loading

Logout succeed

Logout succeed. See you again!

ebook img

Supporting Information A biocatalytic cascade for the amination of unfunctionalised cycloalkanes PDF

pages37 Pages
release year2017
file size3.12 MB
languageEnglish

Preview Supporting Information A biocatalytic cascade for the amination of unfunctionalised cycloalkanes

Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is © The Royal Society of Chemistry 2017 Supporting Information A biocatalytic cascade for the amination of unfunctionalised cycloalkanes Michele Tavanti,a Juan Mangas-Sanchez,a Sarah L. Montgomery,a Matthew P. Thompsona and Nicholas J. Turner*a a School of Chemistry, University of Manchester, Manchester Institute of Biotechnology, 131 Princess Street, Manchester M1 7DN (UK) E-mail: [email protected] CONTENTS EXPERIMENTAL.....................................................................................................................................................3 MATERIALS...................................................................................................................................................................3 MOLECULAR BIOLOGY METHODS.......................................................................................................................................3 PROTEIN PRODUCTION AND PURIFICATION..........................................................................................................................4 P450......................................................................................................................................................................4 TeSADH W110A and CboFDH................................................................................................................................5 AspRedAm.............................................................................................................................................................5 DETERMINATION OF VOLUMETRIC ENZYMATIC ACTIVITIES.......................................................................................................5 CHEMICAL SYNTHESIS AND CHARACTERISATION....................................................................................................................6 Synthetic procedures.............................................................................................................................................6 Reductive amination procedure for the preparation of amine products 4c-d and 5c........................................................6 Reductive amination procedure for the preparation of amine products 4f........................................................................6 Typical procedure for RedAm-catalysed reductive amination............................................................................................6 Spectroscopical characterisation..........................................................................................................................7 N-propargylcyclopentylamine 4c.........................................................................................................................................8 N-allylcyclopentylamine 4e.................................................................................................................................................9 N-cyclopropylcyclopentylamine 4f....................................................................................................................................10 N-propargylcycloheptylamine 5c.......................................................................................................................................11 BIOCATALYTIC CASCADE FOR THE AMINATION OF CYCLOALKANES............................................................................................12 Amine inhibition studies......................................................................................................................................12 One-step process.................................................................................................................................................12 Two-step process................................................................................................................................................13 