Logout succeed
Logout succeed. See you again!

Reduced elastogenesis: a clue to the arteriosclerosis - Orphanet PDF
Preview Reduced elastogenesis: a clue to the arteriosclerosis - Orphanet
Morimotoetal.OrphanetJournalofRareDiseases2012,7:70 http://www.ojrd.com/content/7/1/70 RESEARCH Open Access Reduced elastogenesis: a clue to the arteriosclerosis and emphysematous changes in Schimke immuno-osseous dysplasia? Marie Morimoto1,2, Zhongxin Yu3, Peter Stenzel4, J Marietta Clewing5, Behzad Najafian6, Christy Mayfield7, Glenda Hendson8, Justin G Weinkauf9, Andrew K Gormley10, David M Parham3, Umakumaran Ponniah10, Jean-Luc André11, Yumi Asakura12, Mitra Basiratnia13, Radovan Bogdanović14, Arend Bokenkamp15, Dominique Bonneau16, Anna Buck17, Joel Charrow18, Pierre Cochat19, Isabel Cordeiro20, Georges Deschenes21, M Semin Fenkçi22, Pierre Frange23, Stefan Fründ24, Helen Fryssira25, Encarna Guillen-Navarro26, Kory Keller27, Salman Kirmani28, Christine Kobelka29, Petra Lamfers30, Elena Levtchenko31, David B Lewis32, Laura Massella33, D Ross McLeod34, David V Milford35, François Nobili36, Jorge M Saraiva37, C Nur Semerci38, Lawrence Shoemaker39, Nataša Stajić14, Anja Stein40, Doris Taha41, Dorothea Wand42, Jonathan Zonana27, Thomas Lücke43 and Cornelius F Boerkoel1,2* Abstract Background: Arteriosclerosis and emphysema developin individuals withSchimke immuno-osseous dysplasia (SIOD), amultisystem disorder caused by biallelic mutations in SMARCAL1(SWI/SNF-related,matrix-associated, actin-dependent regulator of chromatin,subfamily a-like 1). However, the mechanism by which the vascularand pulmonary disease arises in SIOD remainsunknown. Methods: We reviewed the records of 65patientswithSMARCAL1mutations. Molecular and immunohistochemical analyses were conducted on autopsy tissue from 4SIOD patients. Results:Thirty-two of 63patientshad signs of arteriosclerosis and 3 of 51had signs of emphysema. The arteriosclerosis was characterized by intimal and medial hyperplasia, smooth muscle cell hyperplasia and fragmented and disorganized elastin fibers, and the pulmonary diseasewas characterized by panlobular enlargementof air spaces. Consistentwith acell autonomousdisorder, SMARCAL1 was expressedin arterialand lung tissue, and both the aorta and lung of SIOD patients had reduced expressionof elastin and alterations in the expression of regulators of elastin gene expression. Conclusions: Thisfirst comprehensive study of the vascularand pulmonary complications of SIOD shows that these commonly cause morbidity and mortalityand mightarise from impaired elastogenesis. Additionally,theeffect of SMARCAL1 deficiency on elastin expression provides a model for understanding other features of SIOD. Keywords:Schimke immuno-osseous dysplasia, SMARCAL1,Elastin,Vascular disease,Pulmonary emphysema *Correspondence:[email protected] 1ProvincialMedicalGeneticsProgram,DepartmentofMedicalGenetics, Children'sandWomen'sHealthCentreofBC,4500OakStreet,RoomC234, Vancouver,BCV6H3N1,Canada 2RareDiseaseFoundation,Vancouver,BritishColumbia,Canada Fulllistofauthorinformationisavailableattheendofthearticle ©2012Morimotoetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited. Morimotoetal.OrphanetJournalofRareDiseases2012,7:70 Page2of17 http://www.ojrd.com/content/7/1/70 Background hernias [7,30,31]. Further highlighting the possibility of Schimke immuno-osseous dysplasia (SIOD, OMIM impaired elastogenesis, the postmortem lungs of two 242900) is an autosomal recessive disorder asso ciated SIOD patients showed enlarged air spaces or emphyse- witharteriosclerosis[1,2].Itischaracterizedbyprominent matous changes, a common feature in disorders of elas- skeletal dysplasia, renal failure, T-cell immunodeficiency, togenesis[7,30,31]. facial dysmorphism, and hyperpigmented macules [3-7]. Given these observations, we hypothesized that osteo- Other features include osteoporosis, joint degeneration, pontin deficiency and/or impaired elastogenesis were the hypothyroidism,abnormal dentition, bonemarrowfailure, primary causes of the vascular and pulmonary disease thin hair, corneal opacities, atherosclerosis, cerebrovas- associated with SIOD. To test these hypotheses and to cularevents(CVEs),andmigraine-likeheadaches[2,6-10]. determine the prevalence of vascular and pulmonary Severelyaffectedpatientsusuallydiebefore15yearsofage disease among SIOD patients, we reviewed the records from renal failure, infection, bone marrow failure, lung of SIOD patients with