loading

Logout succeed

Logout succeed. See you again!

ebook img

Structural Elucidation of the Specificity of the Antibacterial Agent Triclosan for Malarial Enoyl ACP PDF

pages43 Pages
release year2001
file size0.72 MB
languageEnglish

Preview Structural Elucidation of the Specificity of the Antibacterial Agent Triclosan for Malarial Enoyl ACP

JBC Papers in Press. Published on January 15, 2002 as Manuscript M112000200 Structural Elucidation of the Specificity of the Antibacterial Agent Triclosan for Malarial Enoyl ACP Reductase Remo Perozzo‡†, Mack Kuo‡, Amar bir Singh Sidhu§, Jacob T. Valiyaveettil¶, Robert Bittman¶, William R. Jacobs Jr.§,||, David A. Fidock§, James C. Sacchettini‡** ‡ Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 77843-2128, USA § Department of Microbiology and Immunology, Albert Einstein College of Medicine, The D o w n lo a Bronx, New York 10461, USA d e d fro ¶ Department of Chemistry and Biochemistry, Queens College of The City University of New hm ttp ://w York, Flushing, NY 11367-1597, USA w w .jb c || Howard Hughes Medical Institute, Albert Einstein College of Medicine, The Bronx, New York .org b/ y g 10461, USA u e s t o n † Current address: Department of Applied Biosciences, Swiss Federal Institute of Technology A p ril 2 , 2 (ETH), CH-8057 Zurich, Switzerland 0 1 9 Running title: Enoyl-ACP reductase of P. falciparum **Correspondence should be addressed to: James C. Sacchettini email: [email protected] phone: 001-979-8627636 fax: 001-979-8627638 Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc. Enoyl-ACP reductase of P. falciparum SUMMARY The human malaria parasite Plasmodium falciparum synthesizes fatty acids using a type II pathway that is absent in humans. The final step in fatty acid elongation is catalyzed by enoyl acyl carrier protein reductase, a validated antimicrobial drug target. Here, we report the cloning and expression of the P. falciparum enoyl acyl carrier protein reductase gene, which encodes a 50 kDa protein (PfENR) predicted to target to the unique parasite apicoplast. Purified PfENR was crystallized and its structure resolved as a binary complex with NADH, a ternary complex + with triclosan and NAD , and as ternary complexes bound to the triclosan analogs 1 and 2 with NADH. Novel structural features were identified in the PfENR binding loop region that most D o w n lo closely resembled bacterial homologs; elsewhere the protein was similar to ENR from the plant ad e d fro Brassica napus (RMS 0.30 Å). Triclosan and its analogs 1 and 2 killed multi-drug resistant m h ttp strains of intra-erythrocytic P. falciparum parasites at sub to low micromolar concentrations in ://w w w .jb c vitro. These data define the structural basis of triclosan binding to PfENR and will facilitate .o rg b/ y structure-based optimization of PfENR inhibitors. gu e s t o n A p ril 2 , 2 0 1 9 - 2 - Enoyl-ACP reductase of P. falciparum INTRODUCTION Treatment of Plasmodium falciparum malaria has depended for decades on the use of the aminoquinoline chloroquine or the synergistic antifolate combination pyrimethamine- sulfadoxine. These drugs were characterized by their potency against the P. falciparum asexual intra-erythrocytic stages (responsible for malaria pathogenesis), their affordability and their safety. The occurrence and spread of drug-resistant strains of P. falciparum have largely contributed to a recent resurgence of malaria, which claims 1 to 3 million lives annually and which is endemic in inter-tropical areas representing 40% of the world’s population (1). The D o w n lo a current situation of antimalarial chemotherapy and resistance, in conjunction with the d e d fro m reappearance of malaria in formerly well-controlled areas, reinforces the need for new, highly h ttp ://w potent antimalarials. w w .jb c Recent investigations into Apicomplexan parasites including Plasmodium and Toxoplasma .org b/ y g have uncovered the existence of a unique organelle, the apicoplast (2-4). The finding that u e s t o n ciprofloxacin-mediated inhibition of plastid replication in T. gondii tachyzoites blocked parasite A p ril 2 , 2 propagation provided evidence for the indispensable nature of this non-photosynthetic plastid 0 1 9 organelle (5). Studies of plastid inhibitors and apicoplast mis-segregation mutants confirmed the essential requirement of this organelle for normal parasite development and indicated that inhibition of apicoplast function or loss of this organelle resulted in parasite death following reinvasion of host cells (5-7). This organelle appears to derive ultimately from a cyanobacterial endosymbiont (4,8,9) and as such was postulated to contain prokaryotic-type metabolic pathways, of significant interest from the perspective of developing antiparasitic drugs (10). Recent studies indicate that these pathways include fatty acid and isoprenoid biosynthesis - 3 - Enoyl-ACP reductase of P. falciparum (11,12). Proteins involved in these pathways are often the products of nuclear-encoded genes that encode N-terminal signal and transit peptide sequences for apicoplast localization (12-14). Fatty acids play a critical role in providing metabolic precursors of biological membranes and also represent an important form of metabolic energy, making their biosynthetic pathway an excellent target for antimicrobial agents. In eukaryotes and yeast the biosynthetic enzymes are integrated into large multifunctional single polypeptides, commonly referred to as type I fatty acid synthases (FAS-I)1. The FAS-I system utilizes acetyl CoA for iterative 2-carbon elongation of fatty acids. In contrast to the large eukaryotic FAS-I enzyme, plants and most prokaryotes perform the same enzymatic steps using separate, discrete enzymes. This system is referred to as D o w n lo a type II (FAS-II) (15-18). The first evidence in favor of a FAS-II pathway in malaria parasites d e d fro m (see Scheme 1) came from the work of Waller et al. (12). These investigators reported the h ttp presence of nuclear genes encoding the FAS-II proteins acyl carrier protein (ACP), and FabZ (β- ://ww w .jb c hydroxyacyl-ACP dehydratase) in Toxoplasma gondii and ACP, FabH (β-ketoacyl-ACP .org b/ y g synthase III) and FabF (β-ketoacyl-ACP synthase II) in P. falciparum and provided evidence for ue s t o n A their targeting to the apicoplast (12,14). Recent in vitro studies confirm that P. falciparum pril 2 , 2 0 actively synthesizes fatty acids, predominantly C10 to C14 (19). 19 Inhibition of fatty acid biosynthesis has been repeatedly validated as an appropriate target for antimicrobials. Specific inhibitors of the FAS-II pathway include triclosan and thiolactomycin. Triclosan, a specific inhibitor of FAS-II trans 2-enoyl ACP reductase (ENR, also known as inhA or FabI) is effective against a broad spectrum of bacteria (20), including E. coli (21,22), Mycobacteria (23) and multi-drug-resistant Staphylococcus aureus (24,25) and is widely used as an antimicrobial in household formulations including soaps and toothpaste. Recently, - 4 - Enoyl-ACP reductase of P. falciparum triclosan was found to inhibit P. falciparum growth with an IC of approximately 1 µM (19,26). 50 This compares with a reported IC against P. falciparum of about 50 µM for thiolactomycin, 50 which inhibits the condensing enzymes FabB, FabF and FabH in plants and bacteria (12 and references therein. In vivo efficacy studies using P. berghei in mice showed that subcutaneous administration of 3 mg/kg triclosan for 4 days resulted in 75% reduction in parasitemia (19). Full parasite clearance was achieved with a single injection of 38 mg/kg given to mice that already had a parasitemia of 13-27%. Liver and kidney function tests were normal even at this highest dose, indicating that the further development of triclosan and its analogs may result in D o pharmacologically suitable compounds for use in humans. w n lo a d e In this report, we present the cloning of the pfenr gene and the 3D-structure of its d fro m h translation product, PfENR, bound to triclosan and analogs that show biological activity. These ttp ://w w data provide a framework for understanding the inhibitory mechanisms of fatty acid biosynthesis w .jb c .o rg of P. falciparum and a model for undertaking structure-based drug development of selective b/ y g u e FAS-II antimalarials. st o n A p ril 2 , 2 0 1 9 1The abbreviations used are: FAS-I, type I fatty acid synthase; FAS-II, type II fatty acid synthase; ACP, acyl carrier protein; ENR, enoyl acyl carrier protein reductase; CQ, chloroquine; CYC, cycloguanil; QN, quinine; PYR, pyrimethamine; SDX, sulfadoxine. - 5 - Enoyl-ACP reductase of P. falciparum EXPERIMENTAL PROCEDURES pfenr sequence identification and cloning. Overlapping pfenr sequences were PCR amplified from a P. falciparum (3D7 strain) gametocyte cDNA pSPORT plasmid library (kindly provided by Dr. Thomas Templeton, Weill Medical College of Cornell University, New York) using vector-specific primers (M13/pUC forward and reverse) combined with the following pfenr primers: 5’-TTTATTGCTGGTATAGGAGATACAAAT