dark burgundy on Daviesia, pink and orange on Gastrolobium and orange on Jacksonia. They suggested that the three hosts may bear three distinct species of Pilostyles; Dell (1983) subsequently erected P. collina Dell for the southern, monoecious, pink-and- orange-flowered plants growing on Gastrolobium. Field assessmenatnd morphological and molecular analysis of the northern populations of Pilostyles on Jacksonia has confirmed that they too comprise a distinct species, which is morphologically and genetically distinct from P. hamiltonii on Daviesia and morphologically distinct from P. collina on Gastrolobium. Accordingly, the new species Pilostyles coccoidea K.R. Thiele is here described for these populations. Materials and Methods Fresh, dried and ethanol-preserved samples of Pilostyles flowers were used for morphological comparisons. Fresh or ethanol-preserved fruits and flowers of Pilostyles and fresh tip leaves of the hosts Daviesia angulata and Jacksonia floribunda and of Lupinus angustifolius cv. 8Wonga9 were used for the DNA extractions (Appendix 1). The host legume samples were collected from plants within infected populations but that appeared to be uninfected with the parasite. These samples, and the Lupinus sample, were used to detect possible contamination of parasite DNA with host DNA. Samples of Pilostyles coccoidea were collected from throughout its known range. Pilostyles hamiltonii samples were collected from both the northern (Cataby-Badgingarra) and central (Darling Range) parts of its distribution; populations in the southern part of the range near Bunbury were not sampled. Some sampled plants of P. coccoidea and P. hamiltonii in the Cataby area were less than 100 m apart. ' Oxylobium atropurpureum Turcz. and O. linearifolium C.A.Gardner (= O. linariifolium (G.Don) Domin), recorded as hosts for Pilostyles in the southern part ofit s range by e.g. Dell & Burbidge (1981), are now included in Gastrolobium, as G. leakeanum J.Drumm. and G. ebracteolatum G.Chandler & Crisp respectively. K.R. Thiele et al., Pilostyles coccoidea (Apodanthaceae), a new species 275 Pilostyles collina appears to be rare and occurs in localized populations in widely scattered locations. Recent extensive searches at known locations (Bluff Knoll, Peak Charles and Hyden) failed to locate plants. Attempts to extract DNA from herbarium samples held at PERTH failed, with the exception of a single specimen from the Hyden area (4.S. George 16442) which yielded intact DNA for analysis. DNA extraction, PCR and sequence analysis. Samples for DNA analysis (100 mg) were frozen in liquid nitrogen, ground to a fine powder and extracted with a DNeasy Plant Miniprep kit (Qiagen). Amplification by polymerase chain reaction (PCR) of DNA sequences comprising the nad/ (exons 2 and 3 of the mitochondrial NADH dehydrogenase gene), matR (mitochondrial maturase R), and 16S (small subunit of the plastid ribosomal RNA) gene regions were done with a 1:1 mixture of Zag and Pfu DNA polymerases (Promega) using the reaction buffer supplied with the Pfu polymerase. Pfi polymerase has 39-59 exonuclease (proof-reading) activity and was used to reduce DNAp olymerase-induced nucleotide misincorporations. PCR cycle conditions were as follows: 5 min at 94°C (denaturation) followed by 30 cycles of 94°C for 10s, 55°C for 30s, and 72°C for | min. Amplifications used the following primers: 16S 8for (59°-GGAGAGTTCCTGGCTCAG9-)a3n d /46/ rev(59-GGTGATCCAGCCGCACCTTCCAG-39) (Nickrent et al. 1997); matRfor (5 >_GTTTTCACACCATCGACCGACATCG-39) and matRrev (5°-GTTTTCACACCATCGACCGACATCG-39) (Nickrent & Starr | 994); and nadIb 5°-GCATTACGATCTGCAGCTCA-39) and nadIc (59-GGAGCTCGATTAGTTTCTGC -39) (Demesure et al. 1995). Both strands of PCR products were sequenced either (i) directly after purification by ethanol precipitation with the primers used in their amplification or (1i) after first cloning into the PCR® Blunt-Topo® (Invitrogen) vector, then using primers M/3F (59°-TCCCAGTCACGACGTCGT-39) and MI3R (59-GGAAACAGCTATGACCATG-39). Internal primers used to determine the full sequence of 16S were 660f (59-TATACTGACGTTGAGGGACG-39) and 990rev (59-CCTAACACTTCACTGCACGAACTG-39), and for matR matR703for (5°-AAGTGTTAATAACAATTTAGC-39) and matR78Irev (5?