Logout succeed
Logout succeed. See you again!

Proteomic analysis of protein palmitoylation in adipocytes. PDF
Preview Proteomic analysis of protein palmitoylation in adipocytes.
RESEARCHPAPER Adipocyte2:1,17–27;January/February/March2013;G2013LandesBioscience Proteomic analysis of protein palmitoylation in adipocytes Wenying Ren,1 Ulupi S. Jhala2 and Keyong Du1,* 1MolecularOncologyResearchInstitute;TuftsMedicalCenter;Boston,MAUSA;2PediatricDiabetesResearchCenter;UniversityofCaliforniaSanDiego;LaJolla,CAUSA Keywords: palmitoylation, adipocyte, insulin, Glut4, JAK, STAT Abbreviations: TPC, thiopropyl captivation; AS160, Akt substrate 160 kD; STAT, signal transducers and activators of transcription; IRAP, insulin responsive amino peptidase; SHP2, SH2-containing phosphatase 2; Munc18c, mammalian homolog of unc-18; PM, plasma membranes; LDM, low density microsome(s); SNAP23, soluble NSF attachment protein 23 kD; NCAM, neural cell adhesion molecule/CD56; PI4K, phosphotidylinositol 4-kinases II; KIF5B, kinesin family member 5B Proteinpalmitoylation,bymodulatingthedynamicinteractionbetweenproteinandcellularmembrane,isinvolvedina wide range of biological processes, including protein trafficking, sorting, sub-membrane partitioning, protein-protein interactionandcellsignaling.Toexploretheroleofproteinpalmitoylationinadipocytes,wehaveperformedproteomic analysis of palmitoylated proteins in adipose tissue and 3T3-L1 adipocytes and identified more than 800 putative palmitoylated proteins. These include various transporters, enzymes required for lipid and glucose metabolism, regulatorsofproteintraffickingandsignalingmolecules.Ofnote,keyproteinsinvolvedinmembranetranslocationofthe glucose-transporter Glut4 including IRAP, Munc18c, AS160 and Glut4, and signaling proteins in the JAK-STAT pathway including JAK1 and 2, STAT1, 3 and 5A and SHP2 in JAK-STAT, were palmitoylated in cultured adipocytes and primary adipose tissue. Further characterization showed that palmitoylation of Glut4 and IRAP was altered in obesity, and palmitoylationofJAK1playedaregulatoryroleinJAK1intracellularlocalization.Overall,ourstudiesprovideevidenceto suggestanovel and potentiallyregulatory role forprotein palmitoylation inadipocyte function. Introduction Adipose tissue is an energy reservoir and an active endocrine organ. As an energy reservoir, adipose tissue actively transports Protein S-acylation is a post-translational lipid modification glucose and fatty acids from blood for storage as lipids. Glucose through which a fatty acid moiety is attached onto the cysteine transport into the adipocyte is mediated by insulin-responsive residues.1 Since protein-S-acylation is almost exclusively through Glut4 membrane translocation and is essential for the regulation theattachmentofpalmiticacid,a16-carbonsaturatedfattyacidto of blood glucose levels.7 Both clinical and animal model studies the cysteine residues, protein S-acylation is generally referred as have demonstrated that impaired Glut4 membrane translocation protein S-palmitoylation, or simply palmitoylation. Lipid modi- represents a primary defect of insulin action in type II diabetic fication equips the protein with a strong hydrophobic moiety individuals.8 As an endocrine organ, adipose tissues secrete many servingasananchortofacilitateinteractionofthemodifiedprotein different adipokines,9 which modulate peripheral insulin sensitiv- withcellularmembranes.2,3Ineukaryotes,theinteractionbetween ity.10,11 Adipose tissue also includes other cell types including protein and membrane is directly involved in protein trafficking, preadipocytes, immune infiltrating cells and endothelial cells. sorting, subcellular domain partitioning, protein-protein inter- Adipokines,suchasleptin,andotherparacrinesecretoryproducts, action and cell signaling. Thus, by modulating the interaction including IL-6, LIF, IFN-c and PRL, actively contribute to the between protein and membrane, lipid modification of proteins is functionality of adipocytes, mainly by activating the JAK-STAT likelytoplayaroleincellularfunction.Threetypesofproteinlipid pathway, to mediate downstream effects via STA1, STAT3 or modification exist in eukaryotes including myristoylation, iso- STAT5 (for a review, see ref. 12). penylation/farnesylationandpalmitoylation.4Amongthese,palmi- Glut4 membrane translocation, adipokine signaling and lipid toylationisthemostcommonandtheonlyonethatisreversible.5 production in adipocytes all require protein trafficking and Correspondingly, protein palmitoylation is considered as the sorting,leadingustohypothesizethatproteinpalmitoylationmay prevalentlipidmodificationthatcanmediateadynamicinteraction playanessentialroleintheseprocesses.Atpresent,theknowledge between protein and cellular membrane and, thereby, subcellular regarding protein palmitoylation in adipocyte is very limited. To traffickingandcellsignaling(forareview,seeref.6). begin to explore the role of protein palmitoylation in adipocytes, *Correspondenceto:KeyongDu;Email:[email protected] Submitted:08/14/12;Revised:09/07/12;Accepted:09/07/12 http://dx.doi.org/10.4161/adip.22117 www.landesbioscience.com Adipocyte 17 we have performed a proteomic analysis of adipocyte S-acylated 535.14 Palmitoylation-defective ClipR-59 cysteine-alanine proteins in adipose tissue and 3T3-L1 adipocytes and isolated mutant (C2A2-ClipR-59) of CLIPR-59 was used as a negative