loading

Logout succeed

Logout succeed. See you again!

ebook img

Sustained miRNA-mediated Knockdown of Mutant AAT With Simultaneous Augmentation of Wild-type AAT Has Minimal Effect on Global Liver miRNA Profiles. PDF

file size1 MB
languageEnglish

Preview Sustained miRNA-mediated Knockdown of Mutant AAT With Simultaneous Augmentation of Wild-type AAT Has Minimal Effect on Global Liver miRNA Profiles.

original article © The American Society of Gene & Cell Therapy MTOpen Sustained miRNA-mediated Knockdown of Mutant AAT With Simultaneous Augmentation of Wild-type AAT Has Minimal Effect on Global Liver miRNA Profiles Christian Mueller1, Qiushi Tang1,2, Alisha Gruntman1, Keith Blomenkamp3, Jeffery Teckman3, Lina Song1, Phillip D Zamore4 and Terence R Flotte1 1Department of Pediatrics and Gene Therapy Center, UMass Medical School, Worcester, Massachusetts, USA; 2Population Life Science and Technology Research Institute of Jilin Province, Changchun, China; 3Department of Pediatrics, St. Louis University, St. Louis, Missouri, USA; 4Department of Biochemistry and Molecular Pharmacology, UMass Medical School, Worcester, Massachusetts, USA α-1 antitrypsin (AAT) deficiency can exhibit two patho- number of metalloproteinases and other proinflammatory and logic states: a lung disease that is primarily due to the proapoptotic molecules. AAT is normally produced within hepa- loss of AAT’s antiprotease function, and a liver disease tocytes and macrophages, where hepatocyte-derived AAT forms resulting from a toxic gain-of-function of the PiZ-AAT the bulk of the physiologic reserve of AAT. Approximately 4% of (Z-AAT) mutant protein. We have developed several North American and Northern European populations possess at recombinant adeno-associated virus (rAAV) vectors that least one copy of a mutant allele, known as PI*Z (Z-AAT) which incorporate microRNA (miRNA) sequences targeting the results from a single amino acid substitution of lysine for gluta- AAT gene while also driving the expression of miRNA- mate at position 342. In the homozygous state, this mutation leads resistant wild-type AAT-PiM (M-AAT) gene, thus achiev- to severe deficiency of AAT, resulting in a lung disease that is pri- ing concomitant Z-AAT knockdown in the liver and marily due to the loss of antiprotease function and a liver disease increased expression of M-AAT. Transgenic mice express- (lifetime risk of developing liver disease is as high as 50%.) result- ing the human PiZ allele treated with dual-function ing from a toxic gain of function of the Z-AAT mutant protein.1 rAAV9 vectors showed that serum PiZ was stably and Mutant Z-AAT lacks a crucial salt-bridge in a β-sheet region of the persistently reduced by an average of 80%. Treated ani- protein, allowing for the insertion of the reactive loop of a neigh- mals showed knockdown of Z-AAT in liver and serum boring AAT molecule in between the two β-sheets,2 resulting in a with concomitant increased serum M-AAT as determined very stable loop–sheet polymer.3 This polymer accumulates within by allele-specific enzyme-linked immunosorbent assays hepatocytes, resulting in serum deficiency due to inefficient secre- (ELISAs). In addition, decreased globular accumulation tion. In individuals affected by AAT liver disease, it also triggers of misfolded Z-AAT in hepatocytes and a reduction in mitochondrial injury, caspase activation, autophagy and apoptosis within the hepatocyte, likely the result of endoplasmic reticulum inflammatory infiltrates in the liver was observed. Results accumulation.4–6 However, the details remain unclear, as does the from microarray studies demonstrate that endogenous reason for the disparity between those Z-homozygotic individu- miRNAs were minimally affected by this treatment. These als who develop liver disease and those who do not. Nevertheless, data suggests that miRNA mediated knockdown does there is consensus that molecular therapies for AAT liver disease not saturate the miRNA pathway as has been seen with should act by downregulating Z-AAT. viral vector expression of short hairpin RNAs (shRNAs). Our group has developed two investigational clinical gene ther- This safe dual-therapy approach can be applied to other apy products for gene augmentation of AAT as a potential therapy disorders such as amyotrophic lateral sclerosis, Hunting- for the lung disease by using the recombinant adeno-associated ton disease, cerebral ataxia, and optic atrophies. viral vectors (rAAV2-AAT and rAAV1-AAT).7,8 However, because Received 28 September 2011; accepted 8 December 2011; published online a decrease in the expression of Pi*Z mutant protein is required 17 January 2012. doi:10.1038/mt.2011.292 to halt or ameliorate the hepatocellular damage, researchers tried to downregulate AAT messenger RNA (mRNA). One approach IntroductIon was to utilize hammerhead ribozymes designed to