identified SMARCAL1 mutations, disease,orCVEs[7]. delineated the arterial and pulmonary pathology and SIOD is caused by loss of function mutations in the profiled gene expression in postmortem artery and lung. gene encoding for the chromatin remodeling enzyme Weidentify reducedelastinexpressionandsynthesisasa SWI/SNF-related, matrix-associated, actin-dependent possible basis of the arteriosclerosis and pulmonary regulator of chromatin, subfamily a-like 1 (SMARCAL1) emphysemaofSIODpatients. [11]. SMARCAL1 functions as an annealing DNA heli- case at single to double strand transitions in DNA [12] Methods and as a DNA stress response protein [13,14]. It also Patients interacts with replication protein A, participates in the Patients referred to this study signed informed consent resolution of stalled DNA replication forks, and modu- documents approved by the Institutional Review Board lates transcription [14-18]. Despite advances in our of Baylor College of Medicine (Houston, TX, USA) or understanding of the SMARCAL1 enzyme, the mechan- the University of British Columbia (Vancouver, BC, ism by which SMARCAL1 deficiency leads to SIOD Canada). Clinical data for 65 SIOD patients were remainsundefined. obtainedfromquestionnairescompletedbytheattending As renal transplantation and dialysis have prolonged physician and from medical records and summaries pro- the longevity of SIOD patients, cerebral ischemia from vided by that physician. Autopsy tissues were obtained arteriosclerosis has increasingly contributed to mor- according to the protocol approved by the University of bidity and mortality [7,19]. Although treatment with British Columbia. The SMARCAL1 mutations of SIOD anticoagulant or hemorheological medications can tran- patientsarelistedinTable1. siently decrease the frequency and severity of CVEs and transient ischemic attacks (TIAs), the vascular dis- Casereports ease ultimately progresses [7] and is not associated PatientSD120 with detectable alterations in nitric oxide production The propositus was a 5.4-year old boy with Schimke or mitochondrial dysfunction [20,21]. Focal atheros- immuno-osseous dysplasia (Additional file 1). He clerotic plaques, generalized hyperplasia of the tunica was born at 35 weeks gestation to healthy non- media, and splitting and fraying of the internal elastic consanguineous parents by Cesarean section for intra- layer characterize the arterial pathology [1,2]. uterine growth retardation and oligohydramnios. At 1 Potential contributors to the arteriosclerosis include year of age, he underwent surgery to repair an inguinal hypertension, hyperlipidemia, renal disease, and immune hernia. At 3.2 years of age, he had surgery for bilateral dysfunction [3,7,22,23]. However, the arterial pathology hip dysplasia. Beginning in his third year, he developed observed by Clewing et al. is most similar to that recurrent migraine-like headaches with aura, vomiting reported for osteopontin deficiency or for impaired elas- and hemiplegia. By 4 years of age, he manifested recur- togenesis [1,24-26]. Osteopontin is a cytokine that is rent TIAs, although he had normal brain magnetic res- induced by the WNT signaling cascade [27], a cellular onance imaging and angiography as well as normal pathway that participates in the regulation of vascular electroencephalogram studies. At 4.5 years of age, he smooth muscle cell proliferation [28]. Impaired elasto- developed nephrotic syndrome that progressed to end- genesis arises either from mutations of ELN or from stagerenaldiseaserequiring dialysis.At5.4years,hewas impaired function or expression of enzymes that process admitted to hospital for fever, anemia, hypoxia, and re- or bind elastin [29]. Mice heterozygous for Eln gene spiratory distress. His respiratory status rapidly worsened deletions show many features in common with SIOD despite antibiotics and mechanical ventilation. He died patients, including systemic hypertension, pulmonary from respiratory failure without identification of its hypertension, aortic valve disease and frequent inguinal cause. Postmortem studies showed alveolar damage, Morimotoetal.OrphanetJournalofRareDiseases2012,7:70 Page3of17 http://www.ojrd.com/content/7/1/70 Table1SummaryofpulmonaryandvascularfindingsinSIODpatientswithSMARCAL1mutations Pedigree SMARCAL1mutations Sex Pulmonaryfindings Vascularfindings Age Causeofdeath No. at Age Lungdysfunction Age CVA TIA Moya death at orpathology at moya onset onset SD4a c.