more than 800 putative palmitoylated proteins. Overall, our control. As shown in Figure1B, wild-type was captured by results argue that protein palmitoylation is involved in a wide thiopropyl beads while C2A2-ClipR-59 mutant was not. Failure range of adipocyte activities, including Glut4 membrane to capture C2A2-ClipR-59 was not because of the activity of trafficking and JAK-STAT signaling, which modulates insulin Thiopropyl beads as DHHC17, an endogenous palmitoylated signaling and adipocyte differentiation.12 protein was captured in the lysates from the cells expressing either wild-type (lane 2, panel 3) or palmitoylation defective Results (lane 4, panel 3) ClipR-59. Taken together, we conclude that TPC is a reliable assay for analyzing palmitoylated proteins. Thiopropyl captivation (TPC) of S-acylated protein assay. To Identification of palmitoylated proteins in adipocytes and analyze the palmitoylated proteins, we used the thiopropyl adiposetissue.AfterdemonstratingthatTPCassayisaneffective captivation (TPC) of S-acylated proteins derived from RAC methodtoisolatecellularpalmitoylatedproteins,wenextassessed assay.13 This protocol is outlined in Figure1A. Briefly, total cell thestatusofproteinpalmitoylationinadipose,brainandmuscle, lysates or cellular fractions were first incubated with methyl- respectively. Shown in Figure2A, each of these tissues showed methanethiosulfonate (MMTS) to block free cysteine residues. palmitoylation of multiple proteins. Protein palmitoylation was Next, the proteins were precipitated with acetone and resus- initially described in brain,15,16 which also showed the highest pended into a binding buffer supplemented with hydroxylamine abundance of palmitoylated proteins. Compared with muscle, andthiopropylsepharose.Inthisstep,Hydroxylaminehydrolyzes both brain and adipose tissue showed high palmitoylation of thioester bonds to free cysteine residues from acylation, which is proteins, perhaps a reflection of the high lipid content of both promptly captured by thiopropyl sepharose through formation of brain and adipose. Moreover, palmitoylation of a set of proteins a disulfide bond between newly freed cysteine residues and was specifically observed in adipose tissue (compare lanes 10 and thiopropyl group. Once the proteins were captured onto 12, the bars on the right highlight the adipose tissue-specific thiopropyl sepharose, the unbound proteins were removed and palmitoylated proteins). theboundproteinswerereleasedforfurtheranalysis(e.g.,western To examine the role of palmitoylation in adipocytes, we next blot or mass spectrometry). isolatedthetotalpalmitoylatedproteinsfromepididymalfatpads To assess whether TPC assay is suitable to analyze and 3T3-L1 adipocytes using the TPC assay. Isolated proteins palmitoylated proteins, we applied this assay to total lysates of were separated by SDS-PAGE and the different regions of gels HEK293 cells transiently transfected with FLAG-tagged wild- were excised for mass-spectrometric (MS) analysis based on the type ClipR-59, which has been shown to be modified by range of molecular weights (MW) (indicated in Fig.2B, lane 2). palmitoylation at two conserved cysteine residues at 534 and Following MS, putative palmitoylated proteins were identified Figure1.AthiopropylcaptureS-acylationproteinassay.(A)(1)Thecelllysates,orfactions,inablockingbufferareincubatedwithMMTS(0.1%)toblock freecysteineresiduesandprecipitatedwith70%acetone.(2–3)Theprecipitatedproteinsareresuspendedintoabindingbufferthatconsistsof hydroxylamine(HyA)orNaCl(servedasacontrol)andthiopropylsepharose6Mandincubatedfor2–4h(a10%ofreactionmixtureisremovedasthe inputatthisstep).(4)Thebeadsarewashedtoremoveno-bindingproteins.(5)ThebeadsaretreatedwithDTTtoreleasetheproteinfromthiopropyl sepharose6M.(6)Thepurifiedproteinsarereadyforfurtheranalysis,i.e.,westernblot,proteosomics.SH,freecysteine;Pal-S,palmitoylatedcysteine residue;S6B,Sepharose6B.(B)AnalysisofpalmitoylationofClipR-59andDHHC17,respectivelywiththetotalcelllysatesfromHEK293cellslysates expressingFlag-tagged,wild-typeandpalmitoylation-defectiveC2A2ClipR-59,respectively.HyA,hydroxylamine;–,treatedwithNaCl;+,treatedwith hydroxylamine. 18 Adipocyte Volume2Issue1 Figure2.Analyzingpalmitoylatedproteinsfromadipocytesandadiposetissue.(A)Palmitoylatedproteinsfrommouseepididymalfatpad,brainand muscles.ThetotalmembraneproteinswereextractedfromindicatedtissuesandsubjectedtoTCAassay.TheisolatedproteinswereseparatedonSDS PAGEandstainedwithCoomassieBlue.Alloftissuesarefrom2-month-oldmice.HA,hydroxylamine;Pal-proteins,palmitoylatedprotein.Br,brain;Ms, skeletalmuscle;Ad,adiposetissue;Pal-protein,potentialpalmitoylatedproteins.(B)ThiopropylCaptivationassayofepididymalfatpad(ad)and3T3-L1 adipocytes(3T3).(C)Thedistributionofisolatedpalmitoylatedproteinsidentifiedbymassspectrometryfromadipocytesand3T3-L1adipocytes. based on three criteria: (1) at least three unique peptides of the 6 and 7, further indicating the effectiveness of TPC assay MS spectrum match the protein, (2) the identified protein falls employed to isolate palmitoylated proteins. within the correct MW range and (3) MS spectra identify the The identified palmitoylated proteins are functionally highly protein from both adipose tissue and 3T3-L1 adipocytes. Based diverse. Based on their established functions, about one-third are on these criteria, a total of 856 putative palmitoylated proteins the metabolic enzymes of lipid metabolism and energy produc- were identified (Table S1). These include many known tion; one-third are the factors that are involved in protein palmitoylated proteins including Flotillin,17 huntingtin,18 Ras,19 metabolism including protein translation and degradation, about G-proteins,20-22 SNAP23,23 CD151,24 CD35,25 NCAM,26 sorti- 15%arethecytoskeletal,andmembraneproteinsandaboutone- lin,27PI4KIIa,28Tubulin29andmembranepalmitoylatedproteins tenth are the proteins involved in protein trafficking, including www.landesbioscience.com Adipocyte 19 Figure3.ThepalmitoylatedproteinsinGlut4membranetranslocation.