cleave AAT α-1 antitrypsin (AAT) is one of the primary circulating serum mRNA at a specific site.9 Another approach, is the application of antiproteases in humans. It inhibits a variety of serine protei- RNA interference (RNAi) to decrease levels of the mutant mRNA nases, with neutrophil elastase being one of the most physiologi- transcript.10 In our lab, small short hairpin RNAs (shRNAs) were cally important due to its role in lung infections, and inhibits a designed to downregulate endogenous AAT within hepatocytes.11 Correspondence: Christian Mueller, Pediatrics and Gene Therapy Center, University of Massachusetts Medical School, 381 Plantation Street, Suite 250, Worcester, Massachusetts 01605, USA. E-mail: [email protected] 590 www.moleculartherapy.org vol. 20 no. 3, 590–600 mar. 2012 © The American Society of Gene & Cell Therapy Knockdown and Augmentation of AAT and Its Effects Although this strategy proved effective, the optimal approach results would be one that knocks down PiZ protein while at the same Artificial mirnAs efficiently downregulate AAt in vitro time increasing M-AAT protein. Our initial shRNA experiments Previously we had demonstrated efficient Z-AAT knockdown relied on polymerase III U6-based promoters and did not show in vivo and in vitro using shRNAs expressed from a polymerase any liver-associated toxicity although we only followed mice for III U6 promoter with rAAV8.11 To determine an alternative and 4 weeks post shRNA delivery. However other groups have impli- potentially safer approach with polymerase II-driven miRNA cated AAV-mediated shRNA delivery with toxic side-effects, in expression, we cloned three distinct miRNAs targeting the human one instance shRNA delivery to liver was associated with toxic- AAT gene within the intron of a hybrid chicken β-actin (CB) pro- ity only when shRNAs greater that 19 base pairs in length.12,13 In moter driving green fluorescent protein (GFP) expression (Table 1 addition to controlling for the length of the shRNA it has also and Figure 1a,b). The artificial miRNAs are based on the miR-155 been shown that toxicity can be avoided employing RNAi with backbone and have been designed to specifically target the coding microRNAs (miRNAs) instead of shRNAs.14 Despite this, recently sequence of human AAT gene. We compared in vitro the previ- bicistronic AAV vectors expressing shRNAs against PiZ AAT ously used U6-driven shRNAs and the polymerase II-driven miR- and a codon-optimized AAT gene have been evaluated in mice. NAs in cell lines expressing the human Pi*Z AAT gene. By 48 and However the study had several limitations, mainly serum AAT 72 hours of incubation, we noted a comparable ~35% reduction protein detection showing effective knockdown of mutant and in secreted AAT protein for both constructs, as compared to GFP concomitant augmentation of normal AAT was not clearly dem- controls (Figure 1a). A similar reduction was observed in intrac- onstrated and was only convincingly shown by mRNA transcript ellular AAT protein levels assayed from the cell pellets at 72 hours analysis. In addition, these studies were limited to a duration of 2 (Figure 1b). weeks post AAV delivery and did not address long-term sustained knockdown and augmentation therapy or previous finding with rAAV9 expressed mirnAs mediate efficient shRNA-mediated liver toxicity.15 AAt knockdown in vivo We have therefore examined a number of approaches for On the basis of our in vitro findings, we packaged the construct long-term expression of therapeutic miRNAs using the rAAV with the three intronic miRNA sequences (intronCB-3XmiR) platform. miRNAs are single-stranded RNA molecules of about along with three other constructs containing the individual 21–23 nucleotides in length, that are able to regulate gene expres- miRNAs directed against the Z-AAT in rAAV and tested in vivo sion. These regulatory RNA molecules, which can be found in the in the PiZ-transgenic mice. These transgenic mice were previ- intronic regions of protein coding genes of mammals, from stem ously generated by introducing the 14.4 kb human PiZ AAT loop structures that are recognized by a protein complex known gene which included 2.0 and 2.3 kb of the 5′ and 3′ untranslated as the microprocessor. This complex, consisting of the nuclease regions into the germline of mice. The resulting mice are thus Drosha and the RNA-binding domain DGCR8, recognizes the able to express human AAT in a tissue-specific manner with pri-miRNAs stem loops and cleaves them out.16 The resulting pre- normal regulation of gene transcription.18 In humans, normal miRNAs are then exported out of the nucleus into the cytoplasm serum AAT levels range between 104–276 mg/dl and in homozy- where they are processed by Dicer resulting in a mature 21–23 gous PiZ patients the median value is around 28 mg/dl, our PiZ nucleotide miRNA that then