[1930C>T];[410delA] F NR - NR NR 8 Renalfailure SD4b c.[1930C>T];[410delA] M NR - NR NR 8 Renalfailure SD8 c.[1190delT];[?]A F NR - NR NR 5.7 Pneumonia SD16 c.[1933C>T];[1643T>A] M 34 Mildpanlobular - - - emphysemawith dyspnea,pulmonary hypertension, restrictivelung disease SD18a c.[1756C>T];[1756C>T] M NR NR - NR 43 Cryptococcus meningitis SD18c c.[1756C>T];[1756C>T] F - - - - SD22 c.[2459G>A];[2459G>A] M NR 8 - + - 14.6 CMVinfection SD23 c.[2542G>T];[2542G>T] M NR 4.1 + + - 10.3 Unknown SD24 NT_005403.17:g.[67482574_67497178del] F - 7.5 + + NR 9 CVE +[67482574_67497178del] SD25 c.[100C>T];[49C>T] F - 5 + + NR 10.1 CVE SD26 c.[2542G>T];[1190delT] M NR Pulmonaryedema 5.3 + + - 8 Renalandbone marrowfailure SD27 c.[1940A>C];[1940A>C] F - - - - 25.6 Infectious pulmonarydisease SD28 c.[1696A>T;1698G>C;1702delG]; M 12 Chroniccough, NR - NR 12 Pulmonary [1696A>T;1698G>C;1702delG] dyspnea,pulmonary hypertension hypertension SD29 c.[1934delG];[862+1G>T] M 3.7 Pulmonaryedema, <3 + + NR 4 Infectious restrictivelung pulmonarydiseaseB disease,pulmonary fibrosis SD30 c.[1132G>T];[1132G>T] F NR 5.7 + - + 10 HSVpneumonitis SD31 NT_005403.17:g.[67482574_67497178del] F NR 11 + + + 14 Lymphoproliferative +[67482574_67497178del] disease(secondary) SD33a c.[1146_1147delAA;1147+1_2delGT]; F - - - NR 2.8 Bonemarrowfailure [1097-2A>G] SD33b c.[1146_1147delAA;1147+1_2delGT]; M - <1 + - NR 3.7 CVE [1097-2A>G] SD35 c.[1736C>T];[2321C>A] M NR Pulmonaryfibrosis - - - 8 Renalfailure SD38 c.[1096+1G>A];[1096+1G>A] M 2 Asthma NR NR + - 10.8 Complicationsof bloodstemcell transplant SD39 c.[2114C>T];[1402G>C] M NR 11 + + NR 15 CVE SD44 c.[2321C>A];[1191delG] M - 9 + + NR 11.9 Digestivebleeding SD47 c.[2459G>A];[?]A M - 7 + + - SD48 c.[1939A>C];[1939A>C] F 6.8 Pulmonary 4 + + + 6.8 EBVpneumonia hypertension SD49 c.[2321C>A];[1920_1921insG] M 4.8 Pulmonaryedema - - - 4.8 Unknown SD50 c.[2542G>T];[2542G>T] F 3 Restrictivelung 4.5 + + NR 8 Peritonitisand disease sepsispost transversecolon perforation Morimotoetal.OrphanetJournalofRareDiseases2012,7:70 Page4of17 http://www.ojrd.com/content/7/1/70 Table1SummaryofpulmonaryandvascularfindingsinSIODpatientswithSMARCAL1mutations(Continued) SD51 c.[2542G>T];[2459G>A] F - - - - SD53 c.[2291G>A];[2543G>T] M NR - - NR SD57 c.[955C>T];[955C>T] F <10 Asthma,wheezing, 8 + + - 28 Pancreatitis basilaratelectasia SD60 c.[2542G>T];[2542G>T] M NR Pulmonaryedema, 8 + + NR 13.7 CVE pulmonary hypertension, emphysematous changesupon autopsy SD61 c.[1146_1147delAA;1147+1_2delGT]; M - - - NR 5 Lymphoproliferative [1146_1147delAA;1147+1_2delGT] disease(primary) SD65a c.[2542G>T];[836T>C] M - - - - SD65b c.[2542G>T];[836T>C] M 23 Diffusionand 14 + + - perfusionlung disorder SD66 c.[1933C>T];[1933C>T] M NR Pulmonaryedema 7 + + + 13 Congestiveheart failure SD68 c.[1940A>C];[2462T>G] F - 6 + + - 7.1 CVE SD70 c.[340_341insAGTCCAC];[836T>C] F - 6 + + - 18 Recurrentileus pathology SD71 c[1000C>T];[836T>C] M - 6 + + - 9 Unknown SD74 c.[1736C>T];[?]A M - - - - SD78 c.[2264T>G];[1439C>T] F - NR - NR 10 Pneumonia SD79 c.[2459G>A];[?]A F - - - - 10 Complications ofBMT SD84 c.[2104T>G];[1248_1249insC] M NR Pulmonary 10 - + + 23 Pulmonary hypertension, hypertensionwith emphysematous heartfailure changesupon autopsy SD86 c.[2263_2282delATCGATGGCTCCACCTCATC]; F - - - - 5.7 Complications [1129G>C] followingBMT SD96 c.[1427G>A];[1427G>A] M 6 Recurrentlung - - - 6 InfectionC infections SD99 c.[1402G>C];[1402G>C] F 5.5 Pulmonaryedema - - NR 5.5 Pulmonaryedema andleftheartfailure SD101 c.[2542G>T];[2542G>T] M NR 3 - + - SD102 c.[2542G>T];[2542G>T] M NR NR NR NR 8 Renalfailure SD106 c.[1682G>A];[1682G>A] M 4 Chroniccoughing 5.5 - + NR 8 Non-Hodgkin andwheezing Lymphoma SD107 c.[2542G>T];[2542G>T] F 3 Restrictivelung NR - NR 6 Thrombosis disease SD108a c.[1798C>T];[1798C>T] M - - - - SD108b c.[1798C>T];[1798C>T] M - - - NR SD111 c.[1129G>C];[1592T>C] M 13 Pulmonary 15 + + - 17.5 Respiratoryfailure hypertension, chroniccough, restrictivelung disease SD112a c.[1934G>A];[2542G>T] F - - - - SD112b c.[1934G>A];[2542G>T] F - - - - SD114 c.[1898T>C];[1898T>C] M - 4 + - + 9.5 Unknown Morimotoetal.OrphanetJournalofRareDiseases2012,7:70 Page5of17 http://www.ojrd.com/content/7/1/70 Table1SummaryofpulmonaryandvascularfindingsinSIODpatientswithSMARCAL1mutations(Continued) SD115 c.[1437_1438insG];[1437_1438insG] F <0.6 Mildbronchiectasis - - - 1 Pneumoniawith respiratoryfailure SD119 c.[2449C>T];[2542G>T] F NR NR - NR SD120 c.