(A)AsubsetofproteinsinGlut4membranetranslocationidentifiedbyThiopropyl capture(TPC)assayandmassspectrometry(MS)inepididymalfatpadand3T3-L1adipocytes.Thenumberofpeptidesandtheircorresponding sequencesfromMSwereshown.(B)WesternblotanalysisofTPCassayofepididymalfatpad,3T3-L1adipocyteswithanti-Glut4(1)andanti-AS160 antibodies(3).Theinputlevelsofeachproteinisshowninpanels2and4.(C)WesternblotanalysisofTPCassayofepididymalfatpad,3T3-L1 adipocytes,HEK293cellsandFaocellswithanti-IRAP(1)andanti-Munc18cantibodies(3).Theinputlevelsofeachproteinareshowninpanels2and4, withindicatedantibodies. Rab GTPase, various transporter and vesicle trafficking factors membrane translocation is presented in Figure3A. Among these (Fig.2C; Table S1). Taken together, these data imply that proteins, SNAP23,23 sortilin,27 PI4KIIa28 and Flotillin17 are protein palmitoylation is involved in a wide range of adipocyte known to be palmitoylated whereas, Glut4, IRAP, Munc18c, functions. AS160, RAB14, KIF5B and Myo1c are novel targets for Palmitoylated proteins in Glut4 vesicle trafficking. A list of palmitoylation(for areviewaboutthefunctions ofthese proteins palmitoylated proteins that have established roles in Glut4 in Glut4 membrane trafficking, see refs. 30 and 31). Because 20 Adipocyte Volume2Issue1 Glut4isthecenterofinsulin-dependentGlut4vesiclemembrane Ras32andSTK1633areknowntobepalmitoylated.Sincenoneof trafficking and IRAP, Munc18c and AS160 play different these proteins are adipocyte-specific, we selectively assessed the regulatory roles in Glut4 membrane trafficking, we assessed their association of AMPKa and MAPK1 (p42ERK2) in membrane presenceinThiopropylbeadsusingwesternblots.Aspresentedin fraction using TPC assay. Shown in Figure5B, we observed that Figure3B and C, we observed that each of these proteins were AMPKa and both ERK1 and 2 were captured by thiopropyl associated with Thiopropyl beads following hydroxylamine beads under Hydroxylamine treatment. In agreement with these treatment,butnotundercontrol(NaCl)conditionsinadipocytes results, both AMPKa and ERK are metabolically labeled in cells and adipose tissue (top panels). These data suggest that IRAP, treated with 17-octadecynoic acid, strongly indicating that these Munc18c and AS160 are most likely palmitoylated in both proteins are palmitoylated. adipose tissue and 3T3-L1 adipocytes. Palmitoylation of AMPKa and MAPK1 suggests that both Glut4 is specifically expressed in adipocytes where Munc18c proteins would be associated with membranes. To examine this, andIRPAarewidelyexpressed.TodeterminewhetherMunc18C PM (plasma membrane) and LDM (low-density microsome) andIRAParealsopalmitoylatedinothercellortissuetypes,total fractionsisolatedfrom3T3-L1adipocytestreatedwithorwithout cellular lysatesfromHEK293cells, hepatomaFao cells andbrain insulin, were probed with anti-AMPKa and MAPK1-specific weresubjectedtoTPCandwesternblotassays.Weobservedthat antibodies by western blotting. Presented in Figure5C, both bothproteinswereassociatedwithThiopropylbeadsinHEK293 AMPK1a and ERK1/2 were found in PM and LDM, arguing cells, rat hepatoma Fao cells and brain, indicating that these that both proteins are associated with cellular membranes, which proteins are palmitoylated in a wide variety of cell types and is consistent with the potential palmitoylation of these proteins. tissues. Palmitoylation in JAK-STAT pathway. Activated by a variety Glut4andIRAParemajorcargoproteinsforGlut4vesicles.To of cytokines and hormones, the JAK-STAT pathway has been further validate that both proteins are palmitoylated, we next implicated in adipocyte differentiation, body energy metabolism performed 17-octadecynoic acid metabolic labeling and Click and the development of insulin resistance (for a review, see ref. Chemistry,anassaythatlabelscellularproteinsinHEK293Tcells 34). Mass-spectrometric analysis indicated the potential palmi- that transiently express either Flag-tagged Glut4 or HA-tagged toylation of four proteins of the JAK-STAT pathway including IRAP.Asacontrol,thecellswerelabeledinparallelwithpalmitic JAK1,STAT1,STAT3andSTAT5A(Fig.6A).JAKsareafamily acid. Shown in Figure4A, both Flag-tagged Glut4 (panel 1) and oftyrosine kinasesincluding JAK1,JAK2,JAK3 andTyk2. Both HA-tagged IRAP (panel 3) were detected in 17-ODCA labeled JAK1 and JAK2 are expressed in adipocytes. Therefore, we first cells, but not in cells treated with palmitic acid (compare lanes 1 assessed the possibility that both JAK1 and JAK2 are palmitoy- and2,respectively),demonstratingthatbothGlut4andIRAPcan lated in adipocytes. Shown in Figure6B, both JAK1 and JAK2 be palmitoylated in vivo. were captured by thiopropyl beads under hydroxylamine Glut4 membrane translocation is essential for regulation