- CGGTGCTTTACCCGTAGACG -3°). Automated sequencing was performed with an Applied Biosystems Industries (ABI)/Hitachi 3730 DNA Analyzer using BigDye Terminator V3.1 chemistry (ABI). Sequences were submitted to GenBank and assigned accession numbers (Appendix 1). Additional sequences were obtained from Genbank for Pilostyles thurberi (16S, matkR), Apodanthes casearieae (matR), Glycine max (nad1) and Pisum sativum (16S, matR) for comparative purposes (Appendix 1). Genetic diversity of sequences was deduced from nucleotide sequence alignments using ClustalW (Thompson et al. 1994) under default parameters and checked manually. Measures of genetic distance were computed using the Maximum Composite Likelihood model within MEGA4 (Tamura et al. 2007). Phylogenies were calculated using four different methods: Neighbor-joining (NJ), Minimum Evolution (ME), Unweighted Pair Group Method with Arithmetic mean (UPGMA), and Maximum Parsimony (MP). With all methods used, evaluation of statistical confidence for nucleotide and amino acid sequence groups was by the bootstrap test (1000 replicates). Results Morphologically, Pilostyles coccoidea differs from P. hamiltonii, in which it has been previously included, in host range, sexuality, flowering position, bract number, flower size and colour, and berry shape, and from P. collina in distribution, host range, flower colour and size, and in the number of bracts subtending the flowers (Table 1; Figure 1). Nuytsia Vol. 18 (2008) Table 1. Key differences between the three Western Australian species of Pilostyles P. hamiltonii P. coccoidea P. collina' Distribution Eneabba to Bunbury Eneabba to Moore Stirling Ranges, Peak River Charles, Hyden Host Daviesia Jacksonia Gastrolobium Sexuality Dioecious Monoecious Monoecious Flowering position Always on young Usually on old wood, On young stems on host (2-year old) stems occasionally also on young stems (3.5-)4.0-4.5 mm Flower length (2.04)2.8-3.9 mm 1.542.0 mm Flower diameter 3.2-3.6 mm 1.8-2.5 mm 2.0-2.4 mm Flower length/ 1.1-1.3 0.75-1.1 0.8-1.0 diameter Bracts 8412, in 2 whorls 8412, in 2 whorls 12-15, in 3 whorls Bract colour Dark burgundy Pale orange-brown Reddish-orange Column colour Pale cream Dull pinkish-orange Pink; ovary lemon yellow Berry Ovoid-turbinate Depressed-globular, Depressed-globular, to almost conical, exposed within the exposed within the bracts enclosed and hidden erect to spreading (colour unknown) by bracts and bracts and perianth, perianth to maturity, bright orange-red to dull reddish scarlet 8After Dell (1983) All four sequence analysis methods (NJ, ME, MP and UPGMA) generated congruent phylograms from the nucleotide sequences. Consensus Neighbor-joining trees for each gene region are shown in Figure 2. For the three gene regions analysed, there was clear evidence of genetic divergence between P. coccoidea and P. hamiltonii. No clear phylogeographic structuring was apparent within species, and closely sympatric populations of P. coccoidea and P. hamiltonii clustered separately. The average genetic distance was low within species (<0.003), and substantially higher between P. coccoidea and P. hamiltonii (nad1=0.070, 16S=0.177, matR=0.027 respectively; see Tables 2A4C). Only 16S was successfully sequenced from the DNAe xtracted from dried herbarium material of the Hyden population ofP . collina. This sequence grouped closely with samples ofP .h amiltonii (Figure 2B). K.R. Thiele et al., Pilostyles coccoidea (Apodanthaceae), a new species 277 Figure 1. Flowers and fruits of Pilostyles. A4C. P. hamiltonii; A, B 4 flowers in situ on host stem (K.R. Thiele 3188); C 4 fruits (K.R. Thiele 3245). D 4 F. P. coccoidea; D, E 4 flowers in situ on host stem (K.R. Thiele 3495); F 4 fruits (K.R. Thiele 3242). The nad/ sequences of both Pilostyles species were very unusual, differing widely from one another and from those of other plants (Table 2A, Figure 2C). Between