and 5’- ATTTGTATCTCCTATACCAGCAATAAA, 5’-TGGCCTCCTGTTTATAATATTTTT and 5’- AAAAATATTATAAACAGGAGGCCA, 5’- D o w n lo a GAAGAAACGAAAAATAATAAAAGATATAAT and 5’- d e d fro m ATATCTTTTATTATTTTTCGTTTCTTC, 5’-CCAGGCTATGGTGGAGGTATG and 5’- h ttp ://w CATACCTCCACCATAGCCTGG, 5’-GATTATGCAATAGAGTATTCA and 5’- w w .jb c CATATTATTTAAGTGTTTCAT. PCR conditions were: 1 X {94°C 2min}; 35 X {94°C 20s, .org b/ y g 52°C 10S, 48°C 10s; 60°C 2min}. Amplified PCR fragments were isolated and directly u e s t o n sequenced using internal primers. A p ril 2 , 2 Full-length pfenr gene was amplified using primers W1 (5’- 0 1 9 AACGTCCCATGGATAAAATATCACAACGGTTATTATTCCTCTTTCTACAT) and W2 (5’-ATATGGATCCTCATTCATTTTCATTGCGATATATATCATCTGGTAAAAACAT), which contain NcoI and BamHI sites respectively (underlined). Four silent mutations (shown in small letters) were introduced with mutagenic primers M1 (5’- GAgAAGGAAGAgAAgAAgAATTCAGCTAGCCAAAATTATACATTTATAGATTAT and M2 (5’-GAATTcTTcTTcTCTTCCTTcTCACCTGAATTGTTCATAATATTATGAACATC) using a two-step megaprimer PCR method (27,28). In the first step, the cDNA library was used - 6 - Enoyl-ACP reductase of P. falciparum as a template to amplify both a 5' fragment with the primers W1 and M2 and a 3' fragment with the primers M1 and W2. Both reactions used the PCR conditions: 1X {94°C 2min}; 30X {94°C 20s, 53°C 40s, 60°C 3min}. For the second step, both fragments were gel-purified and combined in a PCR reaction with primers W1 and W2, yielding the full-length pfenr. After restriction digestion, the gene was ligated into the pET28a vector (Novagen) and transfected into E. coli (NovaBlue, Novagen). A construct including the four silent mutations was identified and verified by restriction digestion, PCR and automated sequencing with internal primers. This construct harboring the stabilized pfenr gene was used as a template to prepare a N- terminal and C-terminal truncated version, using expression primers E1 (5’- D o w n lo a ACGTCCCATGGTGCATCATCATCATCATCATAATGAAGATATTTGTTTTATTGCTGGT d e d fro m ATAGG) and E2 (5’- h ttp ://w ATATGGATCCTCAATCATCTGGTAAAAACATTATATTTAATCCGTTATCCACATATAT w w .jb c TGTCTG) (NcoI and BamHI sites underlined) and the PCR conditions described above. This .org b/ y g truncated gene was ligated into pET28a and its sequence was verified. u e s t o n Recently, the full-length pfenr gene sequence also appeared in the P. falciparum genome A p ril 2 , 2 database as sequence from the P. falciparum "blob" chromosomes that co-migrate on pulse-field 0 1 9 gels. This has been confirmed independently by two other publications (19,26). When compared to these recently published sequences, our data from multiple independent PCR products show a Q at position 35 instead of H, and a N instead of a Y at position 88 of the complete amino acid sequence. Both changes occur at the N-terminus of the enzyme in a region that is structurally distant to the site of enzymatic function. - 7 - Enoyl-ACP reductase of P. falciparum PfENR expression and purification. BL21(DE3) Codon+-RIL cells (Novagen) harboring the expression plasmids were grown in Terrific broth. When the OD reached 0.8, the cells were 600 induced with 1mM IPTG for 5h at 37°C. Cell pellets were resuspended in buffer A (20 mM Tris/HCl pH 8.0, 500 mM NaCl, 50 mM imidazole) and disrupted using a French press. The filtered supernatant was applied to a metal chelate affinity column loaded with Ni. The column was washed with buffer B (20 mM Tris/HCl pH 8.0, 500 mM NaCl, 150 mM imidazole) and eluted with buffer C (20 mM Tris/HCl pH 8.0, 500 mM NaCl, 400 mM imidazole). The protein was concentrated using Centriprep 30 and applied to a Superdex 75 size exclusion column equilibrated with buffer D (20 mM Tris/HCl pH 7.5, 150 mM NaCl). D o w n lo a d e d fro m Crystallization and data collection. Using hanging drop vapor diffusion methods, PfENR was h ttp ://w crystallized as a binary complex with NADH bound to the enzyme and as a ternary complex with w w .jb c + + .o NAD and triclosan. The protein in buffer D (20 mg/ml) was incubated with 4 mM NAD and 1 rg b/ y g mM triclosan for the ternary complex and with 4 mM NADH for the binary complex. Two µl of ues t o n A these mixtures were mixed with 2 µl well solution consisting of 2.35 M (NH4)2SO4 and 100 mM pril 2 , 2 0 1 buffer pH 5.6 (sodium acetate for the ternary, 2-(N-Morpholino) ethanesulfonic acid for the 9 binary complex) and equilibrated against the reservoir solution at 18°C. The crystals of both complexes were isomorphous, belonged to the space group P4 2 2 with cell