loading

Logout succeed

Logout succeed. See you again!

ebook img

Subpallial Boundary Patterning by Pax6 and Gsh2 PDF

pages15 Pages
release year2009
file size3.15 MB
languageEnglish

Preview Subpallial Boundary Patterning by Pax6 and Gsh2

CerebralCortexApril2009;19:745--759 doi:10.1093/cercor/bhn123 AdvanceAccesspublicationAugust12,2008 Differential Regulation of Telencephalic Rosalind S.E. Carney1,Laura A.Cocas1,2, Tsutomu Hirata1, Kevin Mansfield1and Joshua G. Corbin1 Pallial--Subpallial Boundary Patterning by Pax6 and Gsh2 1Center for Neuroscience Research, Suite5340, Children’s Research Institute, Children’s NationalMedical Center, Washington, DC 20010, USAand 2Interdisciplinary Program in Neuroscience, Georgetown University MedicalCenter, 3970 Reservoir Rd.,NW, Washington, DC 20057, USA In the embryonic telencephalon, the pallial--subpallial boundary regionally expressed transcription factors endow telence- D (PSB)separatesthedorsalPax61palliumfromtheventralGsh21 phalic progenitor populations with the intrinsic potential to o w subpallium. Previous studies have revealed that this region is generate distinct neuronal cell types (reviewed in Wonders nlo asourceofcellsthatwillpopulateboththeolfactorybulbandbasal and Anderson 2006; Molyneaux et al. 2007). ad e telencephalic limbic system. However, the level of progenitor cell Fromearlystagesoftelencephalicdevelopment(byapprox- d heterogeneity and developmental genetic regulation of this pro- imately embryonic day 10.0 [E10.0]), the pallium and sub- fro m genitor region remains to be fully elucidated. In this study pallium are identified by the expression of the homeodomain h we carried out a comprehensive analysis of gene expression containing genes Pax6 and Gsh2, respectively. The pallial-- ttp s patterns at the PSB, in addition to an examination of the subpallial boundary (PSB, also known as the cortico-striatal ://a combinatorial function of Pax6 and Gsh2 in the specification of border)istheregionwherehighPax6expression(Pax6isalso ca d the PSB. First, we reveal that the PSB is comprised of a complex expressedatalowlevelinthedorsal-mostaspectofthelateral e m mixofmolecularlydistinctprogenitorpools.Inaddition,byanalysis ganglion eminence (LGE) [dLGE] ventricular zone [VZ]) abuts ic of single Sey, Gsh2, and Sey/Gsh2 double mutant mice, we Gsh2 expression near the cortico-striatal angle. The PSB is .ou p demonstrate that both Pax6 and Gsh2 are directly required for comprised of neural progenitor cells from both the ventral- .c o major aspects of PSB progenitor specification. Our analysis also mostaspectofthepallium(VP)anddLGE(Puellesetal.1999; m reveals that the establishment of the epidermal growth factor Puelles et al. 2000; Yun et al. 2001; Stenman, Toresson, et al. /ce receptor positive lateral cortical stream migratory route to the 2003). In addition, previous studies have also revealed that rco bwaeslal-lcthealreanccteeprihzaeldoncirsosPsa-xre6pdreespseinvdeenrot.leTshuins,dinorasdadl/ivtieonntrtaoltphaetir- pDrboxg1en(iVtoPr)ancedllSsp8o,fmTthshe1(PdSLBGEt)ratnhsaitencotllylecetixvperlyesmsarSkfrtph2is, r/article terningouranalysesrevealimportantnovelfunctionsofGsh2and region as molecularly distinct from the rest of the telenceph- -a b Pax6 in the regulation of PSB progenitor pool specification and s patterning. aWloancla(wPueelltesale.t2a0l.0260)0.0E;mKeimrgientgale.v2id0e0n1c;eCafurboimt etouarl. 2w0o0r5k; tract/1 (Carney et al. 2006) and that of others (Fernandez et al. 9 Keywords:cortico-striatal border, development, gene expression, /4 lateralcorticalstream, mutant,small eye(Sey) 1998;Puellesetal.1999;Puellesetal.2000;Hirataetal.2002; /74 Stenman, Yu, et al. 2003; Bai et al. 2008) has revealed that 5 /2 a major target of lateral cortical stream (LCS) migrating PSB 7 9 neurons (VP and dLGE) is the basal telencephalic limbic 52 2 Introduction system, most prominently the amygdala and piriform cortex. b y Theembryonictelencephaloncanbeparcellatedinto2broad Moreover,progenitorsfromthePSBgenerateoneoftwomain g u subgroupsofCajal--Retziusneuronsinthepallium(Bielleetal. e progenitor zones, the pallium and subpallium, which are s responsible for generating, in a highly precise and complex 2005), as well as OB interneurons derived from the rostral t on manner, telencephalic excitatory and inhibitory neurons, migratory stream (RMS) (Waclaw et al. 2006; Kohwi et al. 1 1 respectively (reviewed in Corbin et al. 2001; Marı´n and 2007).Thus,thisregionisanimportantsourceoftelencephalic A p Renutbiaelnastnedinte2m0p0o1;raWllyonredgeurslataenddeAxnpdreersssoionn2p0a0t6te)r.nTshoefdpiaflfleiar-l celPlrpeovpiouulastisotnusd.ies have revealed that Pax6 and Gsh2 are ril 20 1 (e.g., Pax6, Emx1, Ngn2) and subpallial (e.g., Gsh2, Mash1, required for proper positioning of the PSB by functioning to 9 Dlx family members) genes define discrete progenitor geneticallycrossrepresseachother(Toressonetal.2000;Yun domains that give rise to neuronal diversity in several etal.2001;Corbinetal.2003;Stenman,Yu,etal.2003;Yunetal. telencephalic regions such as the cerebral cortex (Nery 2003). As such, the lack of Pax6 in Sey (Small eye; Hill et al. etal.2002;Lo´pez-Benditoetal.2004;Xuetal.2004;Buttetal. 1991)mutantmiceresultsinanexpansionofsubpallialmarkers 2005; Flames et al. 2007; Fogarty et al. 2007; Miyoshi et al. such as Dlx1, Dlx2, Gsh2, Mash1, Vax1 into the pallium 2007), olfactory bulb (OB) (Wichterle et al. 1999; Stenman, (Stoykova et al. 1996; Corbin et al. 2000; Stoykova et al. 2000; Toresson, et al. 2003; Kohwi et al. 2005; Vergan˜o-Vera et al. Toressonetal.2000;Yunetal.2001;KrollandO’Leary2005). 