enters the RNA-induced silenc- mouse colony has higher circulating levels of Z-AAT at around ing complex thereby silencing its mRNA target.17 We have taken 90 mg/dl, probably owing to the fact that transgenic mice usu- advantage of this pathway by altering the sequence of miR-155 to ally have more than two copies of the transgene inserted into the create artificial miRNAs that target the human AAT gene. genome. Regardless, these mice model the human liver pathol- Although it is feasible to simultaneously direct silencing ogy quite faithfully. Five groups of 5-week-old mice received: agents to the liver to decrease Z-AAT expression and direct gene rAAV9-CB-GFP, rAAV9-intronCB-3xmiR-GFP or vector with augmentation to other sites, the liver is also the optimal target tis- either one of the individual miRNA via a tail vein injection with sue for augmentation. Thus, here we demonstrate a miRNA-based 5.0 × 1011 virus particles (vps) of rAAV9. Mice were bled weekly approach to stably downregulate Z-AAT within hepatocytes that for 5 weeks to check for circulating Z-AAT and were killed on allows for simultaneous M-AAT gene augmentation from the day 35 after rAAV delivery. Serum PiZ levels were then ana- same rAAV gene delivery vector without serious perturbation of lyzed for each time point and graphed as percent change from the overall hepatic miRNA profile. the control GFP injected mice at the respective time point. As table 1 Artificial mirnA sequences AAt gene start site mir-155 5′ flanking sequence targeting stem loop mir-155 3′ flanking sequence 910 CCTGGAGGCTTGCTGAAGGCT TAAGCTGGCAGACCTTCTGTCGTTTTGGC CAGGACACAAGGCCTGTTACTAGCA GTATGCTG CACTGACTGACGACAGAAGCTGCCAGCTTA CTCACATGGAACAAATGGCCTCTAGA 914 CCTGGAGGCTTGCTGAAGGCT AATGTAAGCTGGCAGACCTTCGTTTTGGC CAGGACACAAGGCCTGTTACTAGCA GTATGCTG CACTGACTGACGAAGGTCTCAGCTTACATT CTCACATGGAACAAATGGCCTCTAGA 943 CCTGGAGGCTTGCTGAAGGCT ATAGGTTCCAGTAATGGACAGGTTTTGGC CAGGACACAAGGCCTGTTACTAGCA GTATGCTG CACTGACTGACCTGTCCATCTGGAACCTA CTCACATGGAACAAATGGCCTCTAGA Abbrevations: AAT, α-1 antitrypsin; miRNA, microRNA. Molecular Therapy vol. 20 no. 3 mar. 2012 591 © The American Society of Gene & Cell Therapy Knockdown and Augmentation of AAT and Its Effects a 1,200 35% b 40 35% g/ml)1,000 U6-3XshRNA Intronic-3XmiR nts (n IGnFtrPon-cico-n3tXromliR ml) 35 UG6F-P3-XcsohnRtrNolA ernata 800 * et (ng/ ell sup 600 ell pell 30 * AAT in c 400 AAT in c 25 200 24 48 72 20 Time (hours) c miR-AAT.910 miR-AAT.910 CMVCβ-actin GFP pA miR-AAT.914 miR-AAT.943 Intronic-3XmiR miR-AAT.914 CMVCβ-actin GFP pA 40 miR-AAT.943 CMV Cβ-actin GFP pA 20 Intronic-3XmiR CMV Cβ-actin GFP pA s a knockdown P controls) –200 10 Time2 (0days) 30 ** 40 m level (% ared to GF –40 ** Z serucomp –60 Pi –80 –100 Figure 1 MicrornA mediated knockdown of human AAt. HEK-293 cells were contrasfected with human Z-AAT plasmid and either a plasmid expressing three anti-AAT shRNAs from a U6 promoter or a plasmid expressing three anti-AAT miRNA from a hybrid chicken β-actin promoter. (a) Culture media was harvested at 24, 48, and 72 hours and was analyzed for the AAT concentration by ELISA. (b) At 72 hours cells were harvested and lysed for AAT concentration by ELISA. *≤0.05 as determined by a two-way unpaired Student’s t-test. (c) Transgenic mice expressing the human PiZ allele were injected with 5 × 1011 virus particles of a rAAV9 control GFP vector or rAAV9 expressing miRNAs against AAT under the control of the hybrid chicken β-actin promoter via the tail vein. Serums from each cohort were collected on a weekly basis and were used to assess Z-AAT concentration by ELISA. Serum Z-AAT levels at each timepoint are expressed as a percent knockdown as compared to the rAAV9-GFP cohort. Data are expressed as group means ± SEM (n = 6). Statistical significance was set at *≤0.05 as determined by a two-way ANOVA comparing each treatment group to the control rAAV-GFP group. AAT, α-1 antitrypsin; ANOVA, analysis of variance; CMV, cytomegalovirus; ELISA, enzyme-linked immunosorbent assay; GFP, green fluorescent protein; miRNA, microRNA; rAAV, recombinant adeno-associated virus; shRNA, short hairpin RNA. shown on Figure 1c mice receiving intronCB-3XmiRNAs had digestion breaks down the glycogen leaving behind the Z-AAT on average a sustained 50–60% decrease in serum AAT, while protein accumulation as positive staining. With this method we mice receiving the single intronic miRNAs had on average also noted a decrease in intracellular AAT globules as deter- a knockdown of 30% as compared to mice receiving the GFP mined by diastase-resistant PAS (PASD) positive staining control vector. (Figure 2c–f). Quantitative image analysis of whole liver sec- To further evaluate the effect of miRNA-mediated Z-AAT tions with an algorithm designed to detect PASD-positive pix- knockdown we tested the livers of these mice 5 weeks after els also revealed about a 