of treatment (compare lanes 1 and 2 each top panel). In the same blood glucose level. Impaired Glut4 membrane translocation is experiments,wealsoexaminedtheassociationofSTAT1,STAT3 the primary cause of hyperglycemia, associated with obesity and and STAT5a with thiopropyl beads and found that each of the type II diabetes. We were interested in knowing the palmitoyla- threeSTATproteinswereassociatedwiththiopropylbeadsunder tion status of Glut4 and IRAP in adipose tissue in obesity. hydroxylamine treatment but not in control (NaCl) (Fig.6C, Towardthisgoal,thepalmitoylationstatusofGlut4andIRAPin compare lanes 1 and 2 each top panel). Thus, these data argue theadiposetissuefrom4-month-olddiet-inducedobesemicewas that both JAKs and STATs are potentially palmitoylated in examined.Shownin Figure4B,thepalmitoylationofbothGlut4 adipose cells. andIRAPwasincreased(panels1and3,comparelanes2and4). Based on the palmitoylation prediction program (www. Next, we examined the palmitoylation status of Glut4 and csspalm.biocuckoo.org), two cysteine residue positions, 541 and IRAP in 3T3-L1 adipocytes that were cultured either in low C542, in JAK1 that are predicted to be palmitoylated are glucose(2.5mM)orhighglucose(22.5mM)medium.Presented conserved through JAK family kinases (Fig.7A). To determine in 4C, the level of Glut4 and IRAP palmitoylation was elevated whetherCys541and542areindeedpalmitoylated,wesubstituted when 3T3-L1 adipocytes were cultured in high glucose medium these cysteine residues with serine in JAK1 (Cys541/542S JAK1) (compare lanes 2 and 4, panel 1 and 3, respectively). At present, and examined the palmitoylation status of Cys541/542 JAK1 the reasons and mechanisms resulting in glucose-dependent with TPC assay using transiently transfected HEK293T cells. As alteration of Glut4 and IRAP palmitoylation are not clear. seen in Figure7B, cysteine to serine substitutions in JAK1 Regardless, these results would argue that palmitoylation of these (C541/542S JAK1) were sufficient to completely abolish proteins might play a role in Glut4 membrane trafficking. palmitoylation of JAK1 (compare lanes 2 and 4, top panel), Palmitoylated proteins in signaling pathways. A partial list of clearly identifying cysteine residues at 541 and 542 in JAK1 are well-studied protein serine kinases and phosphatases that are palmitoylated. involved in cell signaling are presented in Figure5A. These JAKsaregenerallyboundtotheplasmamembrane.Theknown include Ser/Thr kinases AMPKa, integrin-linked kinase (ILK1), localizationofJAKs,alongwiththeknownroleofpalmitoylation MAPK1 (ERK2), mTOR, PKA (regulatory subunit), Rsk90 and in modulating protein-membrane interactions, prompted us to STK16, tyrosine kinases JAK1 and Yes1, protein phosphatases examine whether palmitoylation of Cys541/542 facilitates JAK1 SHP2, PP2A (regulatory subunits) and PP1B. Among them, membraneassociation.WhenexpressedinCOS-7cells,wild-type www.landesbioscience.com Adipocyte 21 Figure4.ThestatusofGlut4andIRAPpalmitoylationunderobesity.(A)MetaboliclabelingandClick-ChemistryanalysisHEK293Tcellsthattransiently transfectedwithindicatedexpressionvectors.Twenty-fourhourspost-transfection,thecellsweremetaboliclabeledwitheitherpalmiticacidor17-OCDA forovernight.ThetotalcelllysateswerepreparedforClickChemistryandwesternblotwithindicatedantibodies.(B)Theadiposetissuesfromnormalor obesitymice(8weekunderhigh-caloriediet)weresubjectedtoTPCassay.Theisolatedproteinswereanalyzedonwesternblotwithanti-Glut4(1)and anti-IRAP(3)antibodies,respectively.Theinputofeachproteinwaspresentedinpanels2and4.(C)TPCassayof3T3-L1adipocytesthatwereculturedin withlowglucose(2.5mM)orhighglucose(22.5mM)overnight.Panels1and3arepalmitoylatedGlut4andIRAP.Panels2and4arethe5%inputofeach protein. Figure5.Palmitoylatedproteinkinasesandphosphatasesinsignaltransductionpathway.(A)Asubsetofkinasesandphosphatasesidentifiedthrough Thiopropylcapture(TPC)assayandmassspectrometry(MS)inepididymalfatpadand3T3-L1adipocytes.Thenumberofpeptidesandtheir correspondingsequencesfromMSwereshown.(B)WesternblotanalysisofTPCassayofepididymalfatpad,3T3-L1adipocytes,HEK293cellsandFao cellswithantiAMPK1a(1)andanti-ERK(3).Theinputlevelofeachproteinisshowninpanels2and4,respectively.(C)WesternblotanalysisofAMPKa andMAPK1inadipocytesubcellularfractions.(1)AMPKaindifferentfractions,(2)phospho-ERKand(3)totalERKindifferentfractionsand(4)Glut4in differentfractions. 22 Adipocyte Volume2Issue1 Figure6.PalmitoylatedproteinsinJAK-STATpathway.(A)JAKandSTATidentifiedbyThiopropylcapture(TPC)assayandmassspectrometry(MS)in epididymalfatpadand3T3-L1adipocytes.ThenumberofpeptidesandtheircorrespondingsequencesfromMSwereshown.(B)Westernblotanalysisof TPCassayofepididymalfatpadand3T3-L1adipocyteswithindividualanti-JAKantibodies.(C)WesternblotanalysisofTPCassayofepididymalfatpad and3T3-L1adipocyteswithindividualanti-JAKantibodies. JAK1(Fig.7C)exhibitedclearmembraneassociation(toppanel), signaling and membrane trafficking. Our interest in the role of but substitution of cysteine residues in JAK1 (C541/542SJAK1) posttranslational modifications, and their regulatory role in markedly altered JAK1 membrane association (bottom panel). metabolic signaling, prompted us to inquire whether palmitoyla- Takenalltogether,thesedatasuggestthatpalmitoylationofJAK1 tion is a prominent modification of proteins expressed in modulates JAK1 membrane association. adipocytes. These cells were chosen because of their obvious role in lipid storage and glucose homeostasis. Discussion Toward this goal, we performed proteomic analysis of total palmitoylatedproteinsfrombothprimaryadiposetissueandfrom Protein palmitoylation has been implicated in a wide range of 3T3-L1 adipocytes. From these studies, we identified upwards of biological processes including protein trafficking, membrane 800 putativepalmitoylatedproteinsthatare expressed inprimary Figure7.CharacterizationofJAKpalmitoylation.