2006; Waclaw et al. 2006; Kohwi et al. 2007), amygdala Conversely,inGsh2mutantmice (Szucsik et al. 1997) pallial (Wichterle et al. 2001; Gorski et al. 2002; Nery et al. 2002; markers such as Pax6, Ngn2, Math2, Tbr1 extend ventrally Remedios et al. 2007), and adult subventricular zone (SVZ) into the LGE (Corbin et al. 2000; Toresson et al. 2000; (DeMarchisetal.2007;Kohwietal.2007;Youngetal.2007). Toresson and Campbell 2001; Yun et al. 2001). Thus, in Sey Emerging evidence also interestingly indicates that in mutant mice VP and lateral pallial (LP) progenitors acquire a manner similar to the spinal cord, combinatorial codes of subpallial properties, whereas in Gsh2 mutant mice the dLGE (cid:1)TheAuthor2008.PublishedbyOxfordUniversityPress.Allrightsreserved. Forpermissions,pleasee-mail:[email protected] is respecified to a pallial identity. Loss of VP markers, Sfrp2, Genotyping Dbx1, and Tgfa in Sey mutant mice has suggested a direct GenomicDNAwasisolatedbyphenol:chloroformextraction.Genotyp- requirement of Pax6 for their expression (Kim et al. 2001; ing of Gsh2 adult mice and embryos was carried out by PCR using previously described methods (Stenman,Wang,et al.2003). PCR was Yun et al. 2001; Assimacopoulos et al. 2003; Stenman, Yu, performed using 2 primers (for adult genotyping) or 3 primers (for et al. 2003). Similarly, dLGE development and gene expres- embryogenotyping)usingaGCrichkit(Roche,Indianapolis,IN).Sey sion is severely affected in Gsh2 mutants (Corbin et al. 2001; mutantembryoswereidentifiedbylackofeyesandabnormalcranio- Yun et al. 2001; Waclaw et al. 2006). However, the facial features(Hillet al. 1991). Additional confirmationof genotypes interpretation of the genetic dependence of Pax6 for PSB was carried out on sections by analysis of known, for example, Dlx2 gene expression in Sey mutants in confounded by ectopic (RNA or X-gal stainingof Dlx2+/tauLacZ sections) (Corbin et al. 2000) expressionchangesinGsh2andSeymutantembryos.Sey/Gsh2double Gsh2 expression in the VP and LP. Conversely, in Gsh2 mutantsectionswereconfirmedbythelackofPax6andGsh2protein mutants, a direct function of Gsh2 cannot be dissociated inadditiontothelackofeyesandPCRforGsh2mutantandwild-type from ectopic Pax6 expression in the dLGE. alleles.MaleheterozygousDlx5/6–cre-iresEGFP(Stenman,Toresson,etal. The purpose of this study was 2-fold: First, we sought to 2003,hereinreferredtoasDlx5/6-GFP)micewerecrossedwithSwiss D systematicallyanalyzetheexpressionpatternsofPSB-specific Webster females to generate Dlx5/6-GFP+ embryos. The adults were o w genesduringkeydevelopmentaltimepointsofneurogenesis. genotypedby PCRforCre (CRE-F:GCGGTCTGGCAGTAAAAACTATC; n Second,wewantedtocomprehensivelydissecttheindividual CRE-R: GTGAAACAGCATTGCTGTCACTT) and the embryos were loa and combinatorial roles of Pax6 and Gsh2 in PSB patterning, identifiedbyGFPfluorescenceusingadissectingmicroscope. ded thereby providing an in-depth understanding of the genetic fro requirement for the establishment of neural diversity in PSB- NonradioactiveDioxygenin-LabeledRNAInSituHybridization m derivedstructures.OurexpressionstudiesrevealthatthePSB Wholeheads(E12.5,E13.5)orisolatedbrains(E15.5)werefixedat4(cid:2)C http in 4% paraformaldehyde (PFA) (in 0.1 M phosphate buffer, pH 7.4) s is a highly complex and dynamic telencephalic progenitor (4% PFA) overnight then cryoprotected in graded sucrose concen- ://a zone, comprised of multiple molecularly distinct progenitor trations (10%, 20% then 30% overnight) before embedding in Tissue- ca pools.Furthermore,geneexpressionanalysisinsingleSeyand TekOCTcompound(SakuraFinetekUSA,Inc.,Torrance,CA).Coronal de m Gsh2mutantmiceandSey/Gsh2doublemutantmice,reveals sections at a thickness of 20 (E12.5, E13.5) or 30 lm (E15.5) were ic that in the absence of both Pax6 and Gsh2 all examined preparedusingacryostat(MicromHM505E,GMI,Inc.,Ramsey,MN). .o u ainsdpieccattsesotfhaptatttheersneinggenoefs,tihnecoPmSBbinreatmioanin, aarebnroerqmuairl.edThfoisr moSdeicfitcioantionRsNAof ipnrevsiiotuuslhyybdreisdcirziabteiodnprwoatsococlasrr(ieSdchaoeurtenb-Wyiesmligehrst p.com correct positioning and expression of PSB-specific genes. andGerfin-Moser1993;WilkinsonandNieto1993).RNAprobeswere /c preparedusingdioxygenin(DIG)RNAlabelingkits(Roche).Air-dried e Moreover, analysis of markers that individually label the VP cryostatsectionswerepostfixedin4%PFAfor10minfollowedby235 rco and dLGE further reveals a complex and novel differential min rinses in phosphate-buffered saline (PBS). Proteinase K (Roche) r/a regulation of PSB progenitor pool specification by Gsh2 and digestion(20lg/mLinPBS)wascarriedoutfor6minfollowedby135 rtic Pax6,whichchangesovertimeduringdevelopment.Further- minrinseinPBS,refixingfor5minin4%PFAandanotherPBSrinse. le-a more, we show that epidermal growth factor receptor The sections were acetylated for 10 min (2.2 g triethanolamine bs positive (EGFR+) cells, that mark the LCS migratory popula- hydrochloride[AcrosOrganics,Geel,Belgium],540lLof10NNaOH tra [FisherScientific,Pittsburgh,PA],300lLofaceticanhydride[Sigma,St c tionfromthePSB,arealsodifferentiallyregulatedbyPax6and Louis,MO]in60mLofmoleculargradewater[Cellgro,Herndon,VA], t/1 9 Gsh2. Thus, our study provides important insights into the priorto335minrinsesinPBS).RNAprobes,preparedatadilutionof2 /4 genetic requirement for the generation of the PSB, a major lL/mLofhybridizationsolution(50%formamide[Invitrogen,Carlsbad, /74 progenitorregionforthegenerationofOBandlimbicsystem CA], 10%dextransulfate,1%1003 Denhart’s,250lg/mLyeasttRNA, 5/2 cell diversity. 