40% reduction in Z-AAT protein in rAAV delivery for abundance of intracellular Z-AAT. We saw the intronCB-3XmiR-GFP group (Figure 2g). The reduction in a marked decrease in AAT positive staining as indicated by the both PASD and hAAT staining was accompanied by a reduc- brown immunostaining in the livers of mice in the rAAV9- tion in inflammatory foci, this reduction was only evident in intronCB-3XmiR-GFP treated group (Figure 2a,b). An alter- the intronCB-3XmiR-GFP group but not in the control GFP native staining method to visualize the aggregation of Z-AAT group (Figure 2c,d, black arrows). This suggests that the reduc- which is used clinically is by performing a periodic acid Schiff tion in hAAT accumulation in the PiZ mice livers may alleviate (PAS) stain after a diastase digestion of the tissue. The diastase inflammation. 592 www.moleculartherapy.org vol. 20 no. 3 mar. 2012 © The American Society of Gene & Cell Therapy Knockdown and Augmentation of AAT and Its Effects a b c d g P ≤ 0.001 1.2 s nt 1.0 u e f o c 0.8 el * pix 0.6 ve 0.4 ositi 0.2 P 0.0 P R CB-GF Intronic-3Xmi Figure 2 liver histology for PiZ-transgenic mice 5 weeks post-rAAV9 delivery. Livers from mice receiving rAAV9 vectors with miRNAs and GFP controls were formalin-fixed and stained for AAT, or with a PAS-D assay. Mouse liver sections stained using an antihuman AAT antibody from a mouse treated with (a) i intronCB-3xmiR-GFP or (b) GFP controls. Mouse liver sections stained with diastase-resistant periodic acid Schiff assay from (c,d) GFP controls, black arrows indicate foci of lymphocyte infiltrates or (e,f) intronCB-3xmiR-GFP. (g) Quantitative pixel image analysis of whole liver sections for PASD-positive globules comparing pixel counts of GFP controls (n = 7) to intronCB-3xmiR-GFP (n = 7) *≤0.05 as determined by a two- way unpaired Student’s t-test. AAT, α-1 antitrypsin; CB, chicken β-actin; GFP, green fluorescent protein; miRNA, microRNA; PASD, diastase-resistant periodic acid Schiff; rAAV, recombinant adeno-associated virus. onset and degree of knockdown depend on mirnA Having achieved a short-term physiologically significant location within the expression cassette knockdown of more than 50% of Z-AAT serum protein levels, we We next determined whether the location of the miRNAs within determined whether this knockdown could be sustained for a lon- the expression cassette had any effect on their efficiency. We inves- ger period of time. The three vector constructs were delivered via tigated whether cloning the three miRNAs between the 3′ end the tail vein at a slightly higher titer of 1.0 × 1012 vps/mouse and of the GFP gene and the polyA tail changed the kinetics of AAT serum Z-AAT was monitored weekly for 3 months. The onset of knockdown and whether expressing the miRNAs from both loca- the effect of the three vector varied, with the Double-6XmiR vector tions (intron and polyA) which should double the amount of miR- achieving 90% knockdown 2 weeks after delivery, the PolyA-3XmiR NAs being produced would in turn lead to a further enhancement reaching 90% by the third week, while the intronCB-3XmiR vector of AAT knockdown. As in the previous experiments, Z-AAT trans- resulted in 50–65% knockdown for the first 7 weeks (Figure 4a, genic mice received 5 × 1011 vps of rAAV9 vectors expressing the Supplementary Figure S1). In order to monitor if there was any miRNAs either from the intron (intronCB-3XmiR), polyA region liver toxicity associated with rAAV9 delivery or miRNA expres- (PolyA-3XmiR) or at both locations at once (Double-6XmiR) sion, we assessed serum alanine and aspartate aminotransferase (Figure 3a). By 4 weeks the PolyA-3XmiR and Double-6XmiR concentrations 2 weeks after rAAV9 delivery. As observed in the were more effective than the intronCB-3XmiR vector at decreasing (Supplementary Figure S2) rAAV9 delivery was not associated serum Z-AAT levels by 85–70%, or in some cases with the Double- with increases in either alanine aminotransferase or aspartate 6XmiR vector by up to 95% (Figure 3a). Real-time quantitative aminotransferase levels, in fact the Double-6XmiR group had a reverse transcriptase-PCR (RT-PCR) analysis of liver tissue from significant reduction in alanine aminotransferase and aspartate these mice was performed to measure each of the three artificial aminotransferase serum concentrations and trends in the same vector derived miRs (910, 914, and 943). Both the PolyA-3XmiR direction were seen with the two other groups expressing anti- and Double-6XmiR vectors produced about twice as many copies AAT miRs (Supplementary Figure S1). Although Z-AAT serum of each of the miRs than the intronCB-3XmiR (Figure 3b). concentration rose slightly in animals in the Double-6XmiR and Molecular Therapy vol. 20 no. 3 mar. 2012 593 © The American Society of Gene & Cell Therapy Knockdown and Augmentation of AAT and Its Effects