Preparative-scale production of N-propargylcyclohexylamine 1c by two-step amination cascade with cyclohexane and propargylamine c....................................................................................................................13 ANALYTICS..................................................................................................................................................................14 SUPPORTING FIGURES AND TABLES....................................................................................................................16 GC-FID CHROMATOGRAMS AND GC-MS TRACES..............................................................................................................22 GC-FID chromatograms......................................................................................................................................22 GC-MS traces......................................................................................................................................................33 By-product analysis...........................................................................................................................................................33 Reductive amination of cyclooctanone with allylamine e.................................................................................................36 REFERENCES.......................................................................................................................................................37 S1 1 4 5 10 OH O HO O O OH O 2 3 6 8 7 9 11 H N NH3 NH2 NH2 H2N 2 NH2 a b c d e f NH2 HN HN HN HN HN 1a 1b 1c 1d 1e 1f HN HN HN HN HN 4c 4e 4f 5c 5f List of substrates and products mentioned in the text. S2 Experimental Materials Solvents, commercially available chemicals and carbon monoxide for CO difference spectroscopy were obtained from Sigma-Aldrich (Poole, Dorset, UK). Gases for GC-FID analysis were purchased from BOC gases (Guildford, UK). Chemically competent cells and enzymes for molecular biology were purchased from New England Biolabs (Hitchin, UK). Terrific Broth Base autoinduction medium including trace elements (TB-AIM) was purchased from Formedium (Hunstanton, UK). Molecular biology methods Custom primer synthesis and plasmid DNA sequencing were performed by Eurofins Genomics. Primers employed in this work are given below (mismatching bases are given in red). Primer 5’->3’ sequence R47L Y51F for, Tm=66°C AGGCGCCTGGTCTGGTAACGCGCTTCTTATCAAGTCAGCGTC R47L Y51F rev, Tm=63°C CGAATTTAAAGATTTCTCCTAATTCATCCGCAATTTTCATCAAAGC R966D for, Tm=60°C CCGCTTTTTCTGACATGCCAAATCAGCCGAAAAC R966D rev, Tm=64°C TATGAAGCGTAATGATGCCTTCGCTTTGGG W1046S for, Tm= 59°C CAAAAGACGTGTCGGCTGGGTAACTCG W1046S rev, Tm= 61°C CGTATCGGCCTTTTTCTTCTAGCTGC Target mutations were introduced by inverse PCR using Eppendorf Mastercycler Gradient thermal cyclers, with buffers and enzymes supplied in the Phusion DNA Polymerase kit (NEB). Reactions (50 μL) were carried out in thin-walled 200 μL PCR tubes following manufacturer instructions. Next, template DNA was removed by a 2 h digestion with DpnI followed by PCR purification (QIAquick PCR Purification Kit). Ligation reactions were performed for 1 h at 25°C with T4 DNA ligase and polynucleotide kinase. NEB 5-alpha competent E.coli (high efficiency) were then transformed according to manufacturer instruction, single colonies picked and grown in 5 mL Luria-Bertani medium (LB) containing 50 µg/mL kanamycin for 16 h, plasmid DNA isolated using a mini-prep kit (Qiagen) and sequence verified by plasmid sequencing. S3 Protein production and purification Chemically competent E. coli BL21 (DE3) were transformed by heat shock with a pET28a vector (or pET28b for TeSADH W110A) encoding the desired N-terminal polyhistidine tagged enzyme under a T7 promoter. Transformants were grown on LB agar with 50 µg/ml kanamycin at 37°C for 16 hours. Starter cultures were prepared in LB medium with 50 µg/ml kanamycin at 37°C for 16 hours by picking single colonies from agar plates. P450 Expression cultures (800 mL, TB-AIM) were inoculated with 8 mL starter culture and cells grown at 37°C 200 rpm until OD = 0.8 was reached. At