[2291G>A];[2542G>T] M NR Restrictivelung 3 - + - 5.5 Respiratoryfailure disease, emphysematous changes SD121 c.[1382G>A];[2542G>T] F - 3.3 + - - 4.8 CVE SD123 c.[49C>T];[49C>T] F - 4 - + - SD124 c.[1920_1921insG];[1920_1921insG] M - - NR - SD127 c.[1736C>T];[1736C>T] F 9 Reactiveairway 7 + + + disease SD131 c.[1026C>A];[2264T>G] M - NR + - - 4.6 Cerebral hemorrhage SD133a c.[863-2A>G;2343_2347_delGCTGT]; F - - - - 3 Pulmonary [=;2343_2347_delGCTGT] embolism (secondary) SD133b c.[863-2A>G;2343_2347_delGCTGT]; F Terminated [=;2343_2347_delGCTGT] pregnancy SD138 c.[2542G>T];[2542G>T] M - NA NA NA NA Abbreviation:+,featurepresent;-,featurenotpresent;BMT,bonemarrowtransplant;CVE,cerebrovascularevent;CMV,cytomegalovirus;EBV,Epstein-Barrvirus;F, female;HSV,herpessimplexvirus;M,male;NA,notapplicable;NR,notreported;TIA,transientischemicattack. A[?]representsalleleswithnoncodingSMARCAL1mutationsasdescribedbyClewingetal.[60]. BNobacteriologicorviralproof. CInfectionofperitonealdialysisfluid. alveolitis, bronchitis, and dilated air spaces as well as ar- Canada).Fortissues,RNAwasextractedfromflashfrozen teriosclerosis, atherosclerosis, and cardiac left ventricular tissue pulverized with a Bessman tissue pulverizer and hypertrophy. lysed with TRIzol reagent (Invitrogen, Burlington, ON, Canada) according to the manufacturer’s specifications. PatientsSD60andSD84 Subsequently, the RNeasy Mini Kit (Qiagen, Mississauga, SD60 was a 13.7-year old boy and SD84 was a 23-year ON, Canada) was used to purify the RNA. Residual gen- old man. Both have been described previously [1,2]. omicDNAwasremovedbyDNaseIdigestion. Control aorta RNA pooled from 4 unaffected indivi- PatientSD16 duals ranging in age from 27–45 years was purchased The propositus is a 36-year old man with mild SIOD from Clontech (636546, Lot no. 9052725A, Mountain (Additional file 1); he was described by Gilchrist et al. at View, CA, USA). Control lung RNA pooled from 3 un- 16 years of age [32]. Since then, he has had bilateral hip affected individuals ranging in age from 32–61 years was and aortic valve replacement and respiratory insuffi- purchased from Clontech (636643, Lot no. 8101369A, ciency requiring oxygen supplementation. He has no MountainView,CA,USA). history of smoking or exposure to cigarette smoke. His RNA from formalin-fixed paraffin-embedded umbilical spirometry and diffusion studies show signs of both re- cord was isolated using the Ambion RecoverAll Total strictive and obstructive pulmonary disease (Additional Nucleic Acid Isolation Kit (AM1975, Life Technologies, file 2). The former is consistent with his skeletal Burlington, ON, Canada) according to the manufac- dysplasia and the latter is explained by the mild pan turer’sspecifications. lobular emphysema identified by computed tomography Reverse transcription was performed with the qScriptTM (Figure 1A, B). The severity of his respiratory distress cDNA Synthesis Kit (Quanta Biosciences, Gaithersburg, has been disproportionate to his lung pathology, and is MD, USA) or the RT2 First Strand Kit (SABiosciences, explained by Type I pulmonary arterial hypertension Mississauga,ON,Canada)using500ngofRNAperreac- detected on right heart catheterization. tionaccordingtothemanufacturer’sspecifications. RNAisolationandreversetranscription PCR For cultured cells, RNA was extracted from 1 X 107 cells Following reverse transcription, 1.5 μl of cDNA served using the RNeasy Mini Kit (Qiagen, Mississauga, ON, as template for each reaction and was amplified with the Morimotoetal.OrphanetJournalofRareDiseases2012,7:70 Page6of17 http://www.ojrd.com/content/7/1/70 Figure1EmphysematouslungchangesinanSIODpatient.(A,B)Consecutiveaxialcomputerizedtomographyimagesofthechestofpatient SD16atage34years.Theimageswerecaptured1mmapart.Notethelungblebs(arrows). HotStarTaq Master Mix Kit (Qiagen, Toronto, ON, interpretation analysis was conducted using Alamut 2.0 Canada). The following conditions were used foramplifi- (Interactive Biosoftware, SanDiego,CA,USA). cation: 1 cycle of 95°C for 15 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, and a Cellculture final extension at 72°C for 10 min. PCR was performed Aortic smooth muscle cells (AoSMCs, CC-2571, Lonza, usingtheprimerslistedinAdditionalfile3. Walkersville, MD, USA) were grown in smooth muscle basal medium (SmBM) supplemented with 5% fetal bo- vine serum (FBS), epidermal growth factor (EGF), basic Geneexpressionarray The Atherosclerosis (PAHS-038) RT2 Profiler™ PCR fibroblast growth factor (FGF-B), insulin, gentamicin, and amphotericin B (SmGM-2 BulletKit, CC-3182, Array from SABiosciences (Mississauga, ON, Canada) Lonza,Walkersville,MD,USA). was used to assess differences in gene expression be- Human iliac artery endothelial cells (HIAECs, CC- tween control and SIOD aortic mRNA according to the manufacturer’sinstructions. 