Logout succeed
Logout succeed. See you again!

RAPD analysis : An Efficient Method of DNA Fingerprinting in Fishes PDF
Preview RAPD analysis : An Efficient Method of DNA Fingerprinting in Fishes
ZOOLOGICAL SCIENCE 10: 849-854 (1993) © 1993 Zoological SocietyofJapan [RAPID COMMUNICATION] RAPD analysis: An Efficient Method of DNA Fingerprinting in Fishes K. R. Dinesh1 T. M. Lim1 K. L. Chua2 , , W. K. Chan13 and V. P. E. Phang14 department of Zoology, 2Department of Biochemistry and ^Institute of Molecular and Cell Biology, National University of Singapore, Kent Ridge, Singapore 0511, Republic of Singapore ABSTRACT—Random Amplified Polymorphic DNA target DNA-sequence information for designing (RAPD) generated using arbitrary primers of 9, 10, 16 specificprimers. Recently, Williams etal. [18] and a(nPdCR2)0wnuacsleiontviedsetilgeantgetdhisnb1y2PsopleycimeesraosfefiCshheasi.nWReeafcotuinodn Wbaeslesdh amnedthMocdCletlelramnedd[R17a]nddeoscmribAemdplaifnioveedlPPoClyR- tUhraetat-hSeDSam-pPliAfGiEcatainodn dpertoedcutcetds bwyerseilvbeerststariensionlgv.edThbey morphic DNA (RAPD) fingerprinting. This tech- DNA amplification products ranged from 25 to 75 depending nique allows detection of polymorphisms by on the primer and template combination. The random randomly amplifying multiple regions of the primersgeneratedunique fingerprintsforeachspeciesof genome by PCR using single arbitrary primers fish in terms of number and position of RAPDs. Our DNA designed independent of target sequence. results showed that the fish species can be distinguished RAPD from each other by RAPDs. The complexity of the Since the technique involves enzymatic RAPDs in the fingerprints may be manipulated to suit amplification of target DNA by PCR using arbi- the requirement of the study. The use of RAPD in trary primers it is also called Arbitrarily Primed taxonomy, fishery management and fish culture is dis- Polymerase Chain Reaction (AP-PCR) or DNA cussed. Amplification Fingerprinting(DAF). Thismethod overcomessometechnicallimitationsofthe earlier INTRODUCTION fingerprinting methods and has wide applications The conventional DNA fingerprinting method, including: genetic fingerprinting of bacteria, involving restriction fragment length polymorph- plants, fewanimal species andhumans [1-3, 6, 17, ism (RFLP) assay, requires large quantities of 18]; creating linkage maps [16]; locating disease relatively pure DNA, specific DNA probes and resistance genes [11, 12, 14]; and identifying generally uses short-lived radio-isotopes in the chromosome-specific markers [15]. AP-PCR has DNA detection system. It is also laborious and time been used for the detection of polymorph- consuming making it impractical for large popula- ismsoffewfish speciesincludingcolourmutantsof tion based studies. Fingerprinting by polymerase tiger barb, Barbus tetrazona and guppy, Poecilia chain reaction (PCR) technique requiresmuch less reticulata [4, 5]. Kubota et al. [10] used this DNA but a major limitation is the requirement of method for the detection of radiation induced DNA damages in Japanese medaka fish, Oryzias Accepted July 5. 1993 latipes. Hence, RAPD fingerprinting technique is Received April 23. 1993 robust, simple, fast, sensitive and particularly 4 To whom reprint request should be addressed. suited to problems where the genome is anony- 850 K. R. Dinesh, T. M. Lim et al. mous or quantity of genomic DNA available is Oligonucleotide Primers: Random primers limited. Itcanalsobeusedforanalysesofmuseum synthesized on ABI 394 DNA synthesizer and specimensandrarefishesusingDNAisolatedfrom purified by an ABI oligonucleotide purification scales and clipped fins without destroying the cartridge were purchased from the Bioprocessing whole organism. Technology Unit, National University of Singa- We used this technique for generating DNA pore. The 10 primers used were of 9-20 nuc- fingerprints in 10 species of tropical and two leotides (9-to20-mer) in lengthwith G+Ccontent species of temperate fishes representing seven ranging from 45.0-77.7%. The melting tempera- families, viz., Belontidae (Betta splendens), Ana- ture (Tm) values ofthe primers ranged from 28°C bantidae (Colisa Mia, Trichogaster microlepis), to 