Logout succeed
Logout succeed. See you again!

Six new cryptic species of Xylodonta Becker, 2014 (Notodontidae: Nystaleinae) from Costa Rica PDF
Preview Six new cryptic species of Xylodonta Becker, 2014 (Notodontidae: Nystaleinae) from Costa Rica
CHACÓN ET AL.: New cryptic species of Xylodonta TROP. LEPID. RES., 27(1): 33-58, 2017 33 Six new cryptic species of Xylodonta Becker, 2014 (Notodontidae: Nystaleinae) from Costa Rica Isidro A. Chacón1*, Daniel H. Janzen2, Winnie Hallwachs2, Tanya Dapkey2, Donald J. Harvey3, Nick V. Grishin4 1. Museo Nacional de Costa Rica (MNCR), San José, Costa Rica, Apdo. 749-1000 [email protected] 2. Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA; [email protected], [email protected], [email protected] 3. Smithsonian Institution, National Museum of Natural History, Department of Entomology, Washington, DC 20560-7012, USA; [email protected] 4. Howard Hughes Medical Institute and Departments of Biophysics and Biochemistry, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX, USA 75390-9050; [email protected] *corresponding author: [email protected] Abstract: The genus Xylodonta Becker (Notodontidae, Nystaleinae) is reviewed for Costa Rica based on 1,571 reared and wild- collected specimens. Eleven species are recorded, of which six are newly described: Xylodonta markvanputteni Chacón, Xylodonta patrickgoodwilliei Chacón, Xylodonta scottmilleri Chacón, Xylodonta andrewrusselli Chacón, Xylodonta robertodelgadoi Chacón, and Xylodonta billhaberi Chacón. Xylodonta terrena (Schaus, 1892) and Xylodonta xylinata (Walker, 1865) are redescribed and Xylodonta angustipennis (Schaus, 1911), Xylodonta rufitincta (Dyar, 1913), and Xylodonta guarana (Schaus, 1892) are discussed. Adults and genitalia are illustrated. Species are described and diagnosed through their distinctive COI barcodes, genital morphology and life histories. Xylodonta adults and caterpillars, and their foodplants in Área de Conservación Guanacaste (ACG) in northwestern Costa Rica, are reviewed. Larvae of four species are illustrated. Keywords: DNA barcoding, cryptic species, Área de Conservación Guanacaste, rain forest, tropical dry forest, tropical cloud forest, Museo Nacional de Costa Rica Resumen: El género Xylodonta Becker (Notodontidae, Nystaleinae) se revisa para Costa Rica, con base en 1.571 especímenes criados y recolectados en el medio silvestre. Se registran once especies, de las cuales seis son descritas como nuevas: Xylodonta markvanputteni Chacón, Xylodonta patrickgoodwilliei Chacón, Xylodonta scottmilleri Chacón, Xylodonta andrewrusselli Chacón, Xylodonta robertodelgadoi Chacón y Xylodonta billhaberi Chacón. Se redescriben Xylodonta terrena (Schaus, 1892) y Xylodonta xylinata (Walker, 1865). Se discute acerca de Xylodonta angustipennis (Schaus, 1911), Xylodonta rufitincta (Dyar, 1913) y Xylodonta guarana (Schaus, 1892). Se ilustran los adultos y los genitales de todas las especies. La mayoría de las especies se describen a través de sus códigos de barras COI, genitales e historia natural. Los adultos, orugas y plantas hospederas de Xylodonta en el Área de Conservación Guanacaste (ACG) en el noroeste de Costa Rica, se revisan. Se ilustran las larvas de cuatro especies. Palabras clave: Código de barras de ADN, especies crípticas, Área de Conservación Guanacaste, bosque lluvioso, bosque seco, bosque nuboso, Museo Nacional de Costa Rica INTRODUCTION barcodes, and in the case of the four species whose caterpillars have been found in the wild, by their relatively different food The genus Xylodonta Becker previously contained 11 plants as well. described species of medium-sized, brownish gray moths that occur from Mexico to Argentina (Becker, 2014). The type MATERIALS AND METHODS species, Nystalea xylinata (Walker, 1865), was described from Bogotá, Colombia. Here, we treat the single previously recorded A total of 1,571 specimens were examined for this study: Costa Rican Xylodonta species, X. terrena (formerly known as 624 were reared from wild-caught caterpillars in Área de Dasylophia maxtla Schaus), as well as X. xylinata (Walker, Conservación Guanacaste (ACG) in northwestern Costa Rica 1865), X. angustipennis (Schaus, 1911), X. rufitincta (Dyar, (Janzen et al., 2009); 131 were collected by the ACG BioLep 1913), X. guarana (Schaus, 1892) and the six undescribed ones project using light traps; and 816 are in the Lepidoptera that until now were hidden under the name D. maxtla. Xylodonta collection of Costa Rica’s Museo Nacional (formerly that of terrena has also sometimes been misidentified as Dasylophia INBio) and were collected with light traps. Of these 1,571 xylinata in collections. As will be seen in our illustrations, all specimens, 519 have been barcoded and can be reviewed six new species can be easily distinguished from X. terrena by in the Barcode of Life Data System (BOLD; http://dx.doi. the morphology of their male genitalia, as well as by their DNA org/10.5883/DS-ASDASY). A total of 58 specimens were 34 TROP. LEPID. RES., 27(1): 33-58, 2017 CHACÓN ET AL.: New cryptic species of Xylodonta dissected for comparison of genital morphology: 34 males and than in males; lashed eye, smooth, round; palpi upcurved to 24 females. It was also necessary to barcode the type specimens medial area of frons, 2nd segment 2 × first segment in length, of Oedemasia terrena, Oedemasia maxtla, Notodonta dares 3rd segment small and slightly decumbent; scaling appressed, and Notodonta pythia to test whether the barcodes of any of haustellum present, 13-14 mm long, ocelli present. Patagia the putatively new species matched them. None of the six new covered with long scales, thoracic scaling not tightly appressed, species described here have a DNA barcode matching that of with