loading

Logout succeed

Logout succeed. See you again!

ebook img

Scientific notes: Mictopsichia cubae recorded from Honduras (Lepidoptera: Tortricidae) PDF

release year2011
file size1.9 MB

Preview Scientific notes: Mictopsichia cubae recorded from Honduras (Lepidoptera: Tortricidae)

NúñEZ BUSTOS ET AL.: Mariposas de Osununú MATTHEWS ET AL.: New tortricid record from Honduras TROP. LEPID. RES., 21(1): 43-45, 2011 43 SCIENTIFIC NOTE: mIcTOPSIchIA cUBAE RECORDED FROM HONDURAS (LEPIDOPTERA: TORTRICIDAE) Deborah L. Matthews1, Jacqueline Y. Miller1 and Józef Razowski2 1McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, P. O. Box 112710, Gainesville, Florida 32611- 2710, USA, 2Institute of Systematics and Evolution of Animals PAS, Sławkowska 17, 31-016 Kraków, Poland Abstract - Mictopsichia cubae Razowski, 2009 is reported from northern Honduras based on specimens collected at Pico Bonito National Park, near La Ceiba. This species was previously known only from two Cuban specimens. Both male and female genitalia are figured, with the female described and illustrated for the first time. Key words: Tortricoidea, Archipini, telochromatic tortricines, neotropical, diurnal, Parque Nacional Pico Bonito. The neotropical tortricid genus Mictopsichia Hübner was mictopsichia cubae Razowski, 2009 recently revised (Razowski 2009) and transferred to Archipini (Figs. 1 & 2a-d) along with the closely related genera Mictocommosis Diakonoff, Chamaepsichia Razowski and Rubropsichia Razowski, which Material Examined. Holotype ♂, “CUBA (S.E.) Santiago. II, 02. W. SCHAUS. 1905-244”; GS 31697 [BMNH] (examined, JR); CUBA: Lomas de Soroa, Pinar can be distinguished on the basis of genitalia characters. These del Rio ix.1963 Alayo & Garcia (1 ♂, slide DM 1586) [ZIL]; HONDURAS: small telochromatic or brightly colored moths, like other Atlantida: Pico Bonito Lodge N15°41’48.00” W86°54’4.40”, 28-29.vi.2009 D. Archipini, are for the most part diurnal (Razowski & Wojtusiak Matthews & J. Y. Miller (1 ♂, slide DM 1556) [MGCL]; Parque Nacional Pico (2008). Mictopsichia is distinguished from related genera by Bonito, vicinity Estación CURLA N15°42’07.0” W86°51’16.0” 13.xi.2009 J. Y. Miller, D. Matthews, M. Lehnert, C. Salcedo (1 ♀, slide DM 1569) [MGCL]. the characteristic orange hindwings with patterns of black and Descriptive notes. Head, thorax, and abdomen dark brown. Legs shiny buff silvery scaling along the anal and terminal margin that extend with gray scaling on hindleg at tibial spurs and marking tarsi dorsally, light into the posterior half of the hindwing. Mictopsichia currently gray ventrally. Forewing length 5.0 mm (♂), 5.5 mm (♀). Holotype ♂ wing includes 25 species (Brown 2005, Razowski 2009, Razowski expanse about 12 mm. Forewing ground color auburn brown with darker chestnut-brown markings and scattered white scales near middle. Cream and Pelz 2010), 13 of which were newly described and colored subapical streak with orange scales basad and curved silvery preapical illustrated in the aforementioned revision along with accounts and subapical fascia. Hindwing orange with small black to chestnut brown of other species including the type species M. hubneriana (Stoll, patches along margin and posterior half of wing. Silvery scale patches along 1791). Species previously described by Meyrick are illustrated anal margin and a patch of scattered white scales in cubital area within dark posterior half of wing. Fringe with elongate gray to buff outer scales and shorter by Clarke (1969). spatulate basal scales concolorous with adjacent wing pattern. Forewing venter Field work conducted in June and November 2009 at auburn brown to orange, yellowish toward base, with cream apical streak and Pico Bonito Lodge (PBL), and CURLA (Centro Universitario three distinct partial dark brown fascia extending from costa. Hindwing ventral Regional del Litoral Atlantico) Reserve, Parque Nacional surface as on forewing but markings consisting of diffuse chestnut brown patches along outer margin. Pico Bonito, La Ceiba, Honduras, as part of a cooperative Male genitalia. The Cuban holotype as figured and described by Razowski comprehensive lepidopteran biodiversity survey with Escuela (2009) shows slender tapered and terminally acute socii and valvae somewhat Agricultura Panamerica en Zamorano, CURLA, PBL, and proportionally wider at the base than near middle. The socii are acute in the McGuire Center for Lepidoptera and Biodiversity, Florida the Honduras specimen (Fig. 2a), but project outward from the focal plane of the image due to the orientation of the genitalia on the slide. Likewise, Museum of Natural History, resulted in the collection of two slight differences in the shape of the valvae at the base appear within variation adult specimens of Mictopsichia cubae Razowski, 2009. The expected with the different orientation of the preparation. In the Honduran specimens are the first records of this species for the country and specimen, the valvae appear to be of more uniform width. The aedeagus of the two of four specimens known for