them, the two species had eight insertions and deletions (indels) in the nad/ region sequenced, ranging from 1472 nucleotides in length. Five indels were present in all five P. hamiltonii plants tested and a further three indels were present in all four P. coccoidea plants. Compared to other plant-derived nad1 sequences on GenBank, there was high sequence similarity only to short regions of the 59 and 39 termini; overall similarity is estimated to be less than 50%. The 16S sequences were also very unusual (Table 2B, Figure 2B). The genetic distance between 16S sequences oft he two Australian Pilostyles species was high (0.177), and they showed little similarity to those of legumes and, surprisingly, to that of P. thurberi. The matR sequences of the Australian Pilostyles species were more similar to other plants (Table 2C, Figure 2C). As expected, they were closer to P. thurberi and A. caseariae than to host matR sequences. Host and parasite sequences were clearly differentiated. Genetic distances in the matR sequences between the Australian Pilostyles and the legume host (where available) were substantial (0.18540.190). Pilostyles 16S and nad1 sequences showed much lower similarity with host homologues; the genetic distances shown (Figures 2B, 2C; Table 2B, 2C) are approximate because the sequences were so divergent that they were impossible to align with a high degree of confidence. 278 Nuytsia Vol. 18 (2008) Figure 2. Neighbour-joining phylograms based on gene sequences for (A) nad/;(B) 16S and (C) matk; phylograms are drawn to scale, with branch lengths proportional to evolutionary distances. Numbers at the branches are bootstrap values (1000 replications) above 50 percent. The evolutionary distance scale is in the units of the number of nucleotide substitutions per site 225 1-2 74)2-0 Pilostyles hamiltonii 4-0 5-0 Pilostyles coccoidea Jacksonia floribunda Glycine max Lupinus angustifolius 38L2-1 Pisum sativum 100 Daviesia angulata 0.05 K.R. Thiele ef al., Pilostyles coccoidea (Apodanthaceae), a new species 279 Pilostyles hamiltonii |Pi lostyles coccoidea Pilostyles thurberi Apodanthes casearieae Pisum sativum 100 Daviesia angulata 0.02 Discussion The low within-species and high between-species divergences of nucleotide sequences confirms the morphological distinctness of P. coccoidea and P. hamiltonii and supports their classification as distinct taxa. The existence ofe ight indels in the nad/ sequences ofP ilostyles suggests that the nad] gene may be non-functional, and therefore not constrained by natural selection, but this was not proven experimentally. Similarly, the wide divergence oft he 16S sequence indicates it may notb e functional. On the other hand, the matR sequences were similar to homologues from other species and, therefore, may be functional. MatR and other mitochondrial genes have been used previously to classify parasitic angiosperms, including Pilostyles (Barkman et al. 2004; Barkman et al. 2007; Nickrent et al. 2004). The relationship of Pilostyles collina to the other taxa is not clear. The single specimen that yielded DNA (A.S. George 16442) grouped within P. hamiltonii on the 16S analysis (Figure 2B). However, P. collina is morphologically more similar to P. coccoidea than it is to P.h amiltonii (Table 1), sharing relatively small flowers compared with P. hamiltonii and a berry that is exposed within the short bracts. Cross-contamination with a P. hamiltonii sample cannot be ruled out. Until new populations ofP . collina can be located and fresh material collected, its relationships to the other two species will remain uncertain. With the recognition of Pilostyles coccoidea, each of the three species of Pilostyles in Western Australia is considered to be restricted to a single host genus, but to occur on several species within its host genus. In general, host specificity in Pi/ostyles is relatively high, with the entire genus restricted to legume hosts (Nickrent 2006). Some species occur on several host genera (e.g. P. thurberi Gray on Dalea formosa Torr. and Psorothamnus emoryi (Gray) Rydb.). Factors controlling host range in Apodanthaceae are unknown. 