a b Intronic CMVCβ-actin GFP pA 3.0 40 Intronic-3XmiR 3XmiR Intronic-3XmiR PolyA-3XmiR P3XolmyAiR CMVCβ-actin GFP pA PolyA-3XmiR Double-6XmiR 2.5 20 Double Double-6XmiR s 6XmiR CMVCβ-actin GFP pA a ckdown ontrols) 0 10 20 30 A level 2.0 oc Time (days) N m level (% knared to GFP ––2400 * Relative miR 11..50 Z serucomp 0.5 Pi –60 * * 0.0 –80 miR-AAT.910 miR-AAT.914 miR-AAT.943 –100 Figure 3 In vivo optimization of anti-AAt mirnA delivery within rAAV9 vectors. (a) Transgenic mice expressing the human PiZ allele were injected with 5 × 1011 virus particles or rAAV9 expressing miRNAs against AAT under the control of the hybrid chicken β-actin promoter via the tail vein. Serums from each cohort were collected on a weekly basis and were used to assess Z-AAT concentration by ELISA. (b) Quantitative RT-PCR for artificial miRNA was quantified from total RNA obtained from mouse livers. RT-PCR was used to assay for the presence of the three artificial anti-AAT miRNAs from mice receiving rAAV9-miRNA vectors. *≤0.05 as determined by a two-way unpaired Student’s t-test. AAT, α-1 antitrypsin; CMV, cyto- megalovirus; ELISA, enzyme-linked immunosorbent assay; GFP, green fluorescent protein; miRNA, microRNA; rAAV, recombinant adeno-associated virus; RT-PCR, reverse transcriptase-PCR. PolyA-3XmiR groups between week 7 and 13, all three vector The transfected cells were incubated for 72 hours and RNA was groups showed stabilized values of serum Z-AAT at a sustained harvested from cell pellets for a quantitative RT-PCR analysis knockdown of 75% for the remainder of the study (Figure 4a). of Z-AAT and M-AAT transcripts. Analysis of Z-AAT mRNA Further analysis of liver homogenates to determine whether this revealed that both Double-6XmiR-GFP and Double-6XmiR- reduction was in the monomer or polymer pools of Z-AAT was AAT produced a significant knockdown (up to 37 times higher) performed on all groups. This modified western blot separates in number of Z-AAT mRNA copies as compared to the mock the monomer and polymer Z-AAT fractions under nondenatur- transfected cells (Supplementary Figure S3a). Furthermore, ing conditions after which they are denatured and quantitatively quantitative RT-PCR for wild-type M-AAT transcripts from the assessed by immunoblotting. As shown in Figure 4b the reduc- same RNA pool revealed that the Double-6XmiR-AAT construct tion in the monomer pool 3 months after miRNA is evident in expressed M-AAT at values more than 100 times higher than all the groups, densitometric analysis of the bands shows highly the values observed in control transfected cells (Supplementary significant differences in the PolyA-3XmiR and Double-6XmiR as Figure S3b). compared to mice treated with a GFP vector control(Figure 4c). Polymer pool analysis revealed that there was no reduction in the In vivo delivery of dual-function vectors Z-AAT polymers fraction even after 90 days (Figure 4d). We next used both of these miRNA configurations to test dual- function vectors in vivo. Three cohorts of seven mice each were In vitro delivery of mirnAs against Z-AAt and gene given 1.0 × 1012 vp with either a GFP control, Double-6XmiR- correction with M-AAt in a single vector CB-AAT or a PolyA-3XmiR-CB-AAT rAAV9 vectors. Serum was On the basis of the success of long-term sustained knockdown of harvested from the mice on a weekly basis for 13 weeks and was Z-AAT, we studied the possibility of creating a dual-function vec- analyzed for Z-AAT serum concentrations with a PiZ specific tor that would simultaneously augment protein levels of the wild- ELISA and for M-AAT concentrations with an ELISA detecting type M-AAT protein, thereby addressing both liver disease caused the cMYC tag on the M-AAT complementary DNA. Changes by the toxic gain-of-function of Z-AAT polymers and the loss-of- in serum Z-AAT were comparable to those in previous experi- function caused by the absence of circulating M-AAT. To achieve ments, with a sustained knockdown around 75–85% for both this, we replaced the GFP gene in the vector with a wild-type AAT vectors (Figure 5a, bottom panel). A more rapid knockdown was gene that had silent base pair changes at the miRNAs’ target sites, seen with the Double-6XmiR vector but the PolyA-3XmiR vec- thus making it resistant to the miRNA-mediated knockdown. tor achieved similar values by the fourth week. As serum Z-AAT HEK-293 cells were cotransfected with two plasmids, one of the decreased a concomitant rise in circulating M-AAT was observed plasmids expressed Z-AAT and the other one contained either the in mice receiving the dual-function vectors (Figure 5a, upper Double-6XmiR-GFP, Double-6XmiR-AAT (containing the miRNA- panel). Although the amount of knockdown for both vectors was resistant AAT gene) or a phosphate-buffered saline (PBS) control. similar for 4 weeks after delivery, the production of M-AAT was 594 