the species. Both specimens Honduras specimen (Fig. 2b) is oriented with the vesica extended so that the characteristic spatulate plate-like cornutus is laterally oriented with the minute were collected during the day while searching for larvae, dentate process dorsal, as opposed to ventral in the Holotype slide. A second butterflies, and diurnal moths. The present note documents the Cuban specimen [ZIL] was dissected and matches both the Honduras male two new locality records and describes the previously unknown and the Holotype, especially the spatulate cornutus and dentate process of the female genitalia. aedeagus, as well as the shape of the valvae, transtilla, and socii. The uniform width of the stout aedeagus, together with the shape of the cornutus, and overall Institutional and locality acronyms used in the text are as shape of the valvae, socii, and saccus differentiate M. cubae from its congeners. follows: Other notable characters of this species include a broad, undifferentiated BMNH – Natural History Museum, London; CURLA – Centro submedian belt (Razowski 2009) and reduced submedian rib on the valvae and Universitario Regional del Litoral Atlantico, Honduras; EAPZ a distinct transtilla with a broad rectangular margin medially. Female genitalia (Fig. 2c,d). Papillae anales petaloid, narrowed anteriad – Escuela Agricultura Panamerica en Zamorano, Honduras; of connection with posterior apophysis, with dense arrangement of setae on FLMNH – Florida Museum of Natural History, Gainesville, ventral surface. Anterior and posterior apophyses similar in length. Anterior Florida; MGCL – McGuire Center for Lepidoptera and apophyses with short laterally projecting thumb-like appendage about 0.17 Biodiversity; PBL – Pico Bonito Lodge, La Ceiba, Honduras; from base and transversely aligned with sterigma. Sterigma elongate with moderately sclerotized band. Ostium slightly excavate. Antrum rectangular, USDA – United States Department of Agriculture; USNM – slighty longer than wide, anterior with transverse sclerite. Ductus bursae long National Museum of Natural History, Washington, DC; ZIL – and narrow, constricted near inception of ductus seminalis at about 0.1 distance Zoologial Institute, Academy of Sciences of Cuba, Havana. from antrum. Corpus bursae ovate, with falciform signum. Anterior margin of 44 TROP. LEPID. RES., 21(1): 43-45, 2011 MATTHEWS ET AL.: New tortricid record from Honduras and markings of the adults, combined with the erratic jumping behavior when evading capture as observed in M. cubae, are suggestive of jumping spider mimicry which has been observed in other Lepidoptera (Rota and Wagner 2006). Adult behavior and potential predator evasion tactics in this group merit future study. Likewise, the early stages and larval habits of these small moths are in need of investigation. Thus far, our only life history data for the group comes from a series of four USNM Venezuelan specimens identified as Mictopsichia gemmisparsana (Walker) which were reared from grape (Vitaceae). Label data from these specimens are “Ex. Vitis vinifera / El Valle, Venez. / 13-March-1943 / Lot 43-20941 / C. H. Ballou BBK” same data 24 March 1943, 2 April 1943, and 7 April 1943. There are a number of lepidopteran taxa shared at the generic and specific level between the West Indies and other areas in the Caribbean Basin. Brown and Razowski have been actively working on the Tortricidae throughout this area, and the discovery of M. cubae including a female is of major interest. Whether the current distribution can be attributed to simple dispersal, hurricane activity, human transport, or is of a more ancient origin remains to be determined. Relatively few species of Tortricidae have been encountered thus far (<18 species) in our night sampling with mercury vapor Fig.1. Female Mictopsichia cubae collected at CURLA reserve, Parque Nacional Pico Bonito. Dorsal view (above), ventral view (below). lamps at Pico Bonito Lodge (June and November, 2009, May and August, 2010), especially considering the world fauna of more than 9,757 species (Baixeras et al. 2010, Brown 2005). We anticipate additional finds as surveys continue, including more specimens and observations of Mictopsichia and related signum serrate. Signum base extended longitudinally on bursa as curved double genera. line of scobinations covering central 0.6 of bursa. Ductus seminals bursalike, posterior half gradually expanded toward ovate distal portion; with narrow ACKNOWLEDGMENTS tubular extension arising from midpoint. Rounded part of ductus seminalis with microscopic spiculations more pronounced than in corpus bursae. Life history and habits. Other than the diurnal habits of these moths the We are indebted to Sebastian Tarcz, Institute of Systematics biology and early stages are unknown. The two adults from Honduras were and Evolution of Animals, Polish Academy of Sciences, for collected during the day on low vegetation. The male was observed jumping providing sequencing data. John B. Heppner (MGCL) kindly erratically on the surface of leaves and nearly