moderately long scales, without tufts, concolorous these types (Grishin, unpubl.), while the barcode of the Schaus with forewing; abdominal scaling appressed, without tufts, holotype of Oedemasia terrena in the National Museum of concolorous with hind wing. In fresh specimens, the brown and Natural History, Washington, D.C., USA (USNM) is identical black pattern is overlaid with light greens and pinks that give to material treated here as Xylodonta terrena. the forewing a lichen- and moss-covered appearance. Forewing It is important to mention that no barcode was obtained from elongate, narrow, with a ‘woody’ pattern. Male terminal tergite the type specimens of Dasylophia angustipennis, Dasylophia distinctive (Figs 7, 17, 27, 37, 46, 55, 64, 75, 84, 92, 98, 105). rufitincta and Oedemasia guarana, because the USNM did not Male genitalia: Uncus acute or rounded, sometimes divided; approve such procedures. Nevertheless a comparison of genital socii small, sclerotized, globular, pubescent, rarely thin and morphology was performed between the types of Dasylophia elongated; valvae often asymmetrical with costal margin angustipennis, Dasylophia rufitincta and our barcoded and sclerotized, sometimes with projections, saccular margin dissected Xylodonta specimens, in order to confirm similarities smooth, toothed or with protuberances; phallus well developed, or differences. sclerotized, usually extending to uncus and narrowing distally; Genitalia comparison was not possible for the type of often with distinct lateral and dorsolateral processes; ST8 Dasylophia guarana as there are no genitalia available, but in diagnostic, bifurcate, often asymmetrical with serrate or dentate August of 2008, Jim Miller identified the voucher specimen 87- margins. SRNP-1251 as D. guarana, based on wing pattern comparisons Female genitalia: ST8 sclerotized, with lateral margins slightly with the type specimen of O. guarana deposited in the USNM. toothed; ductus bursae compressed or short; corpus bursae This voucher specimen was then used to identified X. guarana elongate and globular, surface wrinkled, signa present; papillae from Costa Rica. anales ovoid with multiple setae, apophysis anterior shorter We were unable to sequence or dissect the X. xylinata than posterior. The sclerotized ST8 is the principal diagnostic male holotype from Bogotá, deposited at the Natural History character of the genus (Figs 9, 19, 29, 39, 48, 57, 66, 77, 86). Museum, London, UK (BMNH). Nevertheless, Nick Grishin Etymology: The generic name is derived from the Greek words barcoded the holotype of Notodonta pythia (Druce, 1895), in “xylon”, meaning wood, and “odontos”, meaning tooth (as in the BMNH, which according to Becker (2014) is a synonym of Notodonta), and it is treated as feminine. X. xylinata. The barcode of N. pythia is similar to the barcodes Larvae: Brightly colored, feeding on Fabaceae. Head surface of all specimens we identify as X. xylinata from Costa Rica. rugose; head taller than thoracic segment 1; anal prolegs small, The holotypes of the new species have been deposited in tubular in shape, crochets present; segment A8 with a dorsal the collection of the Museo Nacional de Costa Rica (MNCR), protuberance. and paratypes have been distributed between the MNCR, the Remarks: The species belonging to this genus resemble those Muséum national d’Histoire naturelle, Paris (MNHN), the Paul in Dasylophia Packard, in which they were formerly placed. Thiaucourt collection, and the USNM. The following abbreviations are used for morphological Species accounts terms: AD: Adterminal line; CB: Corpus bursae; DB: Ductus bursae; FW: Forewing; HW: Hind wing; M: Medial line; PM: Xylodonta terrena (Schaus, 1892) Postmedial line; ST8: Sternum 8; STL: Subterminal line; T8: (Figs 1-10; Figs 108-111) Tergum 8; TL: Terminal line; FWL: Forewing length. Synonyms: Oedemasia maxtla Schaus, 1892; Notodonta dares Druce, 1894. Original description (Schaus, 1892): SYSTEMATICS “Female: Primaries fawn-colored, shaded with dark brown, darkest along the inner margin; a cluster of black scales below the middle of the median vein; Xylodonta Becker halfway between this spot and the outer margin another similar spot resting on the portion of a very indistinct, outwardly curved, and wavy pale line, which Xylodonta Becker, 2014, Checklist of New World Notodontidae (Lepidoptera: reaches from the costal to the inner margin; the outer margin with the veins Noctuoidea). Lepidoptera Novae 7: 1-40. dark, finely edged with buff; a series of oblique pale lines between the veins; a large pale space at the base of the primaries. Secondaries dark brownish grey. Centre of thorax and abdomen very dark cinereous. Thorax laterally and head Type-species: Nystalea xylinata Walker, 1865, List of the Specimens of light fawn-colored. Expanse 50 mm. Hab. Coatepec, Mexico.” Lepidopterous Insects in the Collection of the British Museum. Supp. 33: 759- Redescription: MALE (Figs 1, 2): FWL 19-23 mm. Head: Antenna light 760. brown, antennal shaft beige dorsally and brown ventrally; scape bearing a long Type specimens: Unspecified number of syntypes [BMNH], London. beige tuft, cream and light-brown scales; eyes dark gold; frons mostly light brown with dark brown scales intermixed; labial palpus porrect, light brown Diagnosis: Adults – Medium-sized notodontid moths, FWL ventrally, dark brown dorsally; vertex dark brown. Thorax: Tegula cream at 16-27 mm, females larger than males; male antenna bipectinate base, a mix of light and dark brown scales distally; patagium dirty brown; mesoscutellum dirty brown; thoracic pleuron light brown to dirty brown; in basal 2/3, distal 1/3 simple, scape bearing a long tuft; female metathoracic dorsum with dirty brown hair-like scales. Legs: Mostly dirty antenna bipectinate halfway, rami shorter and less dense brown and beige with black scales between segments. Abdomen: Dorsum CHACÓN ET AL.: New cryptic species of Xylodonta TROP. LEPID. RES., 27(1): 33-58, 2017 35 Figs 1-4. Xylodonta terrena: 1, 2 male dorsal and ventral (97-SRNP-761) forewing length 21.13 mm; 3, 4 female dorsal and ventral (07-SRNP- 58051) forewing length 25.88 mm. Figs 5-10. Xylodonta terrena: 5, 6 male genitalia 4.3 mm length, 7 male ST8 5.2 mm length, 8 phallus 4 mm length (88-SRNP-514); 9, 10 female genitalia (95-SRNP-879) 5.5mm length. 