this stage, 5-Aminolevulinic acid hydrochloride (5-ALA, 0.5 mM) 600 was added and the growth continued at 20°C. After 20 h, cells were harvested by centrifugation (2500 g, 20 min, 4 °C) and kept at -20 °C until further use. For protein purification, cells were resuspended in 90% buffer A (Tris-HCl 0.1 M, 0.3 M NaCl, pH 8) and 10% buffer B (Tris-HCl 0.1 M, 0.3 M NaCl, 0.3 M imidazole, pH 8) to a final concentration of 200 mg/mL cell wet weight. Cells were lysed by ultrasonication with a Bandelin Sonopuls sonicator (20 cycles, 15 s on and 45 s off, 40 % amplitude) and the supernatant obtained by ultracentrifugation (48384 g, 30 min, 4 °C). Filtration of the supernatant was performed with a 0.45 μm filter before loading onto a pre-equilibrated 5 mL HisTrap FF column (GE Healthcare). The target protein was purified using an ÄKTA Pure system (GE Healthcare) operated at 2 mL min-1 following a series of step reported in the table below: Step % B Column volumes Wash 1 10 5 Wash 2 20 5 Elution 100 10 Re-equilibration 0 5 Protein elution was followed at 280 nm, fractions collected and desalted in 0.2 M Tris-HCl, pH 8 with a 30,000 molecular weight cut-off filter (Vivaspin column, GE Healthcare). Protein concentration was either determined by CO-difference spectroscopy (P450) following the method of Omura and Sato1 or spectrofotometrically (TeSADH W110A: ε=25600 M-1 cm-1; CboFDH ε=51465 M-1 cm-1; AspRedAm ε= 24410 M-1 cm-1 , wavelength λ=280 nm). Typically, proteins were stored at -80°C as stocks at 10 mg mL-1 protein concentration. When crude enzyme preparations were used to carry out biotransformation, cells were resuspended in 0.2 M Tris-HCl pH 8 to 200 mg mL-1 cell wet weight and lysed as described above. The supernatant obtained after ultracentrifugation was either used without further purification or concentrated until the desired protein concentration/enzymatic activity was attained. S4 TeSADH W110A and CboFDH Expression cultures (400 mL, TB-AIM) were inoculated with 4 mL starter culture and cells grown at 37°C 250 rpm for 24 h. Cells harvesting, storage and purification were performed as reported above. For lyophilization of TeSADH W110A cell free extracts (CFE), cells were resuspended in 50 mM potassium phosphate buffer, 0.5 M NaCl, pH 7.5 to a final concentration of 300 mg/mL cell wet weight and lysed by ultrasonication as described above. The supernatant obtained by ultracentrifugation was frozen in liquid nitrogen before freeze-drying for two days (Heto Powerdry LL 1500, Thermo Electron Corporation). AspRedAm Expression cultures (600 mL, 2-YT broth) were inoculated with 6 mL starter culture and cells grown at 37°C 250 rpm until OD = 0.8 was reached. At this stage, isopropyl β-D-1-thiogalactopyranoside (IPTG, 600 0.4 mM) was added to induce protein expression and the growth continued at 20°C. Cells harvesting, storage and purification were performed as reported above. Determination of volumetric enzymatic activities Volumetric activities were determined by monitoring NAD(P)H formation using a microtitre plate reader (Infinite M200 Pro, Tecan, Männedorf, Switzerland) under the following conditions: Tris-HCl 0.2 M, pH 8, 1 mM NAD+ (CboFDH) or NADP+ (TeSADH W110A), 250 mM formate (CboFDH) or 30 mM cyclohexanol (final 4% v/v DMSO for TeSADH W110A), 20 μL CFE, 200 μL final volume, 22°C. Formation of the reduced cofactor was followed for 1 minute, and the volumetric units (U mL-1, defined as the quantity of enzyme that reduces 1 μmol of oxidized cofactor in 1 min) were calculated from slopes of NAD(P)H formation calculated over 10-30 s using ε = 6.22 mM-1 cm-1 and a pathlength of 0.55 cm. NADH S5 Chemical synthesis and characterisation Synthetic procedures Compounds 1a-b were purchased from commercial suppliers. Preparation and spectroscopic characterisation for compounds 1c-f are reported in Aleku et al.2 Reductive amination procedure for the preparation of amine products 4c-d and 5c To a solution of the corresponding ketone (2.0 mmol) in dry THF (5 mL) under N were added the 2 corresponding amine (2.2 mmol), sodium triacetoxyborohydride (0.636 g, 3.0 mmol) and glacial acetic acid (0.114 mL, 2.0 mmol). The reaction was stirred for 16 hours at 20°C under N then carefully 2 quenched by