(A)TheschematicpresentationofJAKpeptidethatcontainspalmitoylatedcysteineresidues.(B)TPC assayofFlag-tagged,wild-typeandpalmitoylationdefectiveJAK1(C541/542SJAK1)transientlyexpressedinHEK293cells.(1)PalmitoylatedJAK1;(2)the inputlevelofJAK1.(C)ImmunostainingofCOS-7cellstransienttransfectedwithFlag-tagged,wild-typeorC541/542SJAK1withanti-Flagantibody followingCy3conjugatedgoatanti-mouseIGantibodies.TheblueisthecellnucleistainedwithDAPI. www.landesbioscience.com Adipocyte 23 adipose tissue and cultured adipocytes. Among the palmitoylated Thus, it is plausible that palmitoylation of AMPK modulates proteins, we observed a high representation of various transpor- compartmentalization of AMPK signaling to differentially ters,regulatorsofvesiculartraffickingandsignalingmoleculesthat phosphorylate its substrates. likely participate in a wide array of cellular processes including Finally,wealsoexaminedpalmitoylationofJAK1kinaseandits signaling,membranetranslocation,cytoskeletonproteinnetwork, downstream effector STAT proteins. Based on their association transport, secretory function, lipid, protein and energy metabol- with thiopropyl beads, our results suggested palmitoylation of ism. Taken together, palmitoylation appears to be involved in a JAK1, JAK2, STAT1, STAT3 and STAT5. Furthermore, we wide array of adipocyte functions and significantly contribute mappedJAK1palmitoylationtoCys541and542,which,inturn, toward glucose disposal and insulin action. regulated the membrane localization of JAK1. Given that a large number of palmitoylated proteins were It is well-established that upon simulation, JAK1 kinase isolated from adipose tissue,we focused onadistinct set ofnovel undergoes autophosphorylation, which, in turn, recruits and palmitoylatedproteinsthatarerelatedtoglucosehomeostasisand phosphorylatesSTATproteinsthusenablingnucleartranslocation cell signaling. First, we verified that Glut4, IRAP, Munc18c and and transcriptional activation of STAT proteins. JAK kinase- AS160 were represented in spectra obtained from TPC isolated dependent phosphorylation of STAT proteins occurs on or palmitoylated proteins in both cultured adipocytes and adipose proximal membrane and positioning JAK and STAT at the tissue. We have also validated palmitoylation of both Glut4 and membrane is required for activation of JAK-STAT signal IRAPusing17-OCDAmetaboliclabelingandClickChemistryin transduction pathway.41 JAK is targeted to the cognate receptor adiposetissue.Moreimportantly,palmitoylationofbothproteins and plasma membrane via the FERM domain.41-44 JAK1 also was found to be elevated in obesity. Insulin-dependent Glut4 requires an additional perhaps the SH2 domain for membrane membrane translocation constitutes a central mechanism for recruitment. The localization of Cys541 and 542 to the SH2 glucose uptake and disposal in both muscle and adipose tissue. domain in JAK1 would suggest that palmitoylation of SH2-like Although Glut4 is the central player in the insulin-dependent domain may constitute the second JAK1 membrane targeting vesicularuptakeofglucoseacrosstheplasmamembrane,IRAPisa signal. Since both JAK and STAT have been shown to be major cargo protein in Glut4 containing insulin-responsive associatedmembranemicrodomains,45,46itishighlyprobablethat vesicles (GIRV). IRAP is not only involved in the sorting of palmitoylation of JAK and STAT may be instrumental for this GIRV, but also modulates GIRV trafficking.31 Munc18c is a targeting event. JAK-STAT signal pathway is involved in a wide membrane t-SNARE-associated protein and modulates GIRV range of biological processes. In adipocytes, this pathway membrane docking and fusion.35 AS160 is the major Akt modulates adipocyte differentiation and energy metabolism.34 substrate that modulates GIRV membrane docking.36,37 Taken together, palmitoylation of the three sets of proteins Identification of these proteins as palmitoylated proteins strongly discussed here, may regulate various aspects of adipocytebiology. suggests that protein palmitoylation plays an essential role for In this report, we mainly analyzed adipocyte protein insulin-dependent, Glut4-mediated vesicular uptake of glucose. palmitoylation in a qualitative way. It is noted that quantitative While the specific mechanisms that induce these changes remain analysis of protein palmitoylation can also be achieved in TPC unknown,importanceofproteinpalmitoylationishighlightedby assay.Thiopropylbeadscapturepalmitoylationproteinsquantita- its potential role in glucose transport and its modulation in tively via formation of disulfide cross-linkage. In addition, unlike adipose tissue of obese insulin-resistant mice. other modification studies, e.g, phosphorylation, the level of In addition to proteins required for glucose transport, we modifiedproteinandthatoftotalcellularproteinaredetermined assessed the palmitoylation of several