36 TROP. LEPID. RES., 27(1): 33-58, 2017 CHACÓN ET AL.: New cryptic species of Xylodonta dirty brown, venter light brown with a dark brown line in the middle. Wings: (n=43), Platymiscium parviflorum Benth. (n=1), Pterocarpus Dorsal FW ground color beige with black scales covering veins, a dark basal officinalis L. (n=2), Pterocarpus rohrii Vahl (n=1). dash, with a black orbicular spot; M dark brown, from inner margin to costal Remarks: This is the Xylodonta species most frequently margin, S-shaped, PM irregular beige, STL formed by triangular dark brown marks, TL black, fringe dirty and light brown, dorsal HW dark brown; fringe encountered in light traps in Costa Rica. Caterpillars (Figs 108- light brown and dark brown. Male genitalia (Figs 5-8): T8 (Fig. 7) rectangular, 111) are frequently found feeding on Lonchocarpus oliganthus longer than wide, posterior margin sclerotized, with a small invagination in growing in the rain forest understory at intermediate elevations. center; ST8 (Fig. 7) dark-brown, sclerotized with serrate margins, V-shaped Genbank Accession: GU159561 with two denticulate rounded projections, projections asymmetrical, right one shorter with a heavily sclerotized tooth at inner basal margin, antecostal DNA barcode of male 97-SRNP-761. apodemes long, thin and symmetrical, internal ridges present. Valvae slightly MHANC422-06 |97-SRNP-761| Xylodonta terrena (D. asymmetrical and curved, apices rounded and flattened, saccular margin maxtlaDHJ06) |COI-5P slerotized, slightly jagged, costal margin sclerotized, juxta sclerotized with two asymmetrical projections, the left one longer with irregular apical margin; NNAACTTTATATTTTATTTTTGGAATTTGAGCCGGTATATTAGGTACTTCAT uncus short, apex acute and curved, with a short acute dorsal projection (Figs 5, TAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATCATTAATTGGAGA 6); proximal part of phallus tube thin and membranous, distal part sclerotized TGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTT and robust, vesica with three spinose patches (Fig. 8). TTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCTT FEMALE (Figs 3, 4): Similar to male but larger (FWL 24-27 mm). Female TAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATT genitalia (Figs 9, 10): ST8 with a dark ovoid sclerotized plate; ductus bursae TTGGTTACTCCCACCATCATTAACATTATTAATTTCAAGAAGCATTGTAGAA AATGGAGCAGGAACAGGTTGAACAGTATACCCCCCACTATCCTCAAATATTG compressed; corpus bursae elongate and globular, surface wrinkled, signum CTCATAGAGGAAGCTCAGTTGATTTAGCTATTTTTTCCTTACATTTAGCAGG hemispherical with sclerotized margins; papillae anales ovoid, densely setose, AATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATA apophysis anterior shorter than apophysis posterior. CGTTTAAATGGAATATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAG GAATTACAGCATTTTTACTTCTTCTTTCTCTACCTGTTTTAGCAGGAGCTAT Specimens examined: 141 specimens (100 males, 41 females). Data for TACAATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCAGCT specimens examined with barcodes and morphology matching those of the GGAGGAGGAGATCCAATTTTATATCAACATTTATTT type specimen of Xylodonta terrena, and for other specimens examined but not barcoded, are listed in Supplementary Information (Chacón et al., 2017). Xylodonta markvanputteni Chacón, new species (Figs 11-20; Figs 112-116) Diagnosis: ST8 dark-brown, sclerotized with dentate margins, V-shaped with two asymmetrical, rounded projections, right Description: MALE (Figs 11, 12): FWL 20-22 mm. Head: Antenna dark projection shorter with a heavily sclerotized tooth at base of brown, antennal shaft dorsally beige and ventrally brown; scape bearing margin, antecostal apodemes long, thin and symmetrical, long tuft of beige, cream and red-brown scales; eyes dark gold; frons mostly light brown with red brown intermixed scales; labial palpus porrect, light internal ridges present on inner margin (Fig. 7); uncus short brown ventrally, beige dorsally; vertex beige. Thorax: Tegula dirty brown at with acute and curved bifurcated apex, and a short, acute dorsal base, a mix of cream and dark brown scales distally; patagium dirty brown; projection (Figs 5, 6); proximal part of phallus tube thin and mesoscutellum beige and dirty brown; thoracic pleuron beige to dirty brown; membranous, distal part sclerotized and robust, vesica with dorsal area of metathorax with dirty brown hair-like scales. Legs: Mostly dirty brown and beige with black scales between segments. Abdomen: Dorsum three spinose patches (Fig. 8). dirty brown, venter beige with a dark brown line at midline. Wings: Dorsal Distribution: In Costa Rica, Xylodonta terrena has been FW ground color beige with black scales covering veins, a dark basal dash, collected on the eastern slope of Cordillera Volcánica de orbicular spot black; M beige colored, S-shaped from inner margin to costal Guanacaste, Cordillera de Tilarán, Cordillera Volcánica Central margin, PM irregular, light brown, STL formed by triangular dark brown marks, TL black, fringe dirty brown, dorsal HW dark brown; fringe light and Cordillera de Talamanca, from 280 to 2600 m elevation brown (Figs 11, 12). Male genitalia (Figs 15-18): T8 trapezoidal, posterior (Fig. 129). The type specimens are from Coatepec, Mexico margin with two slightly asymmetrical lobes, sclerotized; ST8 with antecostal (1192 m). It should be emphasized that a given numerical apodemes long, robust and symmetrical anterior margin, internal ridges present, elevation in one place, for example western Mexico, is not two dark, robust projections on posterior margin, asymmetrical, heavily sclerotized, with prominent teeth laterally, teeth smaller on inner margin (Fig. biologically equivalent to that same numerical elevation in a 17); valvae asymmetrical, sclerotized and setose, left valve wide, with costal Costa Rican rain forest. Furthermore, elevation is not generally margin sclerotized, saccular margin membranous and setose, apex wide and available for older specimens and species identifications cannot sclerotized. Saccular margin of right valve membranous, finely pubescent at be assumed from the name applied in collections. Therefore, base, sclerotized, setose and elongate towards apex, costal margin sclerotized; uncus hook-shaped, sclerotized, setose ventrally, socii comprising two small elevation should not be viewed as a diagnostic characteristic. setose protuberances (Figs 15, 16); proximal part of phallus tube slender, The true distribution of X. terrena is thus impossible to evaluate rounded at base, distal part of phallus tube robust, slightly sclerotized with a given our current state of knowledge; to sort through the dorsal projection, vesica bulbous with two spiny patches (Fig. 18). massive confusion about its identity would require barcoding FEMALE: Similar to male but larger, dorsal FW ground color mostly beige (Figs 13, 14). FWL 24-25 mm. Female genitalia (Figs 19, 20) – ST8 completely and dissecting specimens from other countries throughout its sclerotized, lateral margins with small black sclerotized bumps, postvaginal supposed range, a task beyond the scope of our work. plate heavily sclerotized, four short spine-like lateral processes on distal Natural history (Figs 108-111): 62 rearing records: ACG margin, ductus bursae extremely short, corpus bursae elongate, rounded with locations: Sector Cacao (n=34), Sector Del Oro (n=3), Sector multiple folds in membrane, signum boat-shaped, sclerotized, elongated, acute at ends. Papillae anales ovoid, densely setose, anterior apophysis sclerotized, Mundo Nuevo (n=8), Sector Pitilla (n=2), Sector San Cristóbal longer than posterior apophysis. (n=15). Food plants: Exclusively Fabaceae; Dioclea malacocarpa Etymology: Xylodonta markvanputteni is named in honor of Ducke (n=2), Erythrina costaricensis Micheli (n=3), Mark Van Putten of Grand Rapids, Michigan in recognition Erythrina lanceolata Standl. (n=2), Lennea viridiflora Seem. of his many years of outstanding support for the Guanacaste (n=2), Lonchocarpus felipei Zamora (n=2), Lonchocarpus Dry Forest Conservation Fund and Área de Conservación macrophyllus Kunth (n=2), Lonchocarpus oliganthus F.J. Herm. Guanacaste. CHACÓN ET AL.: New cryptic species of Xylodonta TROP. LEPID. RES., 27(1): 33-58, 2017 37 Figs 11-14. Xylodonta markvanputteni: 11, 12 Holotype male dorsal and ventral (09-SRNP-31078) forewing length 21.35 mm; 13, 14 Paratype female dorsal and ventral (08-SRNP-4651) forewing length 24.53 mm. Figs 15-20. Xylodonta markvanputteni: 15, 16 Holotype male genitalia (08-SRNP-1546) 5.9 mm length, 17 male ST8 4.5 mm length, 18 phallus 3.5 mm length, 19, 20 Paratype female genitalia (08-SRNP-4651) 6.00 mm length. 38 TROP. LEPID. RES., 27(1): 33-58, 2017 CHACÓN ET AL.: New cryptic species of Xylodonta Specimens examined: 98 specimens (58 males, 40 females). Xylodonta patrickgoodwilliei Chacón new species Type specimens: HOLOTYPE MALE: 09-SRNP-31078 (COI Barcoded), (Figs 21-30; Figs 117-122) Costa Rica, Área de Conservación Guanacaste, Prov. Guanacaste, Sector Pitilla, Sendero Bernales 10.98350 -85.42117, 660 m, 30 April 2009, Petrona Description: MALE (Figs 21, 22, 25-28): FWL 16-20 mm. Head: Antenna dark Ríos (USNM). brown, antennal shaft cream dorsally and light brown ventrally; scape bearing a PARATYPES: 53 males, 39 females. Data for paratypes and other specimens long tuft of beige, cream scales; eyes dark gold; frons mostly light brown; labial examined are listed in Supplementary Information (Chacón et al., 2017). palpus porrect, dirty brown ventrally and dorsally, beige laterally; vertex light brown. Thorax: Tegula dirty brown at base, a mix of cream and dark brown Diagnosis: ST8 heavily sclerotized, with two robust, slightly scales distally; patagium beige; mesoscutellum dirty brown; thoracic pleuron asymmetrical postero-lateral projections, projections coarsely beige; dorsal area of metathorax with dirty brown hair-like scales. Legs: dentate; valvae asymmetrical, sclerotized and setose, left Mostly dirty brown and beige with black scales between segments. Abdomen: Dorsum dirty brown, venter beige with a dark brown midline. Wings: Dorsal valve wide, with costal margin sclerotized, saccular margin FW ground color beige with black scales covering veins, a dark basal dash with membranous and setose, apex wide and sclerotized; saccular a black orbicular spot; PM cream colored, from inner margin to costal margin margin of right valve membranous and finely pubescent at with a question mark sign-shaped line, STL formed by triangular dark brown base, sclerotized, setose and elongate towards apex, costal marks, TL black, fringe dirty brown, dorsal HW dark brown; fringe light brown. Male genitalia (Figs 25-28): T8 rectangular, wider than long, posterior margin margin sclerotized; uncus hook-shaped and sclerotized, setose finely dentate and sclerotized, a central dome covered by a brush; ST8 posterior ventrally; proximal portion of phallus