dimensions of 3 1 a=b=134.0 Å, c=84.0 Å and contained a dimer (half of the functional tetramer) in the asymmetric unit. Crystals of ternary complexes with NADH and the triclosan analogs 1 and 2 were prepared by soaking binary ENR:NADH crystals. The inhibitors were dissolved in acetonitrile, directly added to the drops containing crystals of binary complexes and incubated for a week. - 8 - Enoyl-ACP reductase of P. falciparum Diffraction data was collected at room temperature to 2.35-2.50 Å resolution from single crystals using a MacScience DIP2030 image plate detector with double-focusing mirrors coupled to a Rigaku X-ray generator utilizing a copper rotating anode (CuKα wavelength = 1.54 Å). The data were processed and scaled using DENZO/SCALEPACK (29). + Structure determination and refinement. The structure of the ternary ENR:NAD :triclosan complex was solved by molecular replacement with AMORE (30) using only protein coordinates of the B. napus ENR structure (pdb entry 1ENO) as search model. The initial solution was used D as a template for the Automated Protein Modeling Server (http://www.expasy.ch/swissmod/) to ow n lo a d generate a 3D model of the PfENR sequence. The resulting model was then used to calculate an ed fro m + h initial electron density map at 2.43 Å, which showed strong and continuous density for NAD ttp ://w w w and triclosan. Several rounds of model refinement included the addition of missing amino acids. .jb c .o rg In a late stage, water was automatically added and the final refinement was carried out without b/ y g u e s any restraints. This yielded a final Rwork of 17.1% and a Rfree of 21.3%. The first 9 amino acids t on A p (including the His -tag) were not resolved, and 40 of the 43 amino acids comprising an insertion ril 2 6 , 2 0 1 9 next to the binding loop area did not show any density. There were no additional breaks in the main chain although the density was weak for residues I76-K78 and E84-N88 that form two small loop regions. The average B-value for protein atoms was 36 Å2. The final model contained a total of 289 amino acids, one NAD+ molecule, one triclosan molecule and 57 water molecules in each monomer. PROCHECK analysis showed 90% of all residues in the most favored and 10% in the generously allowed regions of the Ramachandran diagram. Because crystals of the binary complex with NADH were isomorphous to the ternary complex, the protein coordinates of the latter were used to calculate the initial binary complex - 9 - Enoyl-ACP reductase of P. falciparum density maps. The first map calculated at 2.40 Å clearly identified the NADH cofactor as strong and continuous density. Subsequent refinement led to a R of 17.6% and a R of 22.4%. work free Again, no density was observed for the first 9 amino acids and the same 40 amino acids of the binding loop insertion of each monomer, and the same areas for the loops showed weak density. The average B-value for main chain atom positions of the binary structure was 31 Å2. The final + model contained a total of 289 amino acids, one NAD molecule and 77 water molecules in each monomer. The ternary structures with bound inhibitors 1 and 2 were solved using the method D o described above. Initial maps showed strong density for NADH, and additional differences in w n lo a d e electron density at the inhibitor binding site. Good density for 1 was only observed in monomer d fro m h B, whereas 2 showed excellent density in both monomers. The inhibitors were built into the ttp ://w w w model, and subsequent refinement for 1 led to a Rwork of 18.7% and a Rfree of 23.2%, with a total .jb c .o rg of 289 amino acids, one NADH and 69 solvent molecules in each monomer and one 1 molecule b/ y g u e s in subunit B. The ternary structure with bound 2 was refined to a R of 17.6% and a R of t o work free n A p 22.7%. The model comprised 289 amino acids, one NADH molecule, one 2 molecule and 64 ril 2, 2 0 1 9 solvent molecules in each monomer. Both structures lacked density for the initial 9 amino acids and the same residues of the large loop insertion. The density for the two small loops was weak. The average B-values of the main chain atoms of the ternary ENR:NADH:1 and ENR:NADH:2 complexes were 33 Å2 and 34 Å2, respectively. The statistics for all the structural determinations are presented in Table I. Enzyme assay. All experiments were carried out on a Shimadzu UV-1201 UV-Vis Spectrophotometer at 25°C in 20 mM Tris/HCl pH 7.6, 150 mM NaCl. Kinetic parameters were - 10 -

See more

The list of books you might like