kinases including, ERK1/2 with different reagents i.e., anti-phospho and anti-non-phospho and AMPKa. Cellular compartmentalization of ERK1/2 and antibodies, the level of palmitoylated protein and that of total other kinases is consistent with the palmitoylation of these cellularproteinaredeterminedwithsameantibodyinTPCassay. kinases.ForAMPK,palmitoyationmayhaveamorespecificand In this regard, it is possible to determine the relative level of defined role. AMPK is a heterotrimer that consists of three palmitoylated form by comparing the ratio of thiopropyl bead subunits: a, β and c, which are differentially distributed in captured protein and input. For example, in this report, we cellular compartments.38 Of the three subunits, AMPKβ is consistently found that the ratio of palmitoylated IRAP and total myristoylated, which, in turn, regulates membrane association cellularIRAPishigh,whereas,thatofMun18cislow(see Fig.4). and subsequent activation by upstream kinases.39 Thus, This will indicate that the cellular level of palmitoylated IRAP is myristoylation serves to prime the activation of AMPKβ. high, whereas, that of Munc18c is low. The reason for that is Palmitoylation of AMPKa implies that there are two distinct varied. But it could be that IRAP palmitoylation is more stable lipid modifications in AMPK complex. Therefore, it is tempting than that of Munc18c. Since palmitoylation is reversible, by to speculate that palmitoylation of a and myrystoylation of β which protein trafficking is regulated, the lower level of may together recruit AMPK to the plasma membrane. As an palmitoylation may reflect the notion that the modified protein energy sensor, AMPK modulates lipid metabolism. It is is constantly shuttling. noteworthy several AMPK substrates, including acetyl-CoA To date, proteomic analysis of total protein palmitoylation has carboxylase a (ACACA, ACC) and malonyl-CoA decarboxylase beenperformedinneurons,47Tcells,48platelets,49macrophages33 (MLYCD, MCD), are membrane-associated enzymes,40 and and prostate cancer cells.50 Upon comparing the palmitoylated activation of AMPK leads to AMPK intracellular partitioning.39 proteins isolated from adipocytes with those from other cells, we 24 Adipocyte Volume2Issue1 find that enzymes regulating lipid and energy metabolism are outlinedin Figure1A.Briefly,totalcellortissue homogenates in uniquetotheadipocyte,againunderscoringanimportant,though cell lysates buffer (10 mM HEPES, 10 mM NaCl, pH 7.6) were poorlyunderstood,roleforpalmitoylationinregulatingadipocyte spunat500gfor5mintoremovenuclei.Then,thesupernatants biology. A better understanding of palmitoylation in adipocyte were centrifuged at 175 kg for 60 min. The pellets (cell biology is likely to have long-ranging implications for developing membranes including plasma membrane, high-density micro- new strategies in the treatment of obesity and diabetes. somes and low-density microsome) were resuspended into blocking buffer (100 mM HEPES, 1 mM EDTA, 2.5% SDS) Materials and Methods supplemented with 0.1% MMTS and incubated at 42°C for 15 min. Then 2 vol of acetone was added into above reaction Reagents. Hydroxylamine HCl (159417), 3-isobutyl-1-methyl- mixture and incubated at −20°C for 20 min. After washed with xanthine (IBMX) (I5879), dexamethasone (D4902), methyl- 70% cold acetone, the pellet was resuspended into capturing methanethiosulfonate (MMTS) (64306), insulin (I6624), buffer (100 mM HEPES, 1 mM EDTA, 1.0% SDS). Then, palmitic acid (P0500), anti-Flag (F3165), anti-DHHC17 water-swollen thiopropyl sepharose 6B was added. Then, the (SAB2500508), HRP-conjugated anti-HA (H6533) and anti- sample was divided into two equal parts. To one part, munc18c (SAB1406498), anti-Glut4 antibodies (G4173), were hydroxylamine Cl (pH = 7.5) was added to a final concentration from Sigma. Biotin-Azide (B10184) was from Invitrogen. Anti- of 0.2 M. To the other part, an equal amount of NaCl (control) AS160antibody(ABS54)wasfromMillipore.Allcommonlyused was added. After 3 h incubation at room temperature, the beads chemicalswerefromThermoScientific.ThiopropylSepharose6B werewashedwithcapturingbuffer.Afterwashing,thebeadswere (17-0420-01)wasfromGEHealthcareLifeScience.Anti-AMPK, incubated with 50 mM DTT. Thirty minutes later, the beads anti-JAK (9945S), anti-STAT (9939S) and anti-Akt anti- werespunandsupernatantwassavedforSDS-PAGE(authorswill phospho-Akt antibodies (8200S) were from Cell Signaling. 17- provide more detailed protocol if requested). The mass octadecynoic acid (90270) is from Cayman. spectrometry wasperformed inHarvardTaplin MSCore facility. Plasmid construction. Mouse IRAP (MMM1013-9201983) 17-octadecynoicacidmetaboliclabelingandClickChemistry. and JAK1 (MMM1013-7513113) cDNA were purchased from The 17-ODCA metabolic labeling and Click Chemistry was Openbiosystems. Human Glut4 cDNA was the gift of Dr G.I. performed as described.47 Briefly, HEKT 3T3 cells were Bell of University of Iowa.51 To generate the tagged peptide, the transiently transfected with the expression vectors that express primerscorrespondingtoeachcDNAwereamplifiedbyPCRand the tagged target peptides (Flag-Glut4, and HA-IRAP in this cloned into pcDNA-Flag or pcDNA-HA expression vectors. The study). Twenty-four hours post-transfection, the cells were mutation of putative palmitoylation sites in JAK1 was generated metabolically labeled with 50 uM of 