tube slender, rounded at margin sclerotized, dentate with a deep central depresssion and a projection base, distal portion of phallus tube robust, slightly sclerotized on each side, anterior margin with antecostal apodeme symmetrical, short and and acute posteriorly, with a bulbous spiny patch. thin, slightly curved, internal ridges present (Fig. 27); valvae symmetrical, saccular margin membranous and setose, costal margin sclerotized, apices Distribution: Xylodonta markvanputteni has been collected strongly curved, flattened sclerotized, hook-like and acute; sclerotized uncus only in the rain forest of the Cordillera Volcánica de Guanacaste curved, trident-shaped, socii tiny, sclerotized, globular and setose (Figs 25, 26); and Cordillera Volcánica Central from 400 to 1325 m elevation proximal portion of phallus tube wide and robust, distal portion sclerotized, (Fig. 129). While feeding occasionally on other Fabaceae, it robust, curved, with a strongly sclerotized dorsal spatulate projection, apex thin, sharp and denticulate (Fig. 28). is the only species of Xylodonta whose caterpillars feed on FEMALE (Figs 23, 24): Similar to male but larger, basal dash absent, FWL 23- Swartzia simplex in the ACG rain forest understory. 25 mm. Female genitalia (Figs 29, 30): ST8 with a sclerotized triangular plate, Natural history (Figs 112-116): 93 rearing records: ACG lateral margins slightly toothed; ductus bursae dorsoventrally compressed; locations: Sector Cacao (n=16), Sector Del Oro (n=2), Sector corpus bursae globular, membrane with numerous folds, signa rectangular and slightly elongate; papillae anales slightly ovoid, with irregular borders and Pitilla (n=23), Sector San Cristóbal (n=51), Sector Santa María multiple setae, anterior apophyses sclerotized, longer than posterior apophyses. (n=2). Food plants: Exclusively Fabaceae: Erythrina lanceolata Etymology: Xylodonta patrickgoodwilliei is named in honor Standl. (n=1), Lonchocarpus guatemalensis Benth. (n=1), of Patrick Goodwillie of Chicago, Illinois in recognition of Lonchocarpus macrophyllus Kunth (n=1), Lonchocarpus his many years of outstanding support for the Guanacaste oliganthus F.J. Herm. (n=8), Ormosia panamensis Benth. Dry Forest Conservation Fund and Área de Conservación ex Seem. (n=2), Platymiscium parviflorum Benth. (n=1), Guanacaste. Pterocarpus officinalis Jacq. (n=10), Styphnolobium monteviridis M. Sousa & Rudd (n=2), Swartzia cubensis Specimens examined: 26 specimens (15 males, 11 females). (Britton & P. Wilson) Standl. (n=3), Swartzia simplex (Sw.) Type specimens: HOLOTYPE MALE 06-SRNP-4506 (COI Barcoded), Costa Spreng. (n=64). Rica, Prov. Guanacaste, Sector San Cristóbal, Río Areno 10.91407 -85.38174, 460 m, 8 July 2006, Gloria Sihezar (USNM). Remarks: PARATYPES: 15 males, 11 females. Males: 05-SRNP-2958 (COI Barcoded), Genbank Accession: GU651267 Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Río Areno 10.91407 DNA barcode of holotype male 09-SRNP-31078 -85.38174, 460 m, 15 June 2005, Yessenia Mendoza (MNCR). 06-SRNP-3023 MHMYC1056-09|09-SRNP-31078| Xylodonta markvanputteni (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Río Areno 10.91407 -85.38174, 460 m, 8 May 2006, Osvaldo Espinoza (USNM). (D. maxtlaDHJ04)|COI-5P 00-SRNP-11094 (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector San AACTTTATATTTTATTTTTGGAATTTGAGCCGGTATATTAGGTACTTCATTA Cristóbal, Río Blanco Abajo 10.90037 -85.37254, 500 m, 13 June 2000, AGACTATTAATTCGAGCTGAATTAGGAAACCCCGGATCATTAATTGGAGATG Carolina Cano (USNM). 00-SRNP-11096 (COI Barcoded), Costa Rica, Prov. ATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTT Guanacaste, Sector San Cristóbal, Río Blanco Abajo 10.90037 -85.37254, 500 TATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTCCCTCTT m, 14 June 2000, Carolina Cano (USNM). 00-SRNP-11319 (COI Barcoded), ATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTT Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Río Blanco Abajo 10.90037 GATTACTTCCCCCATCATTAACATTATTAATTTCAAGAAGTATTGTAGAAAA -85.37254, 500 m, 21 June 2000, Osvaldo Espinoza (USNM). 00-SRNP- TGGAGCAGGAACAGGTTGAACAGTGTACCCCCCACTATCTTCAAATATTGCC 11384 (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector San Cristóbal, CATAGAGGAAGCTCAGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAA Río Blanco Abajo 10.90037 -85.37254, 500 m, 3 July 2000, Freddy Quesada TTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACG (USNM). 01-SRNP-2232 (COI Barcoded), Costa Rica, Prov. Guanacaste, TTTAAATGGAATATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAGGA Sector San Cristóbal, Río Blanco Abajo 10.90037 -85.37254, 500 m, 16 July ATTACAGCATTTTTACTTCTTCTTTCTTTACCTGTTTTAGCAGGAGCTATTA 2001, Freddy Quesada (USNM). 03-SRNP-8252 (COI Barcoded), Costa CAATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGG Rica, Prov. Guanacaste, Sector San Cristóbal, Río Blanco Abajo 10.90037 AGGAGGAGATCCAATTTTATATCAACATTTATTT -85.37254, 500 m, 24 September 2003, Carolina Cano (USNM). 03-SRNP- 8253 (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Río Blanco Abajo 10.90037 -85.37254, 500 m, 27 September 2003, Carolina Cano (USNM). 00-SRNP-1899 (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Sendero Corredor 10.87868 -85.38963, 620 m, 12 July 2000, Gloria Sihezar (USNM). 06-SRNP-4504 (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Río Areno 10.91407 -85.38174, 460 m, 6 July 2006, Gloria Sihezar (USNM). 01-SRNP-2231 (COI Barcoded), Costa CHACÓN ET AL.: New cryptic species of Xylodonta TROP. LEPID. RES., 27(1): 33-58, 2017 39 Figs 21-24. Xylodonta patrickgoodwilliei: 21, 22 Paratype male dorsal and ventral (05-SRNP-2958) forewing length 19.02 mm; 23, 24 Paratype female dorsal and ventral (00-SRNP-11186) forewing length 23.42 mm. Figs 25-30. Xylodonta patrickgoodwilliei: 25, 26 Paratype male genitalia (06-SRNP-7666) 4.1 mm length, 27 male ST8 4.7 mm length, 28 phallus 2.6 mm length, 29, 30 Paratype female genitalia (00-SRNP-1186) 5.1 mm length. 