0.3MNaCl,20mMTris--HCl,pH8,5mMethylenediaminetetraacetic 79 acid[EDTA],10mMNaPO4,1%sarcosyl[allfromSigmaexceptwhere 52 indicated] in diethylpyrocarbonate-treated H2O [Invitrogen]), were 2 b incubatedat80(cid:2)Cfor2min.Thereafter,250lLoftheprobemixwas y Materials and Methods appliedtoeachslide,coverslippedwithHybri-slips(Sigma)andplaced gu e inasealedboxhumidifiedwith50%formamideandH Oandincubated s AnimalUse at 55 (cid:2)C overnight. The next day, the Hybri-slips we2re floated off by t o n Allanimalsusedinthestudyweremaintainedaccordingtoprotocols placingtheslidesin53saline-sodiumcitratebuffer(Cellgro),priorto 1 1 approved by the Animal Welfare and use committee at Children’s a30-minhighstringencywashinprewarmed50%formamide,23SSCat A NwaetlifoarneallaMwesd.iFcoarlsCteagnitnegr,oWftahsheienmgtborny,oDs,Cm,aidnddaaydohfetrhinegdtaoyaolflvaangiimnaall 6b5uff(cid:2)eCr.(N0.e5xMt, tNhaeCsle,c1t0iomnMs wTerrise--HriCnsl,epdHin7.35,35m10MmEiDnTrAin)s,efosllionwReNdabsey pril 2 0 plug detection was considered as E0.5. Previously published Gsh2 RNaseA(Roche)treatment(20lg/mLinRNasebuffer)for30minand 1 9 (Szucsiketal.1997)andPax6(Sey)mutants(Hilletal.1991)were one 15 min rinse in RNase buffer, all at 37 (cid:2)C. The high stringency used in this study. Adult Gsh2+/– and Sey/+ heterozygotes were washeswererepeatedtwicefor20mineachat65(cid:2)C,followedbya15 maintainedbycrossestoSwissWebstermice(Taconic,Albany,NY). minrinsein23SSC,then0.13SSC,bothat37(cid:2)CandaPBT(PBS+0.1% In all cases, single Gsh2–/–, Sey/Sey (referred to as Sey mutant), or Tween20;Sigma)rinsefor15minatRT.Thesectionswereblocked Sey/Sey;Gsh2–/–doublehomozygousmutant(referredtoasSey/Gsh2 with10%goatseruminPBTfor1hatRT,priortoa3-hincubationwith doublemutant)embryosweregeneratedbyheterozygouscrossesas analkalinephosphatase-coupledanti-DIGantibody(1:5000in1%goat previously described (Corbin et al. 2000; Toresson et al. 2000; Yun seruminPBT;Roche)inahumidifiedchamberatRT.Then,thesections et al. 2001; Waclaw et al. 2004, 2006). In some crosses, mice also were rinsed extensively in PBT at RT (4 3 15 min rinses) and then carried the Dlx2+/tauLacZ allele, and in these cases embryos and underwent2310minrinsesinfreshlypreparedNTMTbuffer(100mM brainswerestainedforX-galtovisualizeDlx2(Corbinetal.2000). NaCl,100mMTris--HCl,pH9.5,50mMMgCl , 0.1%Tween20). The 2 Fortheinsituhybridizationanalyses,theGsh2–/–,Sey/Sey,andSey/ sections were then placed in a light-protected humidified chamber Gsh2doublemutantgenotypeswereeachprocessedindependently with approximately 400 lL of BM-purple AP substrate (Roche) withlittermateheterozygoteandwild-typemiceusedascontrolsto containing ~0.25 mg/mL levamisol (Sigma) until satisfactory staining ensure correct RNA probe labeling. A minimum of 3 mutants and was achieved, typically overnight. Finally, the sections were rinsed controls were used for all genotypes, n numbers are given in the twice in PBS, coverslipped using Crystal mount aqueous mounting figurelegends. media(Sigma)andphotographedimmediately. 746 Pax6andGsh2inPallial--SubpallialBoundaryPatterning d Carneyetal. Thefollowingprobeswereusedinthisstudy:Dbx1(Luetal.1992; tolow-caudalgradient(WaltherandGruss1991;Stoykovaand Yunetal.2001),Dlx2(Porteusetal.1991),Dlx5(Eisenstatetal.1999), Gruss 1994), we carried out this analysis at 2 rostro-caudal Er81(Stenman,Toresson,etal.2003),Gsh1(ToressonandCampbell, levels for eachmarker. 2001), Sfrp2 (Kim et al. 2001), Sp8 (Bell et al. 2003; Waclaw et al. 2006), Tgfa (Vaughan et al. 1992; Assimacopoulos et al. 2003), and mTsh1(Caubitetal.2005). Pax6andGsh2areRequiredfortheCorrectExpressionof Er81atthe PSB Er81isamemberoftheETStranscription factorfamilyandis Immunohistochemistry Sectionspreparedasdescribedaboveforinsituhybridizationanalysis highlyexpressedinthedLGESVZ,VPVZ,andotherpallialand wereair-driedandunderwentmicrowaveheatantigenretrieval(except subpallial regions (Fig. 1A,E,I,M) (Stenman, Wang, et al. 2003; forDlx5/6-GFP+brainswhichwerefixedfor4handdidnotrequire Flames et al. 2007). In Gsh2 mutants at both E13.5 and E15.5, antigen retrieval) in 10 mM sodium citrate (Fisher Scientific) pH 6.0 Er81 expression in the dLGE SVZ is missing and there is an prior to several rinses in PBS. Subsequently, blocking of nonspecific expansionofthedomainofVZexpressionatE13.5(Fig.1B,F,J,N). bindingsiteswasachievedusing10%normalserumdilutedinPBSwith 0.3%Triton-X(PBST;Sigma)toaidpermeabilization.Primaryantibodies, InSeymutantsatbothages,Er81expressionisabsentintheVZ Do goatanti-b-galactosidase(b-gal)(1:200,Biogen,Cambridge,MA),sheep oftheVPthatiscombinedwithanexpandedexpressioninthe w n anti-EGFR (1:20; Millipore, Bedford, MA), rabbit anti-Gsh2 (1:2000; SVZinboththemutantdLGEandVPdomains (Fig. 1C,G,K,O). lo a Toressonetal.2000;kindgiftofK.Campbell),mouseanti-Pax6(1:2000; In Sey/Gsh2 double mutants, Er81 expression remains d e DIoewvaeloCpitmy,enIAta),lrSatbubdiitesanHtiy-Pbarixd6om(1a:1B0a0n0k; C[DovSaHnBc]e, URnesiveearrscihtyPorofdIuocwtas,, athbantorombsaelravnedd,ianlthsionugglehSseliyghmtluytlaenstsssaetvebroet,hclEo1s3e.l5y arensdemE1b5le.5s d from Berkeley,CA),mouseanti-RC2(1:20;DSHB),rabbitanti-Tbr1(1:1000; (Fig. 1D,H,L,P). Interestingly, Er81 expression reveals nascent h rHsienersvuenmseriinnetPPaBlBS.TS2,0at0nh1de;iknsicenucdbtigaotinfetsdoowfvRee.rrenHiegivnhncteuarbt)a4twe(cid:2)edCre.wFdoitillhluotwethdineigna31p%3pro1n0porrmimatianel ppaarllaiuvemnt(rKicruollalraencdtoOp’iLaeaarsyp2r0ev0i5o)u,swlyhdicehscarribeeadlsionoSbesyermveudtanint