www.moleculartherapy.org vol. 20 no. 3 mar. 2012 © The American Society of Gene & Cell Therapy Knockdown and Augmentation of AAT and Its Effects a the M-AAT mRNA between the two groups (Figure 5c). This sug- Intronic-3XmiR 40 gests that mRNA translation of M-AAT but not level of transcrip- PolyA-3XmiR Double-6XmiR tion may be affected in the Double-6XmiR-CB-AAT group. as 20 % knockdown GFP controls) –200 20 40Time (days)60 80 100 AoWfne aaprlyetrisfifioscr mioafel dgm laoi rmbnaicAlr losia vwrerarity hm a rnirAanlAysVAis9 porf oefindleosg eanfotuesr mdeoulisvee mryi R- Z serum level (compared to ––4600 * NolonAn g3s- 0ftr eosremmp a lZriva-etAer AtmiTsis cukreon flfooucrki dsdiixoc wgcrnhoi puespx psu eosrifin mmg eiscnaetm sw p(iFtlehisg fi uovrbeet ma6ini)c,e eda pl ofernrog mg rw otiuhthpe Pi * five untreated Z-AAT transgenic mice and five C57/BL6 mice. To –80 * determine baseline differences imparted by the human Z-AAT gene –100 in mice, an initial comparison between livers tissue from untreated PiZ mice and wild-type C57BL6 mice was performed. There were b only four statistically significant differences among these mice with Monomer only miR-1 having a log ratio greater than 2, being upregulated in PiZ 2 mice (Figure 6a and Table 2). Having established copies miR-1 has Polymer the most significant difference imparted by the expression of human Z-AAT in the transgenic mice, we compared the effects of transduc- Intronic 3XmirR PolyA 3XmirR Double 6XmirR CB-GFP tion on liver miRNA profiles caused by rAAV9-CB-GFP, rAAV9- c d Double-6XmiR-CB-GFP, rAAV9-PolyA-3XmiR-CB-GFP, and p < 0.09 6,000 rAAV9-intronCB-3XmiR-CB-GFP liver transduction. The expression 2,500 p < 0.02 p < 0.0007 of our artificial vector derived miRNAs had minimal impact on global 2,000 4,000 miRNA profiles (see Figure 6b–d). In general, statistically significant 1,500 differences between untreated PiZ mice and rAAV9 treated mice were 1,000 2,000 confined to 2–6 differentially expressed miRNAs depending on the 500 rAAV9 vector group. Of these differentially expressed miRNAs, the Introni0c-3XmirPRolyA-3XmiDroRuble-6XmirR CB-GFP Introni0c-3XmirRPolyA-3XmirDRouble-6XmirR CB-GFP otuhnpere e bwgauistelhalit tnihoene v laianlru gPeesisZ to cbmhsaeicnrveg eewd w aisna s ot mhbesi eRCr-v51e7,d Bw li6hn.i cThahll wisg arcoso udrproeswc itnniorcenlgu oudfli anmtgei dRt h-to1e mice receiving only rAAV9-GFP, and thus it seems to be dependent Figure 4 long-term in vivo silencing of human AAt by rAAV9 on rAAV9 and not on artificial miRNA delivery. expressed mirnAs. Transgenic mice expressing the human PiZ allele were injected with 1 × 1012 virus particles or rAAV9 expressing miRNAs dIscussIon against AAT under the control of the hybrid chicken β-actin promoter via The results presented in this study describe the initial proof-of-con- the tail vein. (a) Serums from each cohort were collected on a weekly basis and were used to assess Z-AAT concentration by ELISA. Hepatocytes PiZ cept and optimization of a combinatorial therapeutic approach for monomer versus polymer densitometry analysis at 90 days post-rAAV9 the treatment of both liver and lung disease present in patients with delivery. (b) Immunoblot for AAT after the monomer and polymer sepa- AAT deficiency. This therapeutic approach is based on a single, dual- ration protocol from liver lysates of mice. The 52 kDa Z-AAT was from liv- function AAV vector that delivers both miRNAs targeting AAT for ers was processed and separated in into a monomer and polymer pool. (c) Densitometric analysis for the monomer and (d) polymer pools was clearance of mutant mRNA and a miRNA-resistant AAT comple- performed using Image J software. Statistical significance was considered mentary DNA for augmentation of wild-type protein. The data clearly when *P ≤ 0.05 as determined by a two-way unpaired Student’s t-test. supports this approach as the biological activities of the miRNAs are AAT, α-1 antitrypsin; CB-GFP, chicken β-actin–green fluorescent protein; demonstrated both by cell culture experiments and more importantly ELISA, enzyme-linked immunosorbent assay; miRNA, microRNA; rAAV, recombinant adeno-associated virus. in vivo after numerous experiments with tail vein delivery of rAAV9- pseudotyped vectors. With the most effective configuration of the significantly different. The PolyA-3XmiR-CB-AAT vector pro- miRNAs, we consistently achieved a long-term knockdown of circu- duced 8–10 times more M-AAT than did the Double-6XmiR-CB- lating serum Z-AAT in a range of 50–95%. Furthermore when the AAT vector. Liver RNA was extracted from these mice at the end dual-function vectors were used, this knockdown was accompanied of the study to quantify the mRNA levels of Z-AAT and M-AAT. by equally sustained expression and secretion of wild-type M-AAT. As expected there was a precipitous decrease in Z-AAT mRNA The optimization of