40 TROP. LEPID. RES., 27(1): 33-58, 2017 CHACÓN ET AL.: New cryptic species of Xylodonta Rica, Prov. Guanacaste, Sector San Cristóbal, Río Blanco Abajo 10.90037 Genbank accession: JQ54278 -85.37254, 500 m, 16 July 2001, Freddy Quesada (USNM). 06-SRNP-7666 DNA barcode of male holotype 06-SRNP-4506. (COI Barcoded dissected), Costa Rica, Prov. Guanacaste, Sector San Cristóbal, MHMXD1252-06|06-SRNP-4506| Xylodonta Puente Palma 10.9163 -85.37869, 460 m, 19 September 2006, Anabelle Córdoba (USNM). 00-SRNP-12608 (COI Barcoded), Costa Rica, Prov. Guanacaste, patrickgoodwilliei (D. maxtlaDHJ05)|COI-5P Sector San Cristóbal, Río Blanco Abajo 10.90037 -85.37254, 500 m, 15 June AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATATTAGGTACTTCACTA 2000, Freddy Quesada (USNM). Females: 08-SRNP-6232 (COI Barcoded), AGATTATTAATTCGAGCTGAATTAGGAAATCCCGGATCATTAATTGGAGATG Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Puente Palma 10.9163 ATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTT -85.37869, 460 m, 23 November 2008, Carolina Cano (USNM). 01-SRNP- TATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCTTTA 3731 (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Río ATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTT Blanco Abajo 10.90037 -85.37254, 500 m, 27 October 2001, Freddy Quesada GATTACTCCCACCATCATTAACGTTATTAATTTCAAGAAGTATTGTAGAAAA (USNM). 01-SRNP-3732 (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector TGGAGCAGGAACAGGTTGAACAGTGTACCCCCCACTATCTTCAAATATTGCT San Cristóbal, Río Blanco Abajo 10.90037 -85.37254, 500 m, 26 October 2001, CATAGAGGAAGCTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAA Freddy Quesada (USNM). 06-SRNP-6338 (COI Barcoded), Costa Rica, Prov. TTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACG Guanacaste, Sector San Cristóbal, Río Blanco Abajo 10.90037 -85.37254, 500 TTTAAATGGAATATCCTTTGATCAAATACCCTTATTTGTATGAGCTGTAGGA m, 23 August 2006, Gloria Sihezar (USNM). 06-SRNP-9230 (COI Barcoded), ATTACAGCATTTTTACTTCTTCTTTCTTTACCTGTTTTAGCAGGAGCTATTA Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Sendero Perdido 10.8794 CAATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCTGG -85.38607, 620 m, 1 December 2006, Gloria Sihezar (USNM). 07-SRNP-2338 AGGAGGAGATCCAATCTTATATCAACATTTATTC (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Potrero Xylodonta scottmilleri Chacón new species Argentina 10.89021 -85.38803, 520 m, 21 June 2007, Osvaldo Espinoza (USNM). 03-SRNP-12592.1 (COI Barcoded), Costa Rica, Prov. Guanacaste, (Figs 31-39) Sector Rincón Rain Forest, Vado Río Francia 10.90093 -85.28915, 400 m, 2 October 2003, Minor Carmona (USNM). 06-SRNP-32372 (COI Barcoded), Description: MALE (Figs 31, 32): FWL 18-20 mm. Head: Antenna dark Costa Rica, Prov. Guanacaste, Sector Pitilla, Pasmompa 11.01926 -85.40997, brown, antennal shaft cream dorsally and light brown ventrally; scape bearing 440 m, 7 July 2006, Manuel Ríos (MNCR). 00-SRNP-11186 (dissected, COI a long dorsal tuft of beige-cream scales; eyes dark gold; frons mostly dirty Barcoded), Costa Rica, Prov. Guanacaste, Sector San Cristóbal, Sendero Palo brown; labial palpus porrect, cream ventrally and laterally, dark brown Alto 10.88186 -85.38221, 570 m, 13 June 2000, Freddy Quesada (MNCR). dorsally; vertex dirty brown. Thorax: Tegula dark brown at base, a mix of 06-SRNP-2556 (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector San cream and light brown scales distally; patagium dark brown; mesoscutellum Cristóbal, Río Blanco Abajo 10.90037 -85.37254, 500 m, 27 April 2006, light brown; thoracic pleuron beige; dorsal area of metathorax with light Carolina Cano (USNM). 00-SRNP-11095 (COI Barcoded), Costa Rica, Prov. brown, hair-like scales. Legs: Mostly dirty brown and beige, with black scales Guanacaste, Sector San Cristóbal, Río Blanco Abajo 10.90037 -85.37254, 500 between segments. Abdomen: Dorsum light brown, venter light brown with a m, 14 June 2000, Carolina Cano (USNM). dark brown midline. Wings: Dorsal FW ground color beige with black scales covering veins, a dark basal dash and a black orbicular spot; STL formed by Diagnosis: ST8 posterior margin sclerotized, dentate with a triangular dark brown marks, TL black, fringe dirty brown, dorsal HW cream with black scales covering veins; fringe light brown. Male genitalia (Figs 35- deep central depresssion and a projection on each side, anterior 38): T8 rectangular, wider than long; ST8 with posterior margin sclerotized, margin with antecostal apodeme symmetrical, short and finely serrate and setose, highly asymmetrical, right posterolateral angle with thin, slightly curved, internal ridges present (Fig. 27). Uncus a tiny process, left posterolateral angle bearing an extremely long, horn-like sclerotized, curved and trident-shaped, socii tiny, sclerotized, projection, anterior margin with short apodemes. It is important to clarify that the apodemes shown in the image are symmetrical, but the left apodeme was globular and setose (Figs 25, 26); proximal portion of phallus not extended in the slide preparation therefore in the photograph the apodemes tube wide and robust, distal portion sclerotized, robust, curved, seem asymmetrical (Fig. 37). Valvae asymmetrical, right valva with saccular with a strongly sclerotized, spatulate projection dorsally, apex margin sclerotized, rounded, a small projection near apex, left valva with thin, sharp and finely dentate (Fig. 28). saccular margin sclerotized, rounded, two heavily sclerotized, acute projections near apex, distal one larger; costal margin of