280 Nuytsia Vol. 18 (2008) Table 2. Mean nucleotide sequence diversity between and within species A. nad1 sequences (eeeee eee eeee Group P.coccoidea P-hamiltonii J. floribunda9 G. max _L. angustifolius P. coccoidea 0.0008 0.070 0.551 0.561° 0.555° P. hamiltonii 0.004 0.573° 0.584? 0.578° J. floribunda - 0.016 0.002 G. max - 0.018 L. angustifolius ° B. 16S sequences Group P. coccoidea P. hamiltonii P.thurberi 4__D. angulata P. sativum P. coccoidea 0.002 0.177 0.601° 0.567° 0.539" P. hamiltonii 0.002 0.608° 0.560° 0.554° P. thurberi - 0.701° 0.696° D. angulata = 0.027 P. sativum % C. matR sequences {pitt emia in Ee i Group P.coccoidea P-hamiltonii P.thurberi A. casearieae-D. angulata _P . sativum P. coccoidea 0.003 0.027 0.080 0.125 0.185 0.184 P. hamiltonii 0.001 0.091 0.135 0.191 0.189 P. thurberi - 0.152 0.208 0.208 A, casearieae - 0.195 0.199 D. angulata - 0.019 P. sativum - * Genetic distance (number of base substitutions per site as calculated by pairwise analysis). > Figure given for genetic distance is an approximate value because sequences are highly divergent. Inter-group mean sequence diversity is indicated in plain text. Intra-group mean sequence diversity is indicated in italics. Early observers (e.g. Smith 1951) expected Pilostyles hamiltonii to be very widespread in south- western Western Australia, perhaps extending to the eastern States, on the basis of the wide distribution of the host genus and species. Dell & Burbidge (1981), however, with a more extensive knowledge of its distribution, noted the paradox that the parasite has a substantially more restricted distribution than its hosts. This is true both taxonomically and geographically: both Daviesia and Jacksonia contain many species not parasitised, and most individual species of host have a wider geographic distribution than the parasite. In particular, P. hamiltonii is widespread on Daviesia hosts on lateritic soils of the Darling Range but is absent from the same host species on sandy soils of the adjacent Swan Coastal Plain. Similarly, P.c occoidea is common on Jacksonia floribunda on the Eneabba Sandplains south to the Moore River, but the host species extends considerably further south to near Perth. K.R. Thiele et al., Pilostyles coccoidea (Apodanthaceae), a new species 281 Taxonomy Pilostyles coccoidea K.R.Thiele, sp. nov. A Pilostyles hamiltoniifloribus parvioribus, bracteis et columna pallida, aurantiaco-brunnea; baccis depresso ovoideis, rubro-aurantiacis, ad maturitatem expositis per bracteas effusas differt. Typus: Waddi Road, 0.7 km from the Brand Highway, Western Australia, 30° 33' 26" S, 115° 28' 10" E, 7 March 2008, K.R. Thiele 3495 (holo: PERTH 07692447; iso: CANB, K, MEL, MO, NSW). Pilostyles sp. Northern Sandplains (P. Armstronsg. n.P ERTH 06590179), Western Australian Herbarium, in FloraBase, http://florabase.dec.wa.gov.au [accessed 10 March 2008]. Monoecious, endophytic perennial, the vegetative thallus ramifying within the host tissue. F/owers emergent singly from host stems, (2.04)2.8-3.9 mm long, (1.8-)2.8-3.8 mm diam. (L/W 0.75-1.1) at anthesis, usually closely packed in groups and clusters, often aligned in fissures of bark, globose (although sometimes distorted from close packing). Bracts thick, fleshy, broad-based, imbricate, somewhat spreading at anthesis, 8-12 in two whorls of 4-6 each, 1.242.6 mm long, 1.0-2.2 mm wide, suborbicular to broadly ovate, the inner whorl longer and narrower than the outer, pale orange-brown darkening and withering at the tips at anthesis. Perianth segments 445(48), similar to the bracts but with somewhat attenuate bases. Disc and column dull pinkish-orange, epigynous. Male flowers with central column (synandrium plus sterile gynoecium) shorter than the perianth, slightly inflated and dome-shaped at the apex, bearing a marginal ring of embedded anther-sacs below a ring of short papillae. Female flowers with an inferior to half-inferior, unilocular ovary and a short, thickened, column-like style expanded at the apex with a