addition of 1 M aqueous HCl (10 mL). Ethyl acetate (EtOAc, 10 mL) was added and the phases separated. The aqueous phase was extracted with a further portion of EtOAc (10 mL). The aqueous phase was then basified to pH 12 by addition of 5 M NaOH. The product was extracted into EtOAc (2 x 20 mL). The organic phase was dried over anhydrous MgSO and the solvent removed under 4 reduced pressure to afford the corresponding amine products with no further purification required. Reductive amination procedure for the preparation of amine products 4f To a stirred flask of cyclopentanone (0.2 g, 2.4 mmol) in dry methanol (MeOH, 10 mL) over 4 Å molecular seives under nitrogen was added cyclopropylamine (0.332 mL, 4.8 mmol). The reaction was stirred at room temperature overnight, after which NaBH (0.181 g, 4.8 mmol) was added over 10 minutes. The 4 mixture was stirrer for a further 2 hours, then the solvent was removed under reduced pressure. The resulting slurry was resuspended in EtOAc (20 mL), filtered then extracted twice with 1 M HCl. The aqueous phase was then basified (pH 12) with 5 M NaOH and extracted three times with EtOAc. The organic phases were combined, dried over MgSO and the solvent removed under reduced pressure to 4 afford the title compound as a yellow oil. Typical procedure for RedAm-catalysed reductive amination A 500 µL reaction mixture contained 20 mM D-glucose, 0.5 mg mL-1 GDH (Codexis, CDX-901), 0.5 mM NADP+, 1 mg mL-1 purified RedAm, 5 mM ketone, 100 mM amine nucleophile (in Tris-HCl buffer adjusted to pH 9) and 2 % v/v DMSO. Reactions were incubated at 30 °C with 250 rpm shaking for 24 h, after which they were quenched by the addition of 30 μL of 10M NaOH and extracted twice with 500 μL methyl tert-butyl ether (MTBE). The organic fractions were combined and dried over anhydrous MgSO and 4 analysed by GC-FID. S6 Spectroscopical characterisation Spectra from 1H and 13C NMR runs were recorded on a Bruker Avance 400 instrument (400 MHz for 1H and 100 MHz for 13C) in CDCl using residual protic solvent as an internal standard. Reported chemical 3 shifts (δ) (in parts per million (ppm)) are relative to the residual protic solvent signal (CHCl in CDCl , 1H = 3 3 7.26; 13C = 77.0). High-resolution mass spectrometry (HRMS) was recorded using a Waters LCT time-of-flight mass spectrometer, connected to a Waters Alliance LC (Waters, Milford, MA, USA). Data were processed with Waters Masslynx software. S7 N-propargylcyclopentylamine 4c Brown oil isolated, 12% yield. 1H NMR δ (400 MHz, CDCl ) 3.41 (d, J = 2.5 Hz, 2H), 3.29 (quint, J = 11.2 Hz, 1H), H 3 2.20 (t, J = 2.5 Hz, 1H), 1.80 – 1.44 (m, 9H). 13C NMR δ (100 MHz CDCl ) 82.46 (C), 70.98 (CH), 58.18 (CH), 36.79 C 3 (CH ), 32.80 (CH ), 24.06 (CH ). HRMS calcd. for C H N+ 124.1121 [M+H]+, found 124.1099. 2 2 2 8 14 NH 8.5 8.0 7.5 7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0 (ppm) NH 110 105 100 95 90 85 80 75 70 65 60 55 50 45 40 35 30 25 20 15 10 5 0 (ppm) S8 N-allylcyclopentylamine 4e Yellow oil isolated, 58% yield. 1H NMR δ (400 MHz, CDCl ) 6.01 – 5.70 (m, 1H), 5.27 – 4.96 (m, 2H), 4.07 – 3.65 (m, H 3 1H), 3.22 (dt, J = 6.1, 1.4 Hz, 1H), 3.08 (p, J = 6.8 Hz, 1H), 1.92 – 1.73 (m, 2H), 1.77 – 1.57 (m, 2H), 1.59 – 1.44 (m, 2H), 1.31 (ddd, J = 13.3, 7.6, 4.0 Hz, 2H).. 13C NMR δ (100 MHz CDCl ) 137.3 (CH), 115.7 (CH ), 59.4 (CH), 51.4 C 3 2 (CH ), 42.2 (CH ), 33.3 (CH ), 24.2 (CH ), 23.4 (CH ). HRMS calcd. for C H N+ 126.1277 [M+H]+, found 126.1265. 2 2 2 2 2 8 16 NH 9.5 9.0 8.5 8.0 7.5 7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0 (ppm) NH 160 150 140 130 120 110 100 90 80 70 60 50 40 30 20 10 0 (ppm) S9 N-cyclopropylcyclopentylamine 4f Yellow oil isolated, 64% yield. 1H NMR δ (400 MHz, CDCl ) 3.02 (quin, J = 6.9 Hz, 1H), 1.99 – 1.94 (m, 1H), 1.76 – H 3 1.69 (m, 2H), 1.61 – 1.56 (s, 1H), 1.55 – 1.45 (m, H), 1.43 – 1.33 (m, 2H), 1.23 – 1.15 (m, 2H), 0.32 – 0.17 (m, 4H). 13C NMR δ (100 MHz CDCl ) 60.13 (CH), 33.12 (CH ), 29.39 (CH), 23.76 (CH ), 6.16 (CH ). HRMS calcd. for C 3 2 2 2 C H N+ 126.1204 [M+H]+, found 126.1281. 8 16 NH 8.0 7.5 7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0 (ppm) NH 100 95 90 85 80 75 70 65 60 55 50 45 40 35 30 25 20 15 10 5 0 -5 -10 (ppm) S10

See more

The list of books you might like