ttps://a c secondaryCy3-(1:200)orfluoresceinisothiocyanate-(1:50)conjugated the double mutant. a d antibodies (serum and secondary antibodies were from Jackson e m Immunoresearch,WestGrove,PA),dilutedasfortheprimaryantibodies, ic inthedarkfor2hatRT.AfterfurtherrinsesinPBS,nuclearcounterstaining Differential Regulation ofdLGE Sp8andmTsh1 .o u was performed by incubation in To-Pro-3 iodide (To-Pro-3; 1:100, Expression byGsh2 and Pax6 p .c Invitrogen)for10minatRT.FinalrinsesinPBSwerecarriedoutpriorto Next, we examined 2 zincfinger transcription factors, Sp8 and om coverslippingusingGelMountaqueousmountingmedia(Sigma). mTsh1,whichareexpressedintheSVZofthedLGEaspectofthe /c e PSB. Recent studies have revealed that Sp8 is required for the rc o DataAnalysis specification,migrationandsurvivalofOBinterneurons(Waclaw r/a Analysis of in situ hybridization experiments was performed using etal.2006)andplaysaroleincorticalarealization(Saharaetal. rtic brightfield microscopy (Olympus BX51, Olympus, Center Valley, PA) 2007;Zembrzyckietal.2007).Themouseteashirtfamilyofgenes le-a andhigh-resolutiondigitalimageswerecapturedundera34objective (mTsh1-3)encodezincfingerDNAbindingproteinsthatarealso bs usinganOlympusD570camera.Forfluorescence,digitalphotographs expressedinthedevelopingbrain(Caubitetal.2005). tra wereobtainedfromepifluorescencemicroscopy(OlympusBX61)and c selectedforfurther analysis usinga Zeiss (Thornwood, NY) LSM 510 At E13.5, Sp8 is expressed at very high levels in the SVZ of t/1 9 META confocal microscope. For confocal analysis, each fluorophore the dLGE and at lower levels in the progenitor zones of the /4 was scanned sequentially and Z-stacks of the images obtained were dorsolateral and dorsomedial cortex (Fig. 2A,E) (Waclaw et al. /74 collapsed into a single projection image, or presented as individual 2006).IthaspreviouslybeenshownthatinGsh2mutantmice 5/2 opticalsectionsusingtheLSM510software(Zeiss).Toassessimmuno- Sp8 protein is missing at E12.5, with a partial recovery of this 79 colocalization, 3 sections from at least n = 2 brains (values given in expressionbyE16.5(Waclawetal.2006).Consistentwiththis 52 figure legends) were examined. Figures were prepared using Adobe observation, we find a striking reduction in Sp8 expression at 2 b PhotoshopCSsoftware(AdobeSystems,SanJose,CA).Adjustmentsto y contrast were applied across each image as a whole and equally to E13.5 in Gsh2 mutants (Fig. 2B,F). In contrast, in Sey mutant gu e controlandmutantbrains. mice,thereisanexpansionofSp8mRNAintotheSeymutant s pallium at E13.5 (Fig. 2C,G). In Sey/Gsh2 double mutants, t on although there appears to be some improvement of ectopic 11 Results Sp8 expression, in general Sp8 expression remains abnormal A p The PSB is defined as the location of the border between (Fig. 2D,H). ril 2 progenitor cells of pallial (Pax6+) and subpallial (Gsh2+) Similar to Sp8, mTsh1 expression marks the dLGE SVZ. 0 1 identity(Yunetal.2001;Corbinetal.2003;Stenman,Yu,etal. However, in contrast to Sp8, mTsh1 expression persists in 9 2003; Yun et al. 2003). To examine the regulation of PSB presumptive migrating cells that emanate from the dLGE patterning by Gsh2 and Pax6, we used a series of well- and form the LCS migratory route to the basal telencephalon characterized in situ hybridization probes that mark the VZ (Fig.2I,M).TheexpressionofmTsh1ismaintainedinthedLGE and/or SVZ progenitor cell compartments of either both the and cells of the presumptive LCS of Gsh2 mutants at E13.5 pallial and subpallial aspects of the PSB (Er81), dLGE (Sp8, (Fig. 2J,N), which is in surprising contrast to the loss of Sp8 mTsh1), or the VP (Sfrp2, Dbx1, Tgfa). These analyses were expression (Fig. 2B,F) thereby indicating a differential regula- carried out at 2 developmental time points, E13.5 and E15.5, tion of Sp8 and mTsh1 by Gsh2. In the Sey mutant which represent the peak of severity of patterning defects in telencephalon at E13.5, mTsh1 expression expands into the Gsh2andSeymutants(Corbinetal.2000;Toressonetal.2000; pallium(Fig.2K,O).Inaddition,therealsoappearstobeectopic Yun et al. 2001; and data shown here) and partial recovery of expressionalongtheouterventraltelencephalonintheareaof the striatal phenotype in Gsh2 mutants (Corbin et al. 2000; the presumptive piriform cortex. Similar to Sp8 expression in ToressonandCampbell2001;Yunetal.2001;Yunetal.2003), Sey/Gsh2 double mutant mice, although partially recovered, respectively.AstheexpressionofPax6occursinahigh-rostral mTsh1 expressionremains abnormal (Fig. 2L,P). CerebralCortexApril2009,V19N4 747 D o w n lo a d e d fro m h ttp s ://a c a d e m ic .o u p .c o m /c e rc o r/a rtic le -a b s tra c t/1 9 /4 /7 4 Figure1. ExpressionofEtstranscriptionfactorEr81atE13.5andE15.5.Er81isexpressedintheSVZofthedLGEandVZoftheVPasshownatE13.5incontrols(A,E).VZ 5/2 expressionexpandsventrallyinGsh2mutantmice(B,F,arrowheads).InSeymutants,SVZexpressionextendsectopicallyintothecerebralcortex(CTX,alsotermedthepallium) 7 9 (C,G,arrows).InSey/Gsh2doublemutants,ectopicpallialexpressionofEr81resemblestheSeymutantphenotype,butisweaker(D,H,arrows).AtE15.5,thedLGESVZ 5 2 expressionofEr81incontrols(I,M)ismissingintheGsh2mutant(J,N,asterisks).Conversely,inSeysinglemutants(K,O)andSey/Gsh2doublemutants(L,P),Er81is 2 b ectopicallyexpressedinthepallium(arrows)andformsnascentparaventricularectopia(K,L,O,P,emptyarrowhead).IntheSeymutant,abasalstreamofEr81expressionis y alsoobserved(K,O,arrowheads),whichisnotpresentinthedoublemutant(L,P,arrowhead).nnumbersareasfollows:controls,n55[E13.5],n55[E15.5];Gsh2(cid:1)/(cid:1),n56 