17-ODCA or palmitic acid through site-directed mutagenesis by PCR. The primers used are (servedasacontrol)forovernight.Then,thetotalcelllysateswere IRAP: forward: GGGGATCCATGGAGTCCTTTACC; reverse: preparedforClickChemistry.Afterthebiotinylatedproteinswere GGGAGCTCTACAGCCACTGGGAG. Glut4: forward: purified via streptavidin-agarose (20347, Thomas Scientific), the GGGAATTC ATGCCGTCGGGCTTCC; reverse: GGTCTA purifiedproteins were analyzed on western blotwith correspond- GATCAGTCGTTCTCATCTG. JAK1: forward: GGGAAT ing antibodies. TCATGCAGTATCTAAATAT; reverse: GGTCTAGATTAT Westernblot.Aftertheindicatedtreatmentsasdescribedinthe TTTAAAAGTGCTTC. For site-directed mutagenesis, the pri- figure legends, cells were washed twice with PBS and lysed with mers used are: forward: CTTTGTGCTGAAACGATCCTC cell lysis buffer (20 mM Tris pH 7.6, 150 mM NaCl, 0.5 mM TCAGCCTAAGCCTCGAG; reverse: CTCGAGGCTTAG EDTA,0.5mMDTT,10mM,1%TritonX-100or1%NP-40, GCTGAGAGGATCGTTTC AGCACAAAG. 10% glycerol, protease and phosphatase inhibitors). Equal Cell culture and transient transfection. HEK293 cells were amounts of protein (20–30 ug) were subjected to SDS-PAGE cultured in DMEM (11995073, Life Technologies) supplemen- electrophoresis and transferred to polyvinylidene fluoride mem- ted with 10% FBS (26140079, Life Technologies) and 1(cid:1) brane (Biorad). The membranes were incubated with each antibiotic-antimycotic (15240112, Life Technologies). 3T3-L1 primary antibody, followed by incubation with a horseradish preadipocytes (CL-183, ATCC) were cultured in DMEM peroxidase-conjugated secondary antibody (Biorad). The protein supplemented with 10% bovine serum and 1(cid:1) antibiotic- bands were visualized using the ECL detection system (Pierces). antimycotic. The differentiation of 3T3-L1 adipocytes has been Subcellular fractionation assay. 3T3-L1 adipocytes with or described. The transient transfections were performed with without insulin treatment were suspended into HES I buffer lipofectamine 2000 (11668019, Life Technologies) according to (0.25 M sucrose, 20 mm Tris pH 7.6, 1 mM EDTA, plus a manufacturer’s protocol. protease-inhibitormixture).Thecellswerehomogenizedbypassing Animals. The normal (380056) and obese (380050) C57B/6 a 23 gauge needle 10 times, and then the homogenates were mice were purchased from Jackson Laboratory. The obese mice centrifugedat19kgfor20min.Toisolatemembranefraction,the were fed a high calorie diet (60% kcal fat) for 8 weeks. The resultantpelletsfromthe19kgcentrifugationwerelayeredonHES detailed information about these mice can be found at www. IIbuffer(1.12Msucrose,20mMTris,pH7.6,1mMEDTA)and jaxmice.jax.org/diomice/index.html. centrifuged at 100 kg for 60 min. The resulted pellets were Isolation and characterization of palmitoylated proteins. The designated as nuclear and mitochondria fraction. The plasma procedure for isolation of total palmitoylated proteins were membrane layers were removed from the sucrose cushion and www.landesbioscience.com Adipocyte 25 suspendedintoHESIbufferandcentrifugedat41kgfor20min. Disclosure of Potential Conflicts ofInterest The resultant pellets were plasma membrane (PM). To isolate No potential conflicts of interest were disclosed. microsomes, the resultant supernatant from the 19 kg centrifu- gation was centrifuged at 175 kg for 75 min and the pellets were Acknowledgments collectedaslow-densitymicrosomes(LDM).Thesupernatantfrom The author is indebted to Dr G.I. Bell for the gift of human the175kgcentrifugationwassavedanddesignatedascytosol. Glut4 cDNA. This work was supported by NIH grant RO1 Cell imaging. Transfected COS-7 cells were fixed in 3.7% DK084319 and R56 DK084319 to K.D. K.D. was the recipient paraformaldehyde. The fixed cells were permeablized with 0.2% of The American Diabetes Association Career Development Triton X100 for 3 min. Then, the cells were incubated with Award. indicated antibodies in 3% BSA for 1–2 h followed by Cy3 conjugated goat-anti-mouse IgG antibodies. The cells were Supplemental Materials mounted on glass-cover slides. The fluorescence imaging was Supplemental materials may be found here: captured with confocal microscopy (Olympus). www.landesbioscience.com/journals/adipocyte/article/22117 References 13. ForresterMT,HessDT,ThompsonJW,HultmanR, 23. GreavesJ,GorlekuOA,SalaunC,ChamberlainLH. MoseleyMA,StamlerJS,etal.Site-specificanalysisof PalmitoylationoftheSNAP25proteinfamily:specifi- 1. Mumby SM. Reversible palmitoylation of signaling proteinS-acylationbyresin-assistedcapture.JLipidRes cityandregulationbyDHHCpalmitoyltransferases.J proteins.CurrOpinCellBiol1997;9:148-54;PMID: 2011; 52:393-8; PMID:21044946; http://dx.doi.org/ Biol Chem 2010; 285:24629-38; PMID:20519516; 9069258; http://dx.doi.org/10.1016/S0955-0674(97) 10.1194/jlr.D011106 http://dx.doi.org/10.1074/jbc.M110.119289 80056-7 14. Lallemand-Breitenbach V, Quesnoit M, Braun V, El 24. CharrinS,ManiéS,OualidM,BillardM,BoucheixC, 2. HuJS,JamesG,OlsonEN.Proteinfattyacylation:a MarjouA,PoüsC,GoudB,etal.CLIPR-59isalipid Rubinstein E. Differential stability of tetraspanin/ novel mechanism for association of proteins with raft-associated protein containing a cytoskeleton-asso- tetraspanin interactions: role of palmitoylation. FEBS membranes and its role in transmembrane regulatory ciated protein glycine-rich domain (CAP-Gly) that Lett 2002; 516:139-44; PMID:11959120; http://dx. pathways.Biofactors1988;1:219-26;PMID:3076775 perturbs microtubule dynamics. J Biol Chem 2004; doi.org/10.1016/S0014-5793(02)02522-X 3. ReshMD.Fattyacylationofproteins:newinsightsinto 279:41168-78;PMID:15262990;http://dx.doi.org/10. 