eluded capture in a vial. Distribution and Phenology. Adults have been collected in February and permitted examination and dissection of ZIL loan material September in Cuba and in June and November in Honduras. The genus under his care. We thank Delano S. Lewis (MGCL), John W. Mictopsichia ranges from Mexico to Brazil (Razowski 2009). Brown (USDA), Todd Gilligan, and anonymous reviewers DNA barcode. A 606bp fragment of Mitochondrial Cytochrome Oxidase for their helpful comments. James Adams (PBL) graciously Subunit 1 (CO1) was obtained from one isolate of legs of the Honduras male specimen, with PCR and sequencing using the forward and reverse provided logistic support for field studies. Richard Lehman, primers, LEP-F1, 5’-ATTCAACCAATCATAAAGATAT-3’; and LEP-R1, Museo de Mariposas, La Ceiba, Honduras, and Matt Lehnert 5’-TAAACTTCTGGATGTCCAAAAA-3’ (Hebert et al. 2004). This sequence (MGCL) and Christian Salcedo (MGCL) assisted in the has been deposited in the GenBank database and is provided in the appendix. field. We also thank Juan Alberto Hernández and Kelvin W. Because of the age of the specimen, the Holotype (BMNH) is unlikely to provide adequate sequence data for comparison and confirmation of the present Bodden (CURLA) for continuing access to the CURLA reserve determination based on morphological characters. at Parque National Pico Bonito and Oliver Schlein, Centro Zamorano de Biodiversidad (EAPZ) access to collections and DISCUSSION assistance in obtaining collecting permits. The first author thanks Todd Gilligan, Colorado State University and John W. Despite the striking coloration of Mictopsichia and related Brown, for direction to references for initial determination of genera, the group is poorly represented in most collections, specimens examined. Genitalia slides were photographed with and much remains to be discovered regarding the behavior, the kind assistance of David Reed, FLMNH using an imaging life histories, and biogeographic distribution patterns of the system assembled by Roy Larimer, Visionary Digital, with a group. In resting posture, the bright orange portion of the Canon 40D camera equipped with a K2 infinity lens and 5× hindwing is mostly concealed beneath the forewing. This and 10× Nikon objective lenses, and funded by NSF grant feature, together with the metallic coloration and “eye-spots” DEB 0845392. Finally, we gratefully acknowledge Thomas C. as seen in certain species such as M. jamaicana Razowski, Emmel for support of travel and field work leading to this and 2009, suggest a possible startle display. The bright coloration other publications. MATTHEWS ET AL.: New tortricid record from Honduras MATTHEWS ET AL.: New tortricid record from Honduras TROP. LEPID. RES., 21(1): 43-45, 2011 45 Fig. 2. Genitalia of Mictopsichia cubae: a) male, with aedeagus removed, slide DM 1556; b) same individual, aedeagus; c) female genitalia, slide DM 1569; d) enlargement showing detail of signum. REFERENCES CITED Razowski, J. and V. Pelz. 2010. Mictopsichia HÜBNER (Lepidoptera: Tortricidae) from Ecuador. Baixeras, J., J. W. Brown and T. M. Gilligan Polskie Pismo Entomologiczne 79: 319–326. 2010. T@RTS: Online World Catalogue of the Tortricidae (Version 1.4.0). Razowski, J. and J. Wojtusiak. http://www.tortricidae.com/catalogue.asp. 2008. Some teleochromatic Tortricidae from Western South America Brown, J. W. (Lepidoptera: Tortricidae). SHILAP Revista de Lepidopterologia 2005. Tortricidae (Lepidoptera) In: World Catalogue of Insects, 5, Apollo 36(142): 209-218. Books, Stenstrup: 1–741. Rota, J. and D. L. Wagner. Clarke, J. F. G. 2006. Predator Mimicry: Metalmark Moths Mimic Their Jumping Spider 1969. Catalogue of the Type Specimens of Microlepidoptera in the British Predators. PLoS ONE 1(1): e45. doi:10.1371/journal.pone.0000045. Museum (Natural History) described by Edward Meyrick. Volume VI. Trustees of the British Museum (Natural History) London. 537 pp. APPENDIX Hebert P. D., E. H. Penton, J. M. Burns, D. H. Janzen, and W. Hallwachs GCAGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGTGCTGAATTAGGTTCACCAG- 2004. Ten species in one: DNA barcoding reveals cryptic species in the GATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATA- neotropical skipper butterfly Astraptes fulgerator. Proc. Natl. Acad. ATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGTAATTGATTAATCCCTTTA- Sci. U.S.A. 101: 14812–14817. ATATTAGGTGCACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTAC- CACCTTCTATTATACTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGA- Razowski, J. TGAACAGTATACCCCCCACTTTCATCTAATATTGCTCATAGTGGAAGATCTGTAGATTTAGC- 2009. Revision of Mictopsichia HÜBNER with descriptions of new TATTTTTTCTTTACATTTAGCTGGTATTTCCTCAATTCTAGGAGCAGTAAATTTTATTACTA- species and two new genera (Lepidoptera: Tortricidae). Polskie CAATCATTAATATACGACCCAATAATATATCATTAGATCAAATACCCCTTTTTGTATGAG- CAGTTGGAATTACAGCTTTATTATTATTATTATCTTTACCAGTATTAGCAGGAGCTATTAC- Pismo Entomologiczne 78: 223–252. TATATTATTAACTGATCGAAATCTTAATACATCATTTTTCGATCCTGCGGGAGGAGGAGAT

See more

The list of books you might like