this approach follows our previous study in both cohorts of mice receiving vectors with miRNAs as com- demonstrating efficient knockdown of mutant Z-AAT protein in pared to mice receiving a rAAV9-CB-GFP control. Quantitative PiZ-transgenic mice using a rAAV8 vector expressing U6-driven RT-PCR for M-AAT was also performed to verify production of shRNAs.11 Our in vivo experiments show a significant decrease in M-AAT at the RNA level and to determine if the difference in Z-AAT after administration of the rAAV9-intronCB-3xmiR-GFP M-AAT production between dual-function vectors was related vector (Figure 1c). Importantly these experiments highlight the to mRNA transcription. Despite the clear difference in M-AAT additive effect that was obtained by using three anti-AAT miRNAs serum protein, there was no statistically significant difference in with different target sequences as none of the vectors with a single Molecular Therapy vol. 20 no. 3 mar. 2012 595 © The American Society of Gene & Cell Therapy Knockdown and Augmentation of AAT and Its Effects a 100,000 b 4×108 * PiZ mRNA ml)10,000 g/ NA 3×108 serum level (µ 1,000 PDThooeluyrbAal-ep3-eX6uXmtimciR ilRe-Cv-eCBlBs-A-AATAT A copies/ng R 2×108 23X T N AA mR 1×108 PiM 100 PiZ * * CB-AAT-6XmiRNA CB-AAT-3XPolyA-miRNA CB-GFP 0 7 14 21 28 35 42 49 56 63 70 77 84 91 98 Time (days) c 1×107 –20 wn) 1×106 PiM mRNA o A d N nock –40 ng R 1×105 % k es/ evel ( –60 A copi 1×104 m l * RN 1×103 PiZ seru –80 * PiM m 1×102 ND 1×101 –100 CB-AAT-6XmiRNA CB-AAT-3XPolyA-miRNA CB-GFP Figure 5 In vivo knockdown of Z-AAt with simultaneous augmentation of M-AAt after rAAV9 dual-function vector delivery. Transgenic mice expressing the human PiZ allele were injected with 1 × 1012 virus particles or rAAV9 expressing miRNAs against AAT and a de-targeted cMyc tagged wild- type M-AAT cDNA under the control of the hybrid chicken β-actin promoter via the tail vein. (a) Serums from each cohort were collected on a weekly basis and were used to assess Z-AAT concentration by ELISA. Serum Z-AAT levels at each timepoint are expressed as a percent knockdown as compared to the rAAV9-GFP cohort by using a Z-specific AAT ELISA and M-AAT levels are calculated by using an ELISA to quantify the cMYC tag on the wild-type protein. Data are expressed as group means ±SEM (n = 6). Statistical significance was set at *≤0.05 as determined by a two-way ANOVA comparing each treatment group to the control rAAV-GFP group. Blue dashed line in the upper panel indicates therapeutic levels of wild-type PiM AAT as determined by the FDA and therapeutic knockdown of PiZ protein in the lower panel as determined by achieving levels expected in a PiZ heterozygous status. Total RNA from mouse livers was used to assay for the presence of the either (b) Z-AAT mRNA or (c) M-AAT mRNA by qRT-PCR. Data are expressed as group means ±SEM (n = 6). *≤0.05 as determined by a two-way unpaired Student’s t-test. AAT, α-1 antitrypsin; ANOVA, analysis of variance; cDNA, complementary DNA; ELISA, enzyme-linked immunosorbent assay; CB-GFP, chicken β-actin–green fluorescent protein; FDA, Food and Drug Administration; mRNA, mes- senger RNA; miRNA, microRNA; ND, not detected; qRT-PCR, quantitative reverse transcriptase-PCR; rAAV, recombinant adeno-associated virus. miRNA achieved the level of knockdown seen when they were this effect. Furthermore, doubling the effective miRNA dose per vec- delivered in combination (Figure 1c). The other biological effect tor by having the miRNAs expressed from both locations led to more aside from Z-AAT serum reduction that was observed included a rapid onset of Z-AAT knockdown (Figure 4a). Importantly, increase significant and widespread decrease in the accumulation of Z-AAT in miRNA production was seen for both the PolyA-3XmiR-CB-GFP within the hepatocytes and a reduction of the inflammatory lym- and the Double-6XmiR-CB-GFP vectors as compared to the rAAV9- phocyte foci within the liver (Figure 2). Endoplasmic reticulum intronCB-3xmiR-GFP vector. This seems to suggest that miRNA pro- accumulation of Z-AAT protein results in inflammation which cessing from the intron of the CB promoter is not as efficient as from overtime can lead to liver fibrosis and eventually to a failing cir- the 3′ end of the GFP gene. However, the long-term experiments rhotic liver.4–6 Thus the reduction in inflammatory infiltrates as a that followed showed that the initial kinetic differences in knock- result of the reduced burden of newly synthesized Z-AAT protein down from the three vectors wanes overtime and by the 8 weeks is important as it may halt the progression of liver disease and the intronCB-3xmiR-GFP decreases in variability and augments in fibrotic tissue remodeling as a consequence of inflammation. silencing efficacy. Western blot data from mice at day 90 analyzing Further refinement of the anti-AAT miRNA efficacy was