58°C. The details of the primers are given in Cyprinidae (Cyprinus carpio, B. tetrazona, Table 1. Brachydanio rerio), Poeciliidae (P. reticulata, Xiphophorus maculatus) Cichlidae {Oreochromis DNA Amplification: Samples were amplified , niloticus), Characidae {Hyphessobrycon innesi) in 50pi reaction mixtures containing IX PCR mM M and Salmonidae (Onchorhynchus nerka, Salmo buffer (Promega), 15 MgCl2, 1.0 primer, salar). We report here the usefulness of this 0.3 to 0.5pg of genomic DNA, 2mM of each method in combination with Urea-SDS-PAGE in dNTP (Promega) and 2.0units of Taq DNA generating RAPDs among the fishes. polymerase (Promega). Thetotalreactionmixwas overlaid with 40/^1 of mineral oil (Sigma). Am- MATERIALS AND METHODS plificationwasperformed in a Perkin-Elmer Cetus GeneAmp PCR System 9600 programmed for 30 Extraction of genomic DNA Tissues from cycles of 3min denaturation at 94°C, 3min low : individual fishes were pulverized after flash freez- stringency annealing at 37°C and 2min primer ingin liquid nitrogen, incubated with mildshaking extension at72°C. At the end a final extension for at 55°C in 10volumes ofextraction buffer (50mM 10min was performed at 72°C. Tris-Cl, pH8.0; 100mM EDTA, pH8.0; 100mM NaCl; 100mM DTT; 1.0% SDS; 0.5 mg/ml pro- Denaturing polyacrylamide gel electrophore- teinase K). After phenol extraction and ethanol sis: Amplified fragments were separated by precipitation, DNA was dried using Speed Vac SDS-PAGE (3% stackingand8% resolvinggel)in concentrator (Savant), resuspended in TE buffer a Mini-Protean II (Bio-Rad; Fig. 2) or Urea (10mM Tris-Cl, pH8.0; 1 mM EDTA, pH8.0) SDS-PAGE (3% stacking and 8% resolving gel M and stored at 4°C. containing 7 urea) in Sturdier SE 400 (Hoefer) Electrophoresis unit. Eight to tenp\ ofeach PCR Table 1. Details of Arbitrary Primers Name Nucleotide length Sequence (5'-3') (G+C)% Tm(°C) NUSZG1 9-mer TTGCGTCCA 55.5 28 NUSZG2 9-mer GCACTGTCT 55.5 28 NUSZG3 9-mer GGTAACGCC 66.6 30 NUSZG4 9-mer GGAGCTGGC 77.7 32 NUSZG5 10-mer AGGTCACTGA 50.0 30 NUSZG6 10-mer CGGTCACTGT 60.0 32 NUSZG7 10-mer AATCGGGTCG 60.0 32 NUSZG8 10-mer TGCCGAGCTG 70.0 34 NUSZG9 16-mer TGCCTGTGGGGAATCC 62.5 52 NUSZG10 20-mer TATGTAAAACGACGGCCAGT 45.0 58 RAPD Fingerprinting in Fishes 851 RAPD product was loaded onto polyacrylamide slab gels the patterns obtained using similar elec- of0.75 mm(7x8cm; Mini-ProteanII)or 1.00mm trophoretic conditions, gel size and detection (14X18cm; Sturdier SE 400) thickness. The system should be used. electrode buffer (pH 8.3) contained 0.025 M Tris- The RAPD profiles were found to be similar in Cl. 0.2 M glycine and 0.1% SDS. The samples terms of mobility and intensity of the bands for were loaded together with a PCR dense dye different individuals ofthe same species as seen in containing 50mM EDTA, 30% glycerol, 0.25% our example ofthe guppy, indicating specificity of DNA xylene cyanol FF and 0.25% bromophenol blue. the patterns for a given species (Fig. 1). Electrophoresis was carried at 100V for 3K hr in Among the 10 guppies (5 male and 5 female Mini-Protean or 16hr in Sturdier gel unit. full-sibs obtained from a single-pair mating) tested, theyshared many monomorphic (constant) Silverstaining Silver staining method of Her- bands with few polymorphic (variable) bands : ring etal. [8] was used with slight modifications to accounting for individual differences (Fig. 1). stain the gels. The gels were fixed with 10% Hence, these fingerprints indicated low genetic ethanol-0.5% acetic acid for 1 hr and then soaked variabilitywhichcouldbeduetoinbreeding, asthe M in 0.011 silver nitrate for 30min. After rinsing parents ofthe individuals testedwere from a small the gels twice briefly in distilled water, the reduc- random breeding stock of about 50 in number tion reaction was carried out for a maximum of 10 maintained for several years in our laboratory. M min with a solution of 0.75 sodium hydroxide The presence of simple repetitive male specific M DNA and 0.085 formaldehyde till the bands were revealed by oligonucleotide fingerprinting clearly visible. The reaction was stopped by has been reported in the guppy, a species with transferring the gels to 0.07 M sodium carbonate XX/XY sex determining