2545, Lonza, Walkersville, MD, USA) were grown in endothelial basal medium (EBM-2) supplemented with 5% FBS, EGF, FGF-B, vascular endothelial growth factor QuantitativePCR (VEGF), R3 insulin-like growth factor 1 (R3-IGF-1), SsoFast EvaGreen Supermix (Bio-rad Laboratories, hydrocortisone, ascorbic acid, gentamicin, and ampho- Mississauga, ON, Canada) or RT2 Real-Time™ SYBR tericin B (EGM-2-MV BulletKit, CC-3202, Lonza, Walk- Green/RoxPCRmastermix(SABiosciences,Mississauga, ersville,MD,USA). ON, Canada) was used with the ABI 7500 Fast Real- Aortic adventitial fibroblasts (AoAFs, CC-7014, Lonza, Time PCR System for quantitative PCR. The primer Walkersville, MD,USA) were grown in stromalcell basal sequencesarelistedinAdditionalfile3. medium (SCBM) supplemented with 5% FBS, FGF-B, in- sulin, gentamicin, and amphotericin B (SCGM BulletKit, ELNmutationanalysis CC-3205,Lonza,Walkersville,MD,USA). Genomic DNA was extracted from the aorta of SD120 Normal human lung fibroblasts (NHLFs, CC-2512, using the DNeasy Tissue Kit (Qiagen, Toronto, ON, Lonza, Walkersville, MD, USA) were grown in fibroblast Canada) according to the manufacturer’s specifications. basal medium (FBM) supplemented with 2% FBS, FGF- The 34 exons of ELN were amplified with the HotStar- B, insulin, gentamicin, and amphotericin B (FGM-2 Bul- Taq Plus Master Mix Kit (Qiagen, Toronto, ON, letKit,CC-3132,Lonza,Walkersville,MD,USA). Canada). The following conditions were used foramplifi- cation: 1 cycle of 95°C for 5 min, followed by 35 cycles Immunofluorescence of 94°C for 30 s, 55°C or 60°C for 30 s, 72°C for 45 s, Immunostaining of cultured cells was performed as pre- and a final extension at 72°C for 10 min. PCR was per- viously described [33]. 5 x 105 cells were grown over- formed using the primers listed in Additional file 3. Un- night on a coverslip in a 6-well plate. With the exception incorporated primers and nucleotides were removed of the aortic smooth muscle cells (AoSMCs), all cells usingExoSAP-ITreagent(USB,Cleveland,OH,USA). were fixed with 4% paraformaldehyde (PFA) for 15 min Sanger capillary sequencing was used to sequence the atroomtemperatureandpermeabilizedwith0.5%Triton PCR products (Macrogen, Seoul, Korea), and the X-100 for 15 min at room temperature. AoSMCs were sequences were aligned and analyzed using Sequencher fixed with 4% PFA and 0.15% picric acid for 20 min at v.4.10.1 (Gene Codes, Ann Arbor, MI, USA). Mutation room temperature, and permeabilized with 0.1% Triton Morimotoetal.OrphanetJournalofRareDiseases2012,7:70 Page7of17 http://www.ojrd.com/content/7/1/70 X-100,1%bovineserumalbumin(BSA),and10%normal was normalized to expression of GAPDH for each sam- horse serum in 1X phosphate buffered saline (PBS). All ple. Densitometry of three independent replicates was cells were blocked overnight with Blocker Casein in PBS conducted using the Kodak 1D Image Analysis Software (Pierce,Rockford,IL,USA)containing10%normalhorse version 3.6. serum at 4°C. The cells were then incubated with anti- SMARCAL1 (1:200) [33], anti-α-smooth muscle actin Tissueimmunohistochemistryandstaining (1:20, 1A4, Dako, Mississauga, ON, Canada), anti-VE- Formalin-fixed, paraffin-embedded sections were cutat 5 cadherin (1:100, 33E1, Leica, Richmond Hill, ON, microns. Following deparaffinization and rehydration, Canada), anti-prolyl 4-hydroxylase (1:50, 5B5, Abcam, heat induced epitope retrieval was conducted with so- Cambridge, MA,USA),oranti-α-tubulin (1:400, DM1A, dium citrate buffer (10 mMsodium citrate, 0.05% Tween Sigma-Aldrich, Oakville, ON, Canada) diluted in block- 20, pH 6) or tris-ethylene diamine tetraacetic acid ing buffer at 4°C for 24 h. Cells then were gently washed (EDTA) buffer (10 mM Tris base, 1 mM EDTA, 0.05% 4 times with PBS and incubated with Alexa Fluor- Tween 20, pH 9). For immunohistochemical detection of conjugated secondary antibodies Alexa 488 and Alexa elastin, proteolytic induced epitope retrieval was con- 555 (1:1000, Molecular Probes, Burlington, ON, Canada) ducted with 0.4% pepsin at 37°C for 15 min. Endogenous for 1 h at room temperature. Cells next were washed 4 peroxidases were