valvae sclerotized and smooth; Distribution: Xylodonta patrickgoodwilliei has been reared juxta heavily sclerotized, inner margin irregular with a small spine-like only from intermediate elevations on the eastern side of projection; uncus wide, curved and laminated, with five, heavily sclerotized the Cordillera Volcánica de Guanacaste, from 400 to 570 m tooth-like processes at apex; socii comprising two small paddle-shaped, elevation (Fig. 129). None has been taken in light traps. sclerotized, setose projections (Figs 35, 36); proximal portion of phallus tube thin, distal portion sclerotized, thin and slightly curved; vesica with two spiny Natural history: (Figs 117-122) 42 rearing records: ACG patches (Fig. 38). locations: Sector Pitilla (n=3), Sector Rincón Rain Forest (n=2), FEMALE (Figs 33, 34): Similar to male but larger, without the basal dash, Sector San Cristóbal (n=38). FWL 23-25 mm. Female genitalia (Fig. 39): ST8 sclerotized, rectangular, Food plants: exclusively Fabaceae: Dioclea malacocarpa longer than wide; ductus bursae short and thin; corpus bursae globular, with numerous folds; signa elongate and triangular; papillae anales ovoid, with Ducke (n=39), Dioclea wilsonii Standl. (n=3). multiple setae. Remarks: To date, this is the only species of Xylodonta whose caterpillars have been found feeding on mature foliage of Etymology. Xylodonta scottmilleri is named in honor of Scott Dioclea; they have not been found on any other plant genus. Miller of Washington, D.C., in recognition of his many years of outstanding support for the Guanacaste Dry Forest Conservation Fund and Área de Conservación Guanacaste. Specimens examined: 38 specimens (23 males, 15 females). Type specimens: HOLOTYPE MALE: INB0004143801 (COI Barcoded), Costa Rica, Prov. Guanacaste, La Cruz, Bosque Nuevo 11.053652 -85.357650, 350 m, 15 April 2008, José Antonio Azofeifa (MNCR). PARATYPES: 12 males, 13 females. Males: 07-SRNP-111327 (COI Barcoded), CostaRica, Prov. Guanacaste, Sector Cacao, Estación Góngora 10.88449 -85.47306, 557 m, 12 September 2007, R. Franco & S. Ríos (MNCR). 07-SRNP-113292 (COI Barcoded), Costa Rica, Prov. Guanacaste, Sector Mundo Nuevo, La Perla (Tanque) 10.76760 -85.43243, 366 m, 9 December CHACÓN ET AL.: New cryptic species of Xylodonta TROP. LEPID. RES., 27(1): 33-58, 2017 41 Figs 31-34. Xylodonta scottmilleri: 31, 32 Paratype male dorsal and ventral (07-SRNP-113631) forewing length 19.04 mm; 33, 34 Paratype female dorsal and ventral (04-SRNP-4577) forewing length 22.76 mm. Figs 35-39. Xylodonta scottmilleri: 35, 36 Paratype male genitalia (07-SRNP-113631) 4.9 mm length, 37 male ST8 5.5 mm length, 38 phallus 4.6 mm length, 39 Paratype female genitalia (06-SRNP-105688) 7.2 mm length. 42 TROP. LEPID. RES., 27(1): 33-58, 2017 CHACÓN ET AL.: New cryptic species of Xylodonta 2007, S. Ríos & F. Quesada (MNCR). 07-SRNP-113298 (COI Barcoded), Puerto Viejo Sarapiquí 10.431958 -84.0091, 40 m, September 1986, M. M. CostaRica, Prov. Guanacaste, Sector Mundo Nuevo, La Perla (Tanque) Chavarría (MNCR). INB0003008945 Costa Rica, Prov. Heredia, La Selva Biol. 10.76760 -85.43243, 366 m, 9 December 2007, S. Ríos & F. Quesada (MNCR). Sta. Puerto Viejo Sarapiquí 10.431958 -84.0091, 40 m, October 1987, M. M. 07-SRNP-113631 (dissected, COI Barcoded), CostaRica, Prov. Guanacaste, Chavarría (MNCR). INB0003548569 Costa Rica, Prov. Guanacaste, Santa Rosa Sector Mundo Nuevo, La Perla (Tanque) 10.76760 -85.43243, 366 m, 10 National Park, 10.83641 -85.615491, 300 m, 18-24 July 1981, D.H. Janzen & December 2007, S. Ríos & F. Quesada (MNCR). INBIOCRI001706073 (COI W. Hallwachs (MNCR). INB0003548570 Costa Rica, Prov. Guanacaste, Est. Barcoded), Costa Rica, Prov. Alajuela, Los Chiles, Caño Negro 10.894 -84.789, Pitilla, 9 Km S. Santa Cecilia 10.992609 -85.429477, 700 m, November 1988. 20 m, 6 March 1993, José Antonio Azofeifa (MNCR). INBIOCRI000694702 Biodiversity Survey (MNCR). INB0003008944 Costa Rica, Prov. Guanacaste, (COI Barcoded), Costa Rica, Prov. Puntarenas, Golfito, Sirena 8.480171 Est. Pitilla, 8 Km S. Santa Cecilia, 10.992609 -85.429477, 700 m, 20 November -83.591289, 50 m, 1 November 1990, Juan Carlos Saborío (MNCR). 1987, D.H. Janzen & W. Hallwachs (MNCR). INBIOCRI000161755 INBIOCRI001839346 (COI Barcoded), Costa Rica, Prov. Limón, Talamanca, (dissected), Costa Rica, Puntarenas, Est. Sirena, Corcovado N. P. 8.480171 Amubri 9.519349 -82.956275, 70 m, 2 September 1993, Gerardina Gallardo -83.591289, 0 – 100 m, Februrary 1990. G. Fonseca (MNCR). (MNCR). INBIOCRI000694718 (COI Barcoded), Costa Rica, Prov. Puntarenas, Golfito, Sirena 8.480171 -83.591289, 50 m, 1 November 1990, Juan Carlos Diagnosis: ST8 with posterior margin sclerotized, finely serrate Saborío (MNCR). INBIOCRI001394246 (COI Barcoded), Costa Rica, Prov. and setose, highly asymmetrical, right posterolateral angle with Puntarenas, Aguirre, P. N. Manuel Antonio 9.38778056 -84.13280611, 80 m, 1 April 1992, Gerardo Varela (MNCR). INBIOCRI000950641 (COI Barcoded), a tiny process, left posterolateral angle bearing an extremely Costa Rica, Prov. Puntarenas, Aguirre, P. N. Manuel Antonio 9.38778056 long, horn-like projection, anterior margin with asymmetrical -84.13280611, 80 m, 1 July 1992, Gerardo Varela (MNCR). INB0004204307 antecostal apodeme short, wide at base, thin at apex, slightly (COI Barcoded), Costa Rica, Prov. Puntarenas, Buenos Aires, Alto Jalisco curved, internal ridges present (Fig. 37). Uncus wide, curved 8.995830 -83.455554, 950 m, 22 Februrary 2009, Elena Ulate (MNCR). INBIOCRI000707496 (COI Barcoded), Costa Rica, Prov. Puntarenas, and laminated, with five, heavily sclerotized tooth-like Garabito, Estación Quebrada Bonita 9.767452 -84.608118, 50 m, June 1992, processes at apex; socii comprising two small paddle-shaped, Juan Carlos Saborío (MNCR). INBIOCRI002024881 (COI barcoded), Costa sclerotized, setose projections (Figs 35, 36) Rica, Prov. Cartago, Turrialba, Monumento Nacional Guayabo 9.973978 Distribution: Xylodonta scottmilleri has been collected with -83.694935, 1000 m, 28 September-21 November 1994, Gilberto Fonseca (MNCR). Females: 04-SRNP-4577 (COI Barcoded), Costa Rica, Prov. light traps in the dry forest and rain forest on both slopes Guanacaste, Sector San Cristóbal, Puente Palma 10.9163 -85.37869, 460 of Cordillera Volcánica de Guanacaste and Cordillera de m, 10 September 2004, Yessenia Mendoza (USNM). 