gu [E13.5],n55[E15.5];Sey/Sey,n55[E13.5],n55[E15.5];Sey/Sey;Gsh2(cid:1)/(cid:1),n55[E13.5],n55[E15.5].Scalebar:200lm. es t o n 1 1 At E15.5, Sp8 is still strongly expressed in the dLGE SVZ reduced (Fig. 3J,N), revealing that mTsh1 expression is A p (Fig.3A,E),whichshowspartialrecoveryofSp8expressionin temporally regulatedbyGsh2 (Fig.3J,N). ril 2 thedLGEofGsh2mutants(Fig.3B,F)ascomparedwithE13.5 Ectopic pallial and basal expression of mTsh1 persists at 0 1 (Fig. 2B,F), similar to that observed at E16.5 (Waclaw et al. E15.5intheSeymutant(Fig.3K,O).Moreover,doublemutant 9 2006). In contrast, the Sey mutant telencephalon continues analysis shows that the loss of ectopic Gsh2 in Sey mutants to exhibit robust ectopic Sp8 expression in the pallium does not significantly rescue the abnormal phenotype (Fig.3C,G),andatmedialtelencephaliclevelsanectopicbasal (Fig.3L,P).TheformationofmTsh1+paraventricularectopia streamofSp8expressionisobserved(Fig.3G).Thisdomainof shows that dorsal telencephalic progenitors in the Sey ectopicpallialSp8expression,althoughlesssevere,persistsin mutant pallium are respecified to not only an Sp8 Sey/Gsh2mutantsatE15.5(Fig.3D,H).Sp8expressionreveals lineage (Kroll and O’Leary 2005; this study), but to mTsh1 paraventricular ectopia in Sey/Gsh2 double mutants and Er81 lineages. Furthermore, removal of Gsh2 from the (Fig. 3D,H) as in the case of the Sey single mutant (Kroll and Sey mutant pallium is not sufficient to rescue the respeci- O’Leary,2005; this study). fication of dorsal telencephalic precursors to these dLGE At E15.5, similar to E13.5, mTsh1 is expressed in the dLGE identities. SVZ and in the LCS migratory route (Fig. 3I,M). Interestingly, In summary, this analysis reveals that 1) Sp8 and mTsh1 although mTsh1 expression in Gsh2 mutants was normal at appear to be differentially regulated by Gsh2 in a temporally E13.5, at E15.5 expression in the dLGE and LCS is markedly dependent manner and 2) altered expression of Sp8 and 748 Pax6andGsh2inPallial--SubpallialBoundaryPatterning d Carneyetal. D o w n lo a d e d fro m h ttp s ://a c a d e m ic .o u p .c o m /c e rc o r/a rtic le -a b s tra c t/1 9 /4 /7 4 Figure2. ExpressionofdLGEmarkersSp8andmTsh1atE13.5.Sp8isstronglyexpressedinthedLGESVZincontrolsatE13.5(A,E).Thelevelofexpressionismarkedly 5/2 diminishedinGsh2mutants(B,F,arrows).ThelossofPax6inSeymutantsresultsinectopicpallialexpressionofSp8(C,G,arrowheads).InSey/Gsh2doublemutantmice,this 7 9 ectopicexpression,althoughimprovedovertheSeysinglemutantphenotype,persists(D,H,arrowheads).AtE13.5,mTsh1isexpressedinthedLGESVZandalsotheputative 5 2 LCSmigratoryroute(I,M,arrows).ThisexpressionisgenerallyunaffectedinGsh2mutants(J,N,arrows).Conversely,intheSeymutant,ectopicmTsh1expressionisobserved 2 inboththepallium(K,O,arrowheads)andbasally(K,O,arrows).ThismispatterningisgenerallysimilarintheSey/Gsh2doublemutants(L,P,arrows,arrowheads).Abbreviation: by nnumbersforeachprobeareasfollows:controls,n54[Sp8],n56[mTsh1];Gsh2(cid:1)/(cid:1),n54[Sp8],n54[mTsh1];Sey/Sey,n54[Sp8],n55[mTsh1];Sey/Sey;Gsh2(cid:1)/(cid:1), g u n55[Sp8],n55[mTsh1].Scalebar:200lm. e s t o n 1 1 mTsh1 in Sey/Gsh2 double mutants broadly resembles that of 5D,H). Thus, we reveal that the Pax6-regulated expression of A p singleSey mutants. Sfrp2isindependent of Gsh2. ril 2 Dbx1 is a homeodomain gene that, similar to Sfrp2, is 0 1 expressed in the VZ of the VP aspect of the PSB (Yun et al. 9 Differential Regulation ofVentral Pallial Markers Sfrp2 2001;Medinaet al. 2004;Bielleet al. 2005).The VPgenerates andDbx1byPax6andGsh2 cells destined for the pallium (Bielle et al. 2005) and the Sfrp2,aninhibitoroftheWNTsecretedgrowthfactorprotein basolateral and lateral amygdala (Stenman, Yu, et al. 2003; isexpressedintheVZoftheVP,asshownatE13.5andE15.5 Carney et al. 2006). We analyzed the expression of Dbx1 at (Figs 4 and 5A,E). In Gsh2 mutants at E13.5, the expression E12.5,afterwhichVPexpressionisdownregulated(Fig.4I).In domain of Sfrp2 expands ventrally (Fig. 4B,F). This expansion Gsh2 mutants, Dbx1, similar to Sfrp2 at E13.5, is ectopically remains present at E15.5 (Fig. 5B,F). In agreement with expressed in the dLGE (Fig. 4J). We further observe that Sey previous findings at E13.5 (Kim et al. 2001; Muzio et al. mutants lack Dbx1 expression at the PSB (Fig. 4K). Interest- 2002),weobservethatthetelencephalicexpressionofSfrp2at ingly,incontrasttoSfrp2,removalofectopicGsh2intheSey thePSBismissinginSeymutantmiceatE13.5andE15.5(Figs4 mutant pallium re-initiated expression of Dbx1 in the LGE of and5C,G). At E13.5and E15.5, lack of bothPax6 and Gsh2 in Sey/Gsh2 double mutants (Fig. 4L). However, this expression Sey/Gsh2 double mutant mice does not restore Sfrp2 appearstobeectopicallylocalizedtotheSVZ.Thisrevealsthat expression at the PSB at rostral or medial levels (Figs 4 and Pax6 is required for Dbx1 expression at the VP and Gsh2 CerebralCortexApril2009,V19N4 749 D o w n lo a d e d fro m h ttp s ://a c a d e m ic .o u p .c o m /c e rc o r/a rtic le -a b s tra c t/1 9 /4 /7 4 Figure3. ExpressionofdLGEmarkersSp8andmTsh1atE15.5.AtE15.5,Sp8stronglymarksthedLGESVZ(A,E).InGsh2mutants,thisexpressionpatternislargelynormal(B, 5/2 F,arrowheads).SeymutantsdisplaysignificantectopicexpressionofSp8inthepallium(C,G,arrows),withanenlargedbasalstreamatmoremediallevels(G,arrowhead)thatis 7 9 notobservedmorerostrally(C,arrowhead).Sey/Gsh2doublemutantsdisplayectopicpallialexpression,thoughatdiminishedlevelsfromtheSeymutants(D,H,arrows),with 5 2 nascent