inactivated by preincubating the sec- times with PBS and mounted in Vectashield containing tions with 0.3% H O in methanol. Non-specific protein 2 2 4’,6-diamidino-2-phenylindole (DAPI, Vector Laborator- binding was blocked by preincubation at 4°C with block- ies, Burlington, ON, Canada). Images were acquired ing buffer (10% horse serum in TBS-T (10 mM Tris– using a 100×/1.30 oil Plan-NEOFLUAR objective lens, a HCl, 150 mM NaCl, 0.01% Tween 20, pH 7.4)) for 24 h. Zeiss Axiovert 200 inverted microscope, a Zeiss Axio- Sections were then incubated with anti-SMARCAL1 camMR camera, and the Zeiss Axiovision imaging (1:200) [33], anti-CD3 (1:50, MRQ-39, Cell Marque, system. Rocklin, CA, USA), anti-CD20 (1:50, L26, Cell Marque, Rocklin, CA, USA), anti-CD68 (1:250, KP1, Dako, Immunoblotanalysis Mississauga, ON, Canada), anti-α-smooth muscle actin Immunoblot analysis on cell lysates was performed as (1:500, 1A4, Dako, Mississauga, ON, Canada), or anti- previously described [33]. Cell lysates were fractionated elastin (1:50, BA-4, Abcam, Cambridge, MA, USA) by 12% sodium dodecyl sulfate polyacrylamide gel diluted in blocking buffer at 4°C for 24 h. Sections were electrophoresis (SDS-PAGE) and transferred to a poly- then washed 5 times with TBS-T and incubated with vinylidene fluoride (PVDF) membrane. The membrane horseradish peroxidase (HRP)-conjugated secondary was blocked overnight at 4°C, using gentle agitation, in antibodies (EnVision+ System, Dako, Mississauga, ON, PBS containing 0.2% I-Block (Applied Biosystems, Canada) for 30 min at room temperature. Sections were Foster City, CA, USA) and 0.1% Tween 20 overnight. then washed 3 times withTBS-Tand 3,3’-diaminobenzi- Anti-SMARCAL1 (1:2000) [33] and anti-glyceraldehyde dine (DAB, EnVision+ System, Dako, Mississauga, ON, 3-phosphate dehydrogenase (GAPDH, 1:2000, 6C5, Canada) was subsequently used as an HRP substrate. AdvancedImmunoChemicalInc.,LongBeach,CA,USA) Sections were counterstained in Mayer’s Hematoxylin were used as primary antibodies. Alkaline phosphatase- (Sigma,Oakville,ON,Canada). conjugated secondary antibodies (1:10000, Bio-rad Histochemical stains on tissue sections included a Laboratories,Mississauga,ON,Canada)wereusedtode- modified Verhoeff van Geison elastic stain (HT25A, tect the primary antibodies. The bound antibody was Sigma, Oakville, ON, Canada) for elastic fibers and a detected by chemiluminescence using CDP-Star (Applied periodic acid-Schiff stain (395B, Sigma, Oakville, ON, Biosystems, Streetsville, ON, Canada) according to the Canada) for neutral glycosaminoglycans. Images were manufacturer’s specifications. GAPDH was detected as a acquired using a 5x/0.15 Plan-NEOFLUAR, 10x/0.45 loadingcontrol. Plan-APOCHROMAT, 20x/0.75 Plan-APOCHROMAT, Immunoblot analysis on human tissue was performed 63x/1.4 oil Plan-APOCHROMAT, or 100x/1.30 oil Plan- as previously described [33]. Anti-elastin binding protein NEOFLUAR objective lens on a Zeiss Axiovert 200 (EBP, 1:200, a kind gift from Dr. Amelia Morrone, Uni- inverted microscope, a Zeiss AxiocamHR camera, and versity of Florence, Florence, Italy) [34,35] and anti- theZeissAxiovisionimagingsystem. GAPDH were used as primary antibodies. EBP expres- sion in the aortas of two SIOD patients was compared Fastinelastinassay to that of a control aorta protein medley pooled from Theelastincontentofarterialtissuewasquantifiedusing 49 unaffected individuals ranging in age from 15–65 the Fastin Elastin Assay Kit (F2000, Bicolor Life Science years and purchased from Clontech (635310, Lot no. Assays, United Kingdom). Tissue samples were flash 5110079, Mountain View, CA, USA). EBP expression frozen and pulverized with a Bessman tissue pulverizer, Morimotoetal.OrphanetJournalofRareDiseases2012,7:70 Page8of17 http://www.ojrd.com/content/7/1/70 weighed and digested with 0.25 M oxalic acid at 95°Cfor Student’s t-test or the one-way analysis of variance six 1 h time periods. Elastin concentration in pooled (ANOVA)followed by theTukey post hoc testwhere ap- supernatants was calculated from the elastin standard propriate.Ap-value oflessthan0.05wasconsideredsta- curve and the totalelastin per wet weight of eachsample tisticallysignificant. was determined according to the manufacturer’s specifications. Results Arterialthicknessanalysis PulmonaryandvasculardiseaseiscommoninSIOD Analysis of the aortic intimal and medial thickness Among SIOD patients with SMARCAL1 mutations, 22 was carried out using the Zeiss Axiovision