06-SRNP-105688 Talamanca, on the east slope of Cordillera Volcánica Central, (dissected, COI Barcoded), Costa Rica, Prov. Guanacaste, Sector Santa Elena, and in the Caribbean and Pacific lowlands, from 20 to 1000 m La Angostura 10.85592 -85.67017, 300 m, 24 July 2006, H. Cambronero & R. Franco (MNCR). INBIOCRI001985307 (COI Barcoded, dissected), Costa elevation (Fig. 129). Rica, Prov. Alajuela, Los Chiles, Caño Negro, Playuelas 10.955 -84.75, 20 Natural history: Rearing records: ACG locations: Sector San m, 12 September 1993, Kattia Martínez (MNCR). INBIOCRI002036101 Cristóbal (n=1), 04-SRNP-4577. (dissected, COI Barcoded), Costa Rica, Prov. Alajuela, Los Chiles, Caño Food plants: Exclusively Fabaceae: Gliricidia sepium (Jacq.) Negro, El Pueblo 10.894 -84.789, 20 m, 22 November 1993, Kattia Martínez (MNCR). INB0004137569 (COI Barcoded), Costa Rica, Prov. Puntarenas, Kunth ex Walp. Gliricidia sepium is an introduced plant at this Golfito, Estación el Tigre, Area Administrativa 8.546089 -83.397801, 47 m, rain forest site, so the native food plant of X. scottmilleri is 26 Februrary 2008, José Antonio Azofeifa (MNCR). INB0004137567 (COI unknown. The single larva of this species was not photographed. Barcoded), Costa Rica, Prov. Puntarenas, Golfito, Estación el Tigre, Area Remarks: Administrativa 8.546089 -83.397801, 47 m, 26 Februrary 2008, José Antonio Azofeifa (MNCR). INB0004222523 (COI barcoded), Costa Rica, Prov. Limón, Genbank Accession: KX676403 Limón, Veragua Rainforest 9.925729 -83.191405, 420 m, 19 July 2009, Ronald DNA barcode: male holotype INB0004143801 Villalobos (MNCR). INB0004222533 (COI barcoded), Costa Rica, Prov. ASARD9192-14|INB0004143801| Xylodonta scottmilleri (D. Limón, Limón, Veragua Rainforest 9.925729 -83.191405, 420 m, 19 July 2009, maxtlaDHJ07)|COI-5P Ronald Villalobos (MNCR). INB0004127738 (COI barcoded), Costa Rica, Prov. Puntarenas, Golfito, Estación el Tigre, Área Administrativa 8.546089 AACTTTATATTTTATTTTTGGAATTTGAGCCGGTATATTAGGTACTTCTTTA -83.397801, 47 m, 28 November 2007, José Antonio Azofeifa (MNCR). AGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATCATTAATTGGAGATG INBIOCRI000198825 (COI Barcoded), Costa Rica, Prov. Puntarenas, Golfito, ATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTT Sirena 8.480171 -83.591289, 51 m, 1 January 1990, Gilberto Fonseca (MNCR). TATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTCTT INB0003316716 (COI barcoded), Costa Rica, Prov. Cartago, Turrialba, P.N. ATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTT Barbilla. Estación Barbilla 9.981347 -83.454258, 500 m, 1 June 2001 Lucía GACTACTTCCCCCATCATTAACATTATTAATTTCAAGAAGTATTGTAGAAAA Chavarría (MNCR). INBIOCRI000849892 (COI Barcoded), Costa Rica, CGGAGCAGGAACAGGTTGAACAGTGTACCCCCCACTTTCTTCAAATATTGCT Prov. Limón, Talamanca, R.V.S. Gandoca Manzanillo 9.632581 -82.659053, CATAGAGGAAGCTCAGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAA 51 m, 9 September 1992, Karla Taylor (MNCR). INBIOCRI000963833 TTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACG TTTAAATGGAATATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAGGA (COI Barcoded), Costa Rica, Prov. Puntarenas, Osa, Rancho Quemado ATTACAGCATTTTTACTTCTTCTTTCTTTACCTGTTTTAGCAGGAGCTATTA 8.679095 -83.566714, 200 m, 1 August 1992, Marianella Segura (MNCR). CTATACTTTTAACTGATCGAAATTTAAATACTTCATTCTTTGACCCAGCTGG INBIOCRI000542824 (COI Barcoded), Costa Rica, Prov. Puntarenas, Golfito, AGGAGGAGATCCAATTTTATATCAACATTTATTT Sirena 8.480171 -83.591289, 50 m, 1 November 1990, Juan Carlos Saborío (MNCR). INBIOCRI000579694 (dissected, COI Barcoded), Costa Rica, Prov. Xylodonta andrewrusselli Chacón new species Puntarenas, Golfito, Sirena 8.480171 -83.591289, 50 m, 1 October 1990, Juan Carlos Saborío (MNCR). INBIOCRI000011639 (COI Barcoded), Costa (Figs 40-48) Rica. Prov. Puntarenas, Res. Biol. Carara, Est. Quebrada Bonita 9.774233 -84.608124, 50 m, September 1989, R. Zuñiga (MNCR). Description: MALE (Figs 40, 41): FWL 18-21 mm. Head: Antenna dark Other specimens examined but not barcoded: Males: INBIOCRI000161755 brown, antennal shaft cream dorsally and dark brown ventrally; scape bearing (dissected), Costa Rica, Prov. Puntarenas, Est. Sirena, P.N. Corcovado a long tuft of cream, dirty brown scales; eyes dark gold; frons mostly dark 8.480171 -83.591289, 0 – 100 m, Februrary 1990, G. Fonseca (MNCR). brown; labial palpus porrect, dark brown; vertex dirty brown. Thorax: Tegula INBIOCRI000178170 Costa Rica, Prov. Puntarenas, Est. Sirena, P.N. dirty brown at base, a mix of cream and dark brown scales distally; patagium Corcovado 8.480171 -83.591289, 0 – 100 m, December 1989, G. Fonseca light brown; mesoscutellum dirty brown; thoracic pleuron beige; metathoracic (MNCR). INBIOCRI000196748 Costa Rica, Prov. Puntarenas, Est. Sirena, dorsum with dark brown hair-like scales. Legs: Mostly dirty brown and beige P.N. Corcovado 8.480171 -83.591289, 0 – 100 m, December 1989, G. Fonseca with black scales between segments. Abdomen: Dorsum dirty brown, venter (MNCR). INB0003008939 Costa Rica, Prov. Heredia, La Selva Biol. Sta. light brown with a dark brown midline. Wings: Dorsal FW ground color dirty