paraventricular ectopia (D, H, empty arrowheads). Sey/Gsh2 double mutants also do not display a basal stream of Sp8 expression (D, H, arrowheads). mTsh1 is 2 expressedinthedLGESVZandputativeLCS(arrows)(I,M).InGsh2mutants,thereisdiminishedmTsh1inthedLGESVZ(arrows)withalackofexpressionintheputativeLCS by (J,N,asterisk).IntheSeymutant,ectopicmTsh1expressionisfoundinthepallium(arrows)andformsparaventricularectopia(emptyarrowheads)(K,O).Basal-directed g u putativemigrationisobservedatrostral(K,arrowheads)andmedial(O,arrowheads)levels.Sey/Gsh2doublemutantsalsoexhibitpallialectopicmTsh1expression(arrows)with e s paraventricularectopia(emptyarrowheads)andputativebasal-directedmigration(arrowheads)(L,P).nnumbersforeachprobeareasfollows:controls,n56[Sp8],n56 t o [mTsh1];Gsh2(cid:1)/(cid:1),n55[Sp8],n55[mTsh1];Sey/Sey,n55[Sp8],n56[mTsh1];Sey/Sey;Gsh2(cid:1)/(cid:1),n54[Sp8],n55[mTsh1].Scalebar:200lm. n 1 1 A p functionstorepressectopicDbx1expressionintheLGE.Thus, theputativeLCS(Fig.6N).Inagreementwithpreviousfindings ril 2 similartotheabovedifferentialregulationofmTsh1andSp8by (Assimacopoulos et al. 2003), Tgfa expression is absent in the 0 1 Gsh2 and Pax6, Sfrp2, and Dbx1 are also regulated in VPinSeymutantsatbothages(Fig.6C,G,K,O).SimilartoSfrp2, 9 a complexmanner byGsh2 and Pax6. but in contrast to the VP marker Dbx1, expression of Tgfa is not restored at the PSB in the Sey/Gsh2 double mutants at Regulation ofTgfaExpression byGsh2 andPax6 either age (Fig. 6D,H,L,P). atE13.5 andE15.5 Next, we examined expression of the secreted factor Tgfa, Interneuron markers Dlx2andDlx5 which is a ligand for EGFR in the developing forebrain TheDlxfamilyofhomeoboxtranscriptionfactorscomprises6 (Kornblum et al. 1997). At E13.5 and E15.5, Tgfa is strongly genes, 4 of which are expressed in the developing forebrain expressed in the VP aspect of the PSB (Fig. 6A,E,I,M) (Bulfone, Puelles, et al. 1993; Simeone et al. 1994; Anderson (Assimacopoulos et al. 2003). In Gsh2 mutants at E13.5, Tgfa etal.1997;Liuetal.1997).Dlx1andDlx2areexpressedinthe expressionectopicallyextendsintotheLGE(Fig.6B,F),similar subpallial VZ and SVZ, whereas Dlx5 and Dlx6 are strongly to otherVP markers, Sfrp2 and Dbx1 (Fig. 4B,F,J). At E15.5in expressed in the subpallial SVZ and postmitotic regions Gsh2 mutants, Tgfa expression remains slightly expanded (Eisenstat et al. 1999). We have previously shown that in the (Fig. 6J,N) along with ectopic expression along the route of absence of Gsh2, there is a lack of Dlx2+ cells along the LCS 750 Pax6andGsh2inPallial--SubpallialBoundaryPatterning d Carneyetal. D o w n lo a d e d fro m h ttp s ://a c a d e m ic .o u p .c o m /c e Figure4. ExpressionofVPmarkersSfrp2andDbx1atE13.5andE12.5.Sfrp2isexpressedintheVPasshownatE13.5(A,E).Thisexpressiondomainisexpandedventrallyin rco Gsh2mutants(B,F,arrowheads).Sfrp2expressionisabsentatthePSB(asterisk)intheSeymutant(C,G,asterisks).InSey/Gsh2doublemutantsexpressionisnotrestored(D, r/a H,asterisks)Dbx1isexpressedintheVPatE12.5(I).LossofGsh2resultsinectopicDbx1expressionintheLGE(J,arrows).InSeymutants,Dbx1ismissingintheVP(K, rtic asterisk).InSey/Gsh2doublemutantsDbx1expressionisre-expressed,butmislocalizedinthedLGESVZ(L,arrows).nnumbersforeachprobeareasfollows:controls,n56 le [Sfrp2],n53[Dbx1];Gsh2(cid:1)/(cid:1),n54[Sfrp2],n53[Dbx1];Sey/Sey,n54[Sfrp2],n52[Dbx1];Sey/Sey;Gsh2(cid:1)/(cid:1),n54[Sfrp2],n52[Dbx1].Scalebar:200lm. -a b s tra c t/1 9 /4 /7 4 5 /2 7 9 5 2 2 b y g u e s t o n 1 1 A p ril 2 0 1 9 Figure5. ExpressionofSfrp2atE15.5.Sfrp2isexpressedintheVPandlayerVneuronsofthecortex(A,E,arrows).InGsh2mutants,theVPexpressiondomainisexpanded(B, F,arrowheads)butreducedinthelateralcortex(B,F,arrows).InSeymutants,VPexpressionofSfrp2ismissing(asterisks)andlayerVexpressionisdrasticallyreduced(arrows) (C,G).InSey/Gsh2doublemutants,Sfrp2expressionisnotrestoredintheVP(asterisks),andisseverelyreducedinthelateralcortex(arrows)(D,H).nnumbersareasfollows: controls,n56;Gsh2(cid:1)/(cid:1),n54;Sey/Sey,n54;Sey/Sey;Gsh2(cid:1)/(cid:1),n54.Scalebar:200lm. migratoryroutetothebasaltelencephalon(Carneyetal.2006). (Fig. 2J,N). To this end, we sought to examine the expression Therefore, the presence of mTsh1-positive cells along the patterns of Dlx2 and Dlx5, which in addition to marking putative LCS in the Gsh2 mutant in this study is surprising subpallial cells, demonstrate migrating cells of the LCS. At CerebralCortexApril2009,V19N4 751 D o w n lo a d e d fro m h ttp s ://a c a d e m ic .o u p .c o m /c e rc o r/a rtic le -a b s tra c t/1 9 /4 /7 4 Figure6. ExpressionofsecretedfactorTgfaatE13.5andE15.5.TgfaisexpressedintheVPandbasaltelencephalonatE13.5(A,E,arrow).InGsh2mutants,VPexpressionis 5/2 expandedventrally(arrowheads)andbasalexpressionismaintained(arrow)(B,F).InSeymutants,VPexpressionismissing(asterisks)whereasbasalexpressionisunaffected 7 9 (arrows,C,G).VPexpressionremainsabsentinSey/Gsh2doublemutants(asterisks),thoughbasalexpressionispresent(arrows)(D,H).AtE15.5,expressionisobservedinthe 5 2 VPanddifferentiatingstriatum(STR,arrows)(I,M).InGsh2mutants,VPexpressionisexpanded(arrowheads),andaputativeectopicbasalmigrationisobserved(empty 2 arrowheads).Asmallerdomainofexpressionisobservedinthestriatum(J,N,arrows).InSeymutants,VPexpressionismissing(asterisks),althoughstriatalexpressionremains by (arrows)(K,O).InSey/Gsh2doublemutants,expressionattheVPisnotrestored(asterisks),andremainspresentinthestriatum(arrows)(L,P).nnumbersareasfollows: g u controls,n54[E13.5],n54[E15.5];Gsh2(cid:1)/(cid:1),n53[E13.5],n53[E15.5];Sey/Sey,n53[E13.5],n54[E15.5];Sey/Sey;Gsh2(cid:1)/(cid:1),n53[E13.5],n53[E15.5].Scalebar: e s 200lm. t o n 1 1 A p E13.5, Dlx mRNA and protein expression is confined to the In addition to putative migratory defects along the LCS as ril 2 subpallial progenitor zones and postmitotic cells undergoing definedbyDlx2andDlx5expressioninbothSeyandSey/Gsh2 0 1 tangential migration (Supplemental Figs 1 and 2A,E) (Porteus double mutants, we also observe alterations in cortical 9 etal.1991;Bulfone,Kim,etal.1993;Porteusetal.1994;Puelles patterning that is generally consistent with previous observa- et al. 2000; Nery et al. 2003; Carney et al. 2007; Flames et al. tions. At both E13.5 and E15.5, in the Sey mutants, there is 2007). At E15.5, Dlx2 and Dlx5 streams are clearly observed a large ectopic expression of Dlx2 and Dlx5 in the cerebral alongtheLCS(SupplementalFigs1and2I,M).InGsh2mutant cortex indicative of a broad ventralization of the dorsal mice, Dlx2 and Dlx5 expression is truncated along the telencephalon (Supplemental Figs 1 and 2C,G,K,O). In Sey/ emanating LCS (Supplemental Figs 1 and 2J,N) (Szucsik et al. Gsh2 double mutants this phenotype is slightly improved 1997;Corbinetal.2000;Neryetal.2002;Carneyetal.2006).In (Supplemental Figs 1and 2D,H) (Toresson et al.2000). the Sey mutant, there appears to be a large ectopic stream of LCS cells destined for the basal telencephalon that is also Alterations in LCScellmigration inGsh2, Sey,andSey/ consistentwithotherfindings(SupplementalFigs1and2K,O) Gsh2 double mutants atE15.5 (Caubit et al. 2005). This abnormal putative migratory stream To examine defects in cell migration along the LCS in Gsh2, appears to persist in Sey/Gsh2 double mutants (Supplemental Sey, and Sey/Gsh2 double mutant mice, we carried out Fig.1Land Supplemental Fig.2L,P). immunohistochemical analysis for EGFR, which is expressed 752 Pax6andGsh2inPallial--SubpallialBoundaryPatterning d Carneyetal. atthePSBandinmigratingcellsoftheLCS(Caricetal.2001). both rostral and medial levels at E13.5, and at rostral levels at First, we further characterized the cell types of the PSB that E15.5(Fig.8C,G,K).Incontrast,atmediallevelsatE15.5,alow expressEGFR.Tothisend,weperformeddualimmunolabeling level of Gsh1 expression expands into the pallium in Sey experiments to label VZ and SVZ/mantle cells that are pallial- mutants (Fig. 8O). In Sey/Gsh2 double mutants at E13.5 and derived (Pax6+ and Tbr1+) and subpallial-derived (Dlx2+ and E15.5, the dorsal limit of Gsh1 expression resembles that of Dlx5/6+) at E15.5, which represents the time point of robust Gsh2 mutants (Fig. 8D,H,L,P). Thus, Pax6 and Gsh2 act LCScellmigrationofbothpopulations(Carneyetal.2006).We combinatorially to repress Gsh1 expression in the ventral and observe that many EGFR+ cells at the PSB also express Pax6 lateral pallium. (Fig. 7A,B) and a minority colocalize with the pallial mantle marker Tbr1 (Fig. 7C,D). To analyze whether the subpallial Discussion progenitors also coexpress EGFR, EGFR immunolabeling was combined with b-gal immunohistochemistry in sections from Gene expression studies have revealed that the embryonic Dlx2+/tauLacZ mice or colocalization with endogenous GFP telencephalon can be parcellated into refined molecular maps from Dlx5/6-GFP mice. WefoundthatmanyEGFR+cellsatthe (Puelles et al. 2000; Medina et al. 2004; Flames et al. 2007). Do w PSBarealsob-gal+,indicatingthatthesecellsareDlx2+(Fig.7E,F). Combined with in utero transplantation and genetic fate n Incontrast,Dlx5/6-GFP+cellsdonotexpressEGFR(Fig.7G,H). mapping studies this work has unraveled the correlation loa d Although this was somewhat surprising, it has been previously between specific subpallial progenitor pools and the diversity ed shownthatnotallDlx2+cellsalsoexpressDlx5(Eisenstatetal. of cortical interneurons in the adult brain (Nery et al. 2002; fro 1999),thustheDlx2+/EGFR+populationmaybeasubsetofthis Buttetal.2005;Flamesetal.2007;Fogartyetal.2007;Wonders m h subpallial Dlx2+/Dlx5/6- population. Alternatively, this EGFR+ et al. 2008, Xu et al. 2008). This restricted potential of neural ttp PpSoBputhlaattioarnemalsaoyPaalsxo6+be(Cpaarrnteoyfetthael.2su0b0s6e)t.ToafkDenlxt2o+gectehlelsr,atthtehsee p20ro0g7e)n.itMoorsreiosvearls,otomaainltaarigneedexintenatdumlthajooorda(sMpeecrtksleofetthael. s://ac a datasuggestthatEGFR+cellsoftheLCSarisefromprogenitorsof functionofbothintrinsicandextrinsickeyplayersthatpattern de boththepallialandsubpallialaspectofthePSB. the telencephalon have been elucidated. However, our un- mic We next examined the status of the EGFR+ LCS population derstanding of the genetic mechanisms that pattern specific .o u and the radial glial scaffold in Gsh2, Pax6, and Sey/Gsh2 telencephalicprogenitorzones,suchasPSB,remainunknown. p.c mutantsbydualimmunolabelingforEGFRandRC2atE15.5.In In this study, we examined the development of the PSB, an om controls,strongRC2expressiondefinestheradialglialscaffold important progenitor domain for the OB, amygdala and early /c e of the LCS migratory route to the basal telencephalon, and cerebral cortical Cajal--Retzius populations. Our studies reveal rc o EGFR+ cells are observed at the PSB and along the LCS that the PSB is a highly complex and dynamic telencephalic r/a (Fig. 7I,M). In Gsh2 mutant mice, the RC2+ radial glia scaffold progenitor zone, comprised of multiple molecularly distinct rtic appears to occupy a larger domain at the PSB, concomitant progenitor pools. We also provide novel insight into the le-a with a wider domain of EGFR+ cells in the LGE and the LCS geneticregulation of their