marginal, papillate stigmatic area and terminal depression; ovules many, on 4 parietal placentas. Fruit a depressed-globular, scarlet to orange-red berry surmounted by the prominent, darkened remnants of the stigma, 2.5-3.5(-4) mm diam.; bracts and perianth in fruit erect to spreading, exposing the berry; seeds c. 0.4 mm long, + globular to broadly ellipsoid, Corrugate. (Figure 1D-F) Specimens examined. WESTERN AUSTRALIA: 16 km N of Badgingarra on Brand Highway, 18 May 1995, P. Armstrong s.n. (PERTH 06590179); 13.6 km N of Cataby on the Brand Highway, 9 June 1977, 4.H. Burbidge s.n. (PERTH 01883151); entrance to Allied Eneabba, Brand Highway, Eneabba, 26 Aug. 1976, B. Dell 7687a (PERTH); | km S of Strathmore Road, on a track 1-2 km W of Brand Highway, 27 Aug. 1977, B. Dell & A. Burbidge s.n. (PERTH 03277658); Moore River National Park, 0.6 km at 180 degrees from junction of Red Gully Road and Brand Highway, NW of Gingin, 26 June 1988, E.A. Griffin 4775 (PERTH); Brand Highway 22.3 km N of southern roadhouse at Cataby, 20 Mar. 2007, K.R. Thiele 3197 (PERTH); Brand Highway 0.6 km N of the turnoff to Cooljarloo Mine, N of Cataby, 12 June 2007, K.R. Thiele 3242 (PERTH); Brand Highway at Badgingarra, c. 0.1 km N of the turnoff into the town, 12 June 2007, K.R. Thiele 3243 (PERTH); Brand Highway at southern turnoff to Iluka Resources Eneabba mine, S of Eneabba, 12 June 2007, K.R. Thiele 3246 (PERTH). Distribution. Pilostyles coccoidea is endemic to the northern wheatbelt region ofsouth-western Western Australia (Figure 3a). All known collections are from the immediate vicinity of the Brand Highway between the Moore River and Eneabba. It almost certainly occurs more widely in the region, but is probably poorly collected. Kenneally and Pirkopf (1979) cite an occurrence at Mt Lesueur, but there is no specimen at PERTH from this locality. 282 Nuytsia Vol. 18 (2008) e Jurien Bay x e \ Perth ge° e i 3 Norsemano In 200 Kilometres Figure 3. Distribution of Pilostyles species in south-west Western Australia. A4P. coccoidea; B4 P. hamiltonii; C 4 P. collina. Version 6.1 IBRA regions (Department oft he Environment, Water, Heritage and the Arts 2008) are indicated in grey. Pilostyles coccoidea is sympatric with P. hamiltonii (Figure 3B), probably throughout its range, wherever the two hosts co-occur. It is widely allopatric from P. collina (Figure 3C). Habitat. Pilostyles coccoidea has been found on two species of Jacksonia, J. floribunda Endl. and J. nutans Chappill, in low to tall, dense heath vegetation on sandy soil over laterite. Whereas P. hamiltonii and P. collina consistently flower on young (142-year old) stems of their hosts, P. coccoidea is usually found on much older wood, sometimes at the base of the plant where its flowers and fruits erupt from fissures in the bark of large, stout stems that are several years old. Flowers are sometimes virtually hidden beneath the papery outer bark layers on J. floribunda. Flowering and fruiting period. Both P. coccoidea and P. hamiltonii on the northern sandplains flower together in February and March. Fruits persist on the hosts until July or August. Conservation status. Pilostyles coccoidea appears to be relatively common within its range, and occurs in a number of National Parks and Nature Reserves in the region. Etymology. The epithet is derived from the Latin coccus (a berry) with the termination 4oides (like, similar), in reference to the remarkable superficial similarity of the fruiting plants to scale insects (Homoptera superfamily Coccoidea), particularly to species such as Saissetia oleae and Eriococcus coriaceus. Notes. Pilostyles coccoidea differs most prominently from P. hamiltonii in its smaller flowers which are dull orange (dark burgundy in P. hamiltonii) and in the berry which is depressed-globular, scarlet and exposed by the spreading bracts (turbinate, dull-coloured and hidden by the erect bracts in P. hamiltonii). \t differs from P. collina in its flower colour (reddish-orange, pink and lemon yellow in P. collina; fide Dell 1981), northern distribution, and fewer bracts.