25. JochenA,HaysJ.Purificationofthemajorsubstratefor membranetargetingofmyristoylatedandpalmitoylated 1074/jbc.M406482200 palmitoylationinratadipocytes:N-terminalhomology proteins. Biochim Biophys Acta 1999; 1451:1-16; 15. Folch J, Lees M. Proteolipides, a new type of tissue with CD36 and evidence for cell surface acylation. J PMID:10446384; http://dx.doi.org/10.1016/S0167- lipoproteins; their isolation from brain. J Biol Chem LipidRes1993;34:1783-92;PMID:7504047 4889(99)00075-0 1951;191:807-17;PMID:14861226 26. KleeneR,MzoughiM,JoshiG,KalusI,BormannU, 4. Aicart-Ramos C, Valero RA, Rodriguez-Crespo I. 16. DalvaMB.Neuronalactivitymovesproteinpalmitoy- Schulze C, et al. NCAM-induced neurite outgrowth Protein palmitoylation and subcellular trafficking. lation into the synapse. J Cell Biol 2009; 186:7-9; dependsonbindingofcalmodulintoNCAMandon Biochim Biophys Acta 2011; 1808:2981-94; PMID: PMID:19596846; http://dx.doi.org/10.1083/jcb. nuclear import of NCAM and fak fragments. J 21819967 200906101 Neurosci 2010; 30:10784-98; PMID:20702708; 5. IwanagaT,TsutsumiR,NoritakeJ,FukataY,Fukata 17. LiY,MartinBR,CravattBF,HofmannSL.DHHC5 http://dx.doi.org/10.1523/JNEUROSCI.0297-10. M.Dynamicproteinpalmitoylationincellularsignal- proteinpalmitoylatesflotillin-2andisrapidlydegraded 2010 ing. Prog Lipid Res 2009; 48:117-27; PMID: on induction of neuronal differentiation in cultured 27. McCormick PJ, Dumaresq-Doiron K, Pluviose AS, 19233228; http://dx.doi.org/10.1016/j.plipres.2009. cells. J Biol Chem 2012; 287:523-30; PMID: Pichette V, Tosato G, Lefrancois S. Palmitoylation 02.001 22081607; http://dx.doi.org/10.1074/jbc.M111. controlsrecyclinginlysosomalsortingandtrafficking. 6. SmotrysJE,LinderME.Palmitoylationofintracellular 306183 Traffic2008;9:1984-97;PMID:18817523;http://dx. signalingproteins:regulationandfunction.AnnuRev 18. HuangK,YanaiA,KangR,ArstikaitisP,SingarajaRR, doi.org/10.1111/j.1600-0854.2008.00814.x Biochem 2004; 73:559-87; PMID:15189153; http:// MetzlerM,etal.Huntingtin-interactingproteinHIP14 28. BarylkoB,MaoYS,WlodarskiP,JungG,BinnsDD, dx.doi.org/10.1146/annurev.biochem.73.011303. isapalmitoyltransferaseinvolvedinpalmitoylationand Sun HQ, et al. Palmitoylation controls the catalytic 073954 traffickingofmultipleneuronalproteins.Neuron2004; activity and subcellular distribution of phosphatidyli- 7. NandiA,KitamuraY,KahnCR,AcciliD.Mousemodels 44:977-86; PMID:15603740; http://dx.doi.org/10. nositol4-kinaseIIalpha.JBiolChem2009;284:9994- of insulin resistance. Physiol Rev 2004; 84:623-47; 1016/j.neuron.2004.11.027 10003; PMID:19211550; http://dx.doi.org/10.1074/ PMID:15044684; http://dx.doi.org/10.1152/physrev. 19. Dudler T, Gelb MH. Palmitoylation of Ha-Ras jbc.M900724200 00032.2003 facilitatesmembranebinding,activationofdownstream 29. Zambito AM, Wolff J. Palmitoylation of tubulin. 8. SavageDB,PetersenKF,ShulmanGI.Disorderedlipid effectors,andmeioticmaturationinXenopusoocytes.J Biochem Biophys Res Commun 1997; 239:650-4; metabolismandthepathogenesisofinsulinresistance. Biol Chem 1996; 271:11541-7; PMID:8626715; PMID:9367822;http://dx.doi.org/10.1006/bbrc.1997. Physiol Rev 2007; 87:507-20; PMID:17429039; http://dx.doi.org/10.1074/jbc.271.19.11541 7525 http://dx.doi.org/10.1152/physrev.00024.2006 20. CaseyPJ.LipidmodificationsofGproteins.CurrOpin 30. Rowland AF, Fazakerley DJ, James DE. Mapping 9. GalicS,OakhillJS,SteinbergGR.Adiposetissueasan CellBiol1994;6:219-25;PMID:8024813;http://dx. insulin/GLUT4 circuitry. Traffic 2011; 12:672-81; endocrineorgan.MolCellEndocrinol2010;316:129- doi.org/10.1016/0955-0674(94)90139-2 PMID:21401839; http://dx.doi.org/10.1111/j.1600- 39; PMID:19723556; http://dx.doi.org/10.1016/j. 21. OsterhoutJL,WaheedAA,HiolA,WardRJ,Davey 0854.2011.01178.x mce.2009.08.018 PC,NiniL,etal.Palmitoylationregulatesregulatorof 31. KandrorKV, Pilch PF. The sugar issIRVed: sorting 10. Lihn AS, Pedersen SB, Richelsen B. Adiponectin: G-protein signaling (RGS) 16 function. II. Glut4anditsfellowtravelers.Traffic2011;12:665-71; action,regulationandassociationtoinsulinsensitivity. PalmitoylationofacysteineresidueintheRGSboxis PMID:21306486; http://dx.doi.org/10.1111/j.1600- ObesRev2005;6:13-21;PMID:15655035;http://dx. critical for RGS16 GTPase accelerating activity and 0854.2011.01175.x doi.org/10.1111/j.1467-789X.2005.00159.x regulationofGi-coupledsignalling.JBiolChem2003; 32. ApolloniA,PriorIA,LindsayM,PartonRG,Hancock 11. Rabe K, Lehrke M, Parhofer KG, Broedl UC. 278:19309-16;PMID:12642592;http://dx.doi.org/10. JF.H-rasbutnotK-rastrafficstotheplasmamembrane Adipokines and insulin resistance. Mol Med 2008; 1074/jbc.M210124200 throughtheexocyticpathway.MolCellBiol2000;20: 14:741-51; PMID:19009016; http://dx.doi.org/10. 22. MilliganG,GrassieMA,WiseA,MacEwanDJ,Magee 2475-87; PMID:10713171; http://dx.doi.org/10. 2119/2008-00058.Rabe AI, Parenti M. G-protein palmitoylation: regulation 1128/MCB.20.7.2475-2487.2000 12. Richard AJ, Stephens JM. Emerging roles of JAK- andfunctionalsignificance.BiochemSocTrans1995; STAT signaling pathways in adipocytes. Trends 23:583-7;PMID:8566421 Endocrinol Metab 2011; 22:325-32; PMID: 21561789; http://dx.doi.org/10.1016/j.tem.2011.03. 007 26 Adipocyte Volume2Issue1