specification byPax6and Gsh2. bs (Fig. 7J,N). Conversely, in Sey mutants, the fasciculated RC2+ tra c processes of the LCS radial glia scaffold are missing, and RC2 Combinatorial Codes ofGene Expression DefineUnique t/1 9 labelingappearsdiffuse(Fig.7K,O)(Stoykovaetal.1997).Also, Progenitor Domains atthe PSB /4 thereisastrikingabsenceofEGFRexpressionbothatthePSB Theimportanceofintrinsicspecificationforneuronaloutputin /74 5 and in the LCS in Sey mutants (Fig. 7K). In Sey/Gsh2 double the cerebral cortex was first suggested by the ‘‘protomap’’ /2 mutants,theRC2+immunolabelingalsoappearsdiffuse,similar theory (Rakic 1988). Furthermore, the parcellation of pro- 79 5 totheSeymutant.Interestingly,EGFRexpressionisrestoredin genitor domains and the generation of restricted neuronal 2 2 the double mutant, although EGFR+ cells appear scattered in diversitywerefirstappreciatedinthespinalcord(reviewedin b y the LGE and LCS (Fig. 7L,P). This observation is similar to the Jessell 2000). Collectively, these studies defined a paradigm in gu e restoration of Dbx1 expression in the LGE in Sey/Gsh2 whichregionalexpressionofkeygenes(typicallytranscription s mutants (Fig. 4), and reveals that the loss of EGFR expression factors) instruct cell fate decisions in a cell-autonomous t on at the PSB and LCS in Sey mutant mice is a consequence of manner, before or at the last cell division (reviewed in Dehay 11 ectopicGsh2 expression. andKennedy2007).Amajorpredictionofthesestudiesisthat A p progenitorpoolsexpresscombinationsoftranscriptionfactors, ril 2 Gsh1expressioninsingleSey,Gsh2,andSey/Gsh2double whichendowthesecellswithuniquefatepotentials.Basedon 0 1 mutants this idea, recent studies have comprehensively explored gene 9 Previously it has been shown that Gsh1 can rescue many, but expression patterns of putative instructive factors in the not all, of the subpallial patterning defects in found in Gsh2 subpallial proliferative zones. One study defined at least 18 mutants starting at around E14 (Toresson and Campbell 2001; molecular distinct progenitor domains in the embryonic Yun et al. 2001, 2003). As described previously (Toresson and subpallium(Flamesetal.2007).Moreover,atembryonicstages, Campbell 2001), and shown here at E13.5 and E15.5, Gsh1 is postmitotic subpallial-derived cells express genes which normally expressed at high levels in the medial ganglionic encode proteins of a characteristically mature neuronal eminence (MGE) and ventral LGE, with intense expression in phenotype as early as E13.5 (Batista-Brito, Machold, et al. theVZandinscatteredcellsintheSVZ(Fig.8A,E,I,M).InGsh2 2008). Collectively, these analyses have provided both an mutant mice at E13.5, high levels of expression extend to the important reference and context to consider the spatio- PSB, most prominent at rostral levels (Fig. 8B,F). At E15.5 in temporal and genetic origins of neural diversity. However, to Gsh2mutantmice,highlevelsofGsh1expressionextendinto a large extent such studies have focused on the MGE, which the VP (Fig. 8J,N). In contrast, in the Sey mutant, this dorsal generates the majority of cortical interneurons (Sussel et al. limit of expression of Gsh1 is located much more ventrally at 1999). CerebralCortexApril2009,V19N4 753 D o w n lo a d e d fro m h ttp s ://a c a d e m ic .o u p .c o m /c e rc o r/a rtic le -a b s tra c t/1 9 /4 /7 4 5 /2 7 9 5 2 2 b y g u e s t o n 1 1 A p Figure7. AlterationsinLCScellmigrationinGsh2,Sey,andSey/Gsh2doublemutantsatE15.5.LowmagnificationofdualimmunolabelingforPax6(green,A),Tbr1(green,C), ril 2 Dlx2(green,E)andEGFR(red)showscoexpressionofasubsetofcellsatthePSB(A,C,E).Highermagnificationofboxedregionsin(A,C,E)showindividualdoubleEGFRþcells 0 1 (arrows)colocalizedwithPax6(B,arrows),Tbr1(D,arrows),orDlx2(F,arrows)intermingledwithEGFRþcellsnotexpressinganyofthesemarkers(arrowheads).Incontrast, 9 thereisnocolocalizationofendogenousDlx5/6-GFPlabeling(green,arrows)andEGFRimmunolabeling(red,arrowheads)(G,H).RC2(green)andEGFR(red)dualimmunolabeling revealstheLCSradialglialscaffold(arrows)andEGFRþmigratorycells(arrowheads)emanatingfromthePSB(emptyarrowheads)(I,M).InGsh2mutants,theVZEGFRþ domainappearsexpanded(emptyarrowheads),withamorediffuseRC2immunolabeling(arrows)(J,N).EGFRþcells(arrowheads),althoughdisorganized,remainpresentalong theLCS.InSeymutants,EGFRþcellsarecompletelyabsent,andtheRC2þradialgliaalongtheLCSmigratoryrouteismissing(K,O,arrows).InSey/Gsh2doublemutants, RC2þradialglia(arrows)resembleSeymutants,butEGFRþcellsarenowpresentalongtheLCS(arrowheads)andoccupyanexpandeddomainatthePSB(emptyarrowheads) (L,P).To-Pro-3counterstaining(blue)isshowninthemajorityofpanels.nnumbersareasfollows:EGFRandPax6orDlx2orTbr1,n52;EGFR/Dlx5/6-GFP,n52;EGFR/RC2: controls,n53;Gsh2(cid:1)/(cid:1),n53;Sey/Sey,n54;Sey/Sey;Gsh2(cid:1)/(cid:1),n53.Scalebar:A,C,E,G,M--P:100lm,I--L:40lm,B,D,F,H:30lm. In this study, we sought to extensively examine the gene expression. These combinatorial expression patterns molecular code of gene expression of the PSB. Our analysis highlight the importance of the PSB as a unique and highly using a battery of markers that delineate the dLGE (mTsh1, heterogeneous telencephalic progenitor domain. Moreover Sp8), VP (Sfrp2, Tgfa, and Dbx1), or both (Er81) subdomains considering that the PSB is a major source of cells that reveals that the PSB also contains highly regulated patterns of generates neuronal cell diversity in the limbic system and OB, 754 Pax6andGsh2inPallial--SubpallialBoundaryPatterning d Carneyetal.

See more

The list of books you might like