mechanism [13]. We did for 30min. Prior to drying, the gels were photo- not find any sex specific RAPD markers for male graphedwithtransmittedlightusingaNikonF-501 or female guppies using the 16-mer RAPD primer mm camerafittedwitha55 f2.8Micro-Nikkorlens and Kodak TMAX 100 black and white film. Bio-Rad gel dryer 583 was used to dry the gels - 6 7 8 9 10 afterbrieflysoakingin asolutionof30% methanol and 5% glycerol. RESULTS AND DISCUSSION RandomAmplifiedPolymorphicDNA (RAPD) in 12 species of fishes was investigated. Both the short (9 and 10 nucleotide) andmedium length (16 i 1 and 20 nucleotide) primers generated discrete DNA amplified fragments of varying lengths and revealed RAPD variation among the species. We found that addition of 7 M urea to the 8% 9_^ resolving gels in SDS-PAGE improved the am- plifiedfragment separationconsiderably. General- ly the fragments of range 100 to 3500 bp could be adequately resolved by Urea-SDS-PAGE. The Fig. 1. RAPD fingerprints generated by 16-mer spectrum of amplified products was reproducible (NUSZG9)in5male(lanes1-5)and5female(lanes fora particulartemplate-primercombination. The 6-10) i—ndividuals of the guppy, Poecilia reticulata. technique of DNA amplified fragment separation LDaNnAe.' Fr'aigsmoefnntesgiazteisve(brpe)aocftiloanmsbwdiathDoNuAt-tBesmptlEatIeI and detection system play important roles in digest molecular weight standard: a) 3675, b) 2323, RAPD analysis. For the purpose of comparison c) 1929, d) 1371, e) 1264, f) 702, g) 224, h) 117. 852 K. R. Dinesh, T. M. Lim et al. 5- M1 234 567 8910 2 3 4 -"| a Fig. 2. DNA profiles from a single tiger barb, Barbus tetrazonaobtainedbyusingfourprimersofdifferent DNA nucleotide sequences and lengths. amplifica- Fig. 3. Amplification fingerprints in 10 species of tro- tionproductsby: 9-mer, NUSZG4(lane2); 10-mer, pical fishes generated by a 9-mer, NUSZG3. Lane NUSZG8 (lane 3); 16-mer, NUSZG9 (lane 4); and M: Molecular weight marker is lambda DNA-BstE 20-mer, NUSZG10(lane5). Thefirstandlastlanes II digest. Lane 1: Betta splendens; Lane 2: Colisa are of lambda DNA-BstE II digest and negative lalia; Lane3: Trichogastermicrolepis;Lane4: Cyp- reactions without template, respectively. RAPD rinus carpio; Lane 5: Barbus tetrazona; Lane 6: bands resolved by SDS-PAGE in Mini-Protean II Brachydaniorerio;Lane7: Poeciliareticulata;Lane (BIO-RAD). 8: Xiphophorus maculatus; Lane 9: Oreochromis niloticus Lane 10: Hyphessobrycon innesi. Arrows indicate R; APD variable bands among the different (NUSZG9) (Fig. 1). species. Figure2 showed that four primers of different sequences and lengths generated different profiles length ofthe primers and the numberofamplified DNA in a single individual tiger barb. Also, the fragments generated. The number of amplified profiles of 10 individual fishes representing 10 products may be related to the G+C content of species (lanes 1-10) in Fig. 3 (9-mer, NUSZG3), primerandtemplate DNAsequenceratherthanto Fig. 4 (10-mer, NUSZG5) and Fig. 5 (20-mer, theprimerlength [1]. G+Ccontentoftheprimers NUSZG10) show clearly that different patterns of usedinourstudyrangedfrom45.0-77.7%. Figure amplified products are generated by different 2shows some evidence thatprimers ofhigher G+ primers. We have found that the primers ofsame C content generate more amplified products. length but with different sequences generated The 9-mer (NUSZG3) generated a total of different DNA patterns in a single fish [4, 5]. about 40 clearly noticeable RAPD variable bands These results showed that this technique can be among the 10 species of tropical freshwater fishes manipulated bychanging the primersequence and (Fig. 3), while the 10-mer (NUSZG5) (Fig. 4), length to generate amplification products of de- 16-mer (NUSZG9) and 20-mer (NUSZG10) (Fig. sired complexity to suit different purposes like 5) generated 31, 20 and 28 RAPD variable bands, genetic mapping or genotyping [1]. Depending on respectively, among the 12 species offishes which the particular primer and template combination, included two cold water species. The fingerprints the numberofRAPD ranged from25 to 75. Each generated by the four different primers revealed primer detected an average of 30 RAPD variable