imaging sys- of 51 (43.1%) patients had lung disease (Table 1). Ob- tem and software to measure the width of the tunica in- structive lung disease was present in 7 (13.7%) patients, tima and the tunica media. Four random images of each including 3 (5.9%) with asthma or reactive airway dis- sample were taken and 5 random measures were taken ease, 1 (2.0%) with bronchiectasis, and 3 (5.9%) with for both the tunica intima and tunica media for each emphysematouschanges(Table1). image. Measures of the tunica intima were taken Regarding the vascular disease, 32 of 63 (50.8%) from the luminal edge of the endothelium to the internal patients had clinical symptoms of cerebral ischemia and elastic lamina perpendicular to the internal elastic lam- 6 of 51 (11.8%) patients had documented pulmonary ina; measures of the tunica media were taken from hypertension. Twenty-five of 58 (43.1%) patients had the internal elastic lamina to the boundary between the CVEs and 27 of 59 (45.8%) patients had TIAs (Table 1). tunica media and the tunica adventitia perpendicular For 7 patients, the onset of cerebral ischemia preceded to the internal elastic lamina. Ratios were calculated the development of renal disease or hypertension, and comparing the widths of the tunica intima and tunica among patients who received a renal transplant, cerebral media of SIOD patient aortas to that of age-matched ischemia worsened despite renal transplantation (data controlaortas. not shown). Of the 65 patients with SMARCAL1 mutations, 47 Echocardiogrammeasurements have died. Six (12.8%) died from pulmonary complica- A transthoracic echocardiogram was obtained by a Phi- tions,and7(14.9%)diedfromvasculardisease(Table1). lips iE33 echocardiography machine using an S8 phased arrayultrasoundtransducerprobewiththepatientinthe supine and left lateral position. M-mode, 2D, color Dop- HistopathologyoftheSIODaortashowsfragmented pler, pulse wave Doppler and continuous wave Doppler elastinfibersandhyperplasiaofthetunicaintimaandmedia were obtained. Standard views including long axis view, To define better the histopathology of SIOD blood ves- short axis view, four chambers, subcostal and supraster- sels, we analyzed postmortem arterial tissue from three nalnotchviewswereobtained. individuals with SIOD (SD60, SD84 and SD120). Ver- The following measurements of the aorta in systole hoeff van Gieson staining showed fragmented elastin were obtained in accordance to the American Society of fibers compared to age-matched controls (Figure 2 and Echocardiogram guidelines in real time and confirmed Additional file 4). The aorta, common iliac, and pulmon- postmortem [36]: the aortic valve, the aortic root at ary arteries of SD60, SD84 and SD120 had marked in- the sinus of Valsalva, the sinotubular junction and the timal and medial hyperplasia accompanied by an ascending aorta. Body surface area and Z scores were increased number of elastic lamellae compared to age- calculatedofflineusingtheHaycockandHalifaxformula, matched controls (Figure 2 and Additional file 4). The respectively [37,38]. aortic tunica intima of SD60 and SD120 were 2.6-fold (p-value=3.5×10-13) and 1.4-fold (p-value=2.1×10-3) Pulmonaryfunctiontesting thicker than age-matched controls, respectively; the tu- Patient SD16 performed complete pulmonary function nica media of SD60 and SD120 were 1.3-fold (p-values= tests that met the American Thoracic Society (ATS) cri- 5.6×10-21 and 7.2×10-15, respectively) thicker than age- teria for acceptability [39]. This included spirometery, matched controls. By echocardiogram, SD120 had lung volumes measured via plethsysmography, and diffu- increased diameter of the sinotubular junction compared sioncapacitymeasuredvianitrogenwashout. to normal using the Halifax formula, although measures at other levels of the aortic root were within the normal Statisticalanalysis range (Additional file 5). Immunostaining for α-smooth Quantitative data are presented as the mean±1 standard muscle actin showed an increased number of positive deviation calculated from a minimum of 3 independent cells suggesting smooth muscle cell hyperplasia in the replicates. Data were analyzed by the paired 2-tailed aorticintimaofSD60andSD120(Additionalfile6). Morimotoetal.OrphanetJournalofRareDiseases2012,7:70 Page9of17 http://www.ojrd.com/content/7/1/70 Figure2PhotomicrographsofVerhoeffvanGiesonstainedaortasfromSIODpatientsandage-matchedcontrols.Comparedto