uniqueprofilesforeachspeciesintermsofnumber bands among the 12 species of fishes studied. and position of RAPD bands. Thus, the RAPD However, there was no clear relation between the generated for each species can be efficiently used RAPD Fingerprinting in Fishes 853 M12345678 910111213 a_ b-S) d__ e . M f — iJttb— Urn fc Fig.4. DNAfingerprintsgeneratedbyadecamerprimer, NUSZG5in 12speciesoffishes. LanesMand 1 to 10are as in Fig. 3. Lane 11: Onchorhynchus nerka; Lane 12: Salmo salar and Lane 13: control reactions without template DNA. 789 M1 23 45 6 10 11 12 m — f_ Fig.5. Fingerprintsgeneratedbythe20-mer(NUSZG10)in 12speciesoffishes. LanesMand 1-12areasinFig. 4. as supporting markers for taxonomic identifica- and systematics, species-specific RAPD markers tion. Further confirmation can be achieved by could be an invaluable tool for species verification consideringthe RAPD markersgeneratedbymore and in establishing the status of organisms of than one primerforthe same species. Intaxonomy controversial systematics. RAPDs that are di- 854 K. R. Dinesh, T. M. Lim et al. agnostic at different taxonomic levels can be CarlsonJE,TulsieramLK, GlaubitzJC,LukVWK, generatedbyemployingdifferentprimersandthey KauffeldtC, Rutledge R (1991) TheorAppl Genet 83: 194-200 can be used to determine the relatedness between taxa for which diagnostic RAPD fingerprints have PCohwaellmlerWs (K1J9,92W)auHegrhedRit,yS6p9r:e4nt65J-I4,72Simsons AL, been established [7]. However, for RAPD finger- Dinesh KR, Chua KL, Phang VPE, Lim TM, Tan printing to provide supporting evidence for tax- TW (1992) In "Proc. International Workshop on onomic relationships in fishes, data should be Genetics in Aquaculture and Fisheries Manage- generated using adequate sample size for each ment" Ed by D Penman, N Roongratri, B McAn- species. RAPD markers can play an important drew, Stirling, U.K. pp125-127 Dinesh KR, Phang VPE, Lim TM, Chua KL, Tan role in fishery management and conservation TW In "Proc. 3rd Asian Fisheries Forum", Asian genetics such as studying the genetic effects of Fish Soc, 26-30 Oct 1992. Singapore (in press) mixing cultured fish with wild populations. Such EchtCS,ErdahlLA,McCoyTJ(1992) Genome35: DNA markers could also be used to assess the 84-87 impact of intentional or accidental release of HadrysH,BalickM,SchierwaterB(1992) MolEcol farmed fishes to the wild [9]. From the point of 1: 55-63 view offish culture, RAPD methodology has been HMeernrgiinegsAJJD,(I1n9g8l2is)NJFC,liOnjeMhi,croCbKi,olSn16o:dg4r7a3s-s47D7R, shown to be useful in preliminary pedigree analy- Hindar K (1992) In "Conservation of Biodiversity ses [5] and in the detection of phenotypic-specific for sustainable development" Ed by OT Sandlund, DNA polymorphic markers in different colour K Hindar, AHD Brown, Scandinavian Univ Press, mutants of two freshwater aquarium fishes [4, 5]. Norway, pp168-184 Our results show that RAPD can be used to 10 KubotaY, Shimada A, ShimaA (1992) Mutat Res 283: 263-270 generate useful fingerprints characteristic of fish 11 Martin GB, Williams JGK, Tanksley SD (1991) species and for genotyping individuals within the Proc Natl Acad Sci USA, 88: 2336-2340 species. Thus, itprovides anefficient and sensitive 12 Michelmore RW, Paran I, Kesseli RV (1992) Proc method which can be used to estimate genetic Natl Acad Sci USA, 88: 9828-9832 variability, relatedness, inbreeding levels, species/ 13 Nanda I, Feichtinger W, Schmid M, Schroder JH, strain verification, pedigree analyses, detection of Zischler H, Epplen JT (1990) J Mol Evol 30:456- 462 economic traits and in other marker-based studies 14 Paran I, Kesseli R, Michelmore R (1991) Genome in fishes. 34: 1021-1027 15 Quiros CF, Hu J, This P, Chevre AM, Delseny M ACKNOWLEDGMENTS (1991) TheorAppl Genet, 82: 627-632 16 Rafalski JA, Tingey SV, Williams JGK (1991) We thank Mr. H. K. Yip for developing and printing Agbiotech News Inf3: 645-648 the gel photographs. Support for this study came from 17 Welsh J, McClelland M (1990) NuclAcids Res 18: National University ofSingapore. 7213-7218 18 WilliamsJGK,KubelikAR,LivakKJ, RafalskiJA, Tingey SV (1990) Nucl Acids Res 18:6531-6535 REFERENCES 1 Caetano-Anolles G, Bassam BJ, Gresshoff PM (1991) Bio/technology 9: 553-557