age-matchedcontrols,notethedecreasedelastinfiberstaining,thefragmentationandsplittingoftheelastinfibers,themarkedhyperplasiaofthe tunicaintimaandthetunicamediaintheaortafromthreeindividualswithSIOD.Arteriesareorientedwiththetunicaadventitiaontheleftand thetunicaintimaontheright;theageofdeathisinparentheses.Scalebars:50μm. InflammationisnotincreasedintheSIODaorta age-matched controls showed that the umbilical cord Since SIOD patients have an immune disorder and the of both controls had 1.75- to 2.95-fold higher ELN inflammation of atherosclerosis causes smooth muscle mRNA expression compared to that of SD133b (Add- cell hyperplasia [40,41], we also looked for evidence of itional file 8). arterialinflammation.Using CD68asa macrophage mar- ker,CD3asaT-cellmarker,andCD20asaB-cellmarker, immunostainingdid not detect an inflammatory infiltrate SMARCAL1isexpressedinthevascularsmoothmuscle, within the arterial walls (Additional file 7) except for the endothelial,andadventitialfibroblastcellsofthearterial CD68+ macrophages within the atherosclerotic lesions of wall SD84(Additionalfile7). The above findings suggest a local or cell autonomous basisforthearteriosclerosisinSIOD,andconsistentwith HistopathologyoftheSIODumbilicalcordshowsa this mechanism, arteriosclerosis does not recur in the fragmentedinternalelasticlamina transplanted kidneys ofSIODpatients[1,2].Asafirstre- As longstanding hypertension, renal failure and hyper- quirement for a cell autonomous mechanism, SMAR- lipidemia of individuals SD60, SD84 and SD120 could CAL1 must be expressed within the affected tissues, and be a cause of the arterial disease and are not present indeed, SMARCAL1 was expressed in the adventitial in individuals with SIOD at birth, we tested this hy- fibroblasts, smooth muscle cells, and endothelium of the pothesis by studying the umbilical artery of a 15-week normalhumanaorta,commoniliacandpulmonaryarter- gestation fetus (SD133b) with biallelic SMARCAL1 ies (Figure 4A-C). It was also expressed in the nuclei of mutations (Table 1). Compared to age-matched con- cultured aortic smooth muscle cells (AoSMCs), iliac ar- trols, the fetal umbilical arteries of SD133b had inter- tery endothelial cells (HIAECs), and aortic adventitial rupted circumferential expression of tropoelastin and fibroblasts (AoAFs) (Figure 4D-K and Additional file 9). elastin suggesting an intrinsic problem with elastogen- Given these findings, we hypothesized that the cell au- esis (Figure 3). Moreover, analysis of ELN mRNA tonomous mechanisms of osteopontin deficiency or expression in the umbilical cord of SD133b and two impairedelastogenesiscouldgiverisetoarteriosclerosis. Morimotoetal.OrphanetJournalofRareDiseases2012,7:70 Page10of17 http://www.ojrd.com/content/7/1/70 Figure3ElastinexpressionanalysisoftheumbilicalcordfromSIODandunaffectedfetusesat15-weeksgestation.Notethatthe immunohistochemicalanalysisshowsmarkeddiscontinuityandreducedexpressionofelastinintheinternalelasticlaminainSD133bcompared tothatof2age-matchedcontrols.Thisdifferenceinexpressionofelastinprecedesthedevelopmentofhypertension,hypercholesterolemia,and renaldisease.Abbreviations:A,artery;V,vein.Scalebars:50μm. OsteopontinexpressionisnotdecreasedintheSIODaorta andwasaccentuatedbyhypertension,hyperlipidemia,and Osteopontin is a direct target of the WNT pathway renal failure. One mechanism for impaired elastin fiber anddeficientWNTsignalingcanleadtoosteopontindefi- assemblyisareductionintheprotectivechaperoneelastin ciency [27]. Therefore, since the histopathology of aortas binding protein (EBP) [42,43]. Elevated levels of glycosa- fromOpn−/−;Ldlr−/−miceresemblesthatofSIODpatients minoglycans, which are found in the mucopolysacchari- [26], we measured levels of SPP1 mRNA, which encodes doses like Morquio syndrome, Costello syndrome and osteopontin. Contrary to our hypothesis, SPP1 mRNA Hurler’s disease, induce premature shedding of EBP and levels were increased by 2.6-fold in the aorta of SD120 lead to impaired elastin fiber assembly [44-46]. Although comparedtocontrols(Figure5AandAdditionalfile10). later studies have not confirmed mucopolysacchariduria as a consistent feature of SIOD [6], we tested EBP levels ElastinbindingproteinisnotdecreasedintheSIODaorta since chondroitin-6-sulphaturia was initially described as Basedonthepreceding,wehypothesizedthatthearterio- a feature of SIOD by Schimke et al. [5]. Immunoblotting sclerosis primarily arose from a defect of elastogenesis showedthatEBPlevelsintheaorticlysatefromSD60and