achieved the monomeric and polymeric Z-AAT fractions confirmed the effec- by altering the location of the miRNA within the expression cassette. tiveness of miRNA-mediated knockdown seen in serum Z-AAT but Initial short-term experiments demonstrated that expressing the also revealed more variability in the decrease of monomeric Z-AAT miRNAs from the 3′ end of the GFP gene rather than from the intron in mice receiving the intronCB-3xmiR-GFP vectors as compared to of the CB promoter lead to a 25% increase in the silencing capabilities PolyA-3XmiR-CB-GFP and the Double-6XmiR-CB-GFP vectors of the miRNAs and also to a significant decrease in the variability of (Figure 4b,c). More importantly this data clearly establishes that 596 www.moleculartherapy.org vol. 20 no. 3 mar. 2012 © The American Society of Gene & Cell Therapy Knockdown and Augmentation of AAT and Its Effects 1×105 1×105 P-value > 0.05 P-value > 0.05 P-value < 0.05 miR-1 P-value < 0.05 miR-1 1×104 1×104 PiZ-control signal 1×103 miR-122 PiZ-control signal 11××110023 miR-122 1×102 1×101 1×101 1×100 1×101 1×102 1×103 1×104 1×105 1×100 1×101 1×102 1×103 1×104 1×105 C57/BL6-control signal C57/BL6-control signal 1×105 1×105 P-value > 0.05 P-value > 0.05 P-value < 0.05 miR-1 P-value < 0.05 1×104 1×104 miR-1 PiZ-control signal 1×103 miR-122 PiZ-control signal 1×103 miR-122 1×102 1×102 1×101 1×101 1×101 1×102 1×103 1×104 1×105 1×101 1×102 1×103 1×104 1×105 PiZ-Double 6XmiR signal PiZ-PolyA3XmiR signal Figure 6 Artificial mirnA have minimal impact on endogenous mirnA liver profiles. Liver RNA was harvested 3 months post delivery from animals injected with the following vectors: intronCB-3xmiR-GFP, PolyA-3XmiR-GFP, Double-6XmiR-GFP, CB-GFP along with RNA from untreated PiZ mice and wild-type C57Bl6 mice was used to run a miRNA microarray. Each group consisted of five mouse RNA samples and was run independently with a single color (Cy5) microarray. CB, chicken β-actin; GFP, green fluorescent protein; miRNA, microRNA. Z-AAT polymers are remarkably stable as there was no difference The potency and stability of the decrease in serum and liver in the amount of Z-AAT polymers between GFP control mice and Z-AAT observed in vivo suggests that either of these vectors would those receiving the anti-AAT miRNAs. Clearly, miRNAs would not lower Z-AAT levels in Pi*ZZ patients to therapeutic levels, even be expected to decrease polymerized Z-AAT as they act on nascent below those seen in Pi*MZ heterozygote patients. However maximal Z-AAT mRNA; however, the remarkable stability of Z-AAT polymers clinical benefit would be derived from a concomitant rise in M-AAT throughout the 90-day study was surprising. The fact that there were circulation. For this reason we designed the dual-function vectors to no differences in the Z-AAT polymeric loads in the livers between also deliver a miRNA-resistant M-AAT complementary DNA. The in groups of mice receiving GFP control vectors and anti-AAT miRNAs vivo studies with these dual-function vectors clearly demonstrate the implies several things. First, this suggests that there was little new feasibility of concomitant knockdown and augmentation of mutant Z-AAT polymer formation during the 3-month study as one would and wild-type protein respectively. These experiments also revealed expect that in the face of dramatic knockdown of newly synthesized that the double configuration of miRNAs had a more rapid onset Z-AAT as seen in the monomeric pool, few new polymeric aggre- of Z-AAT knockdown but the overall efficacy over time was com- gates should arise during the experiment as compared to control mice parable to the PolyA-3XmiR-CB-AAT vector. More importantly, the where newly synthesized Z-AAT monomers are not limiting. Second, improved knockdown kinetics of the Double-6XmiR-CB-AAT vec- the results also imply that the turnover of hepatocytes with Z-AAT tor came at a cost as was seen from the decreased output in M-AAT polymers is rather slow, again as no differences were seen between (Figure 5a). Initially, it was hypothesized that this may have been a the control and treated mice after 3 months. If there should have been result of decreased M-AAT mRNA production due to the presence of a significant amount of hepatocytes turnover it would been expected miRNA within the intron of this construct, but as shown in Figure 5c, that treated mice would have smaller Z-AAT polymer pools in the there was not statistically significant difference in M-AAT mRNA liver since these would not be as easily replenished in the presence of between the two groups. It is possible that while mRNA transcription a Z-AAT knockdown. and stability are not affected by the presence of miRNAs within the Molecular Therapy vol. 20 no. 3 mar. 2012 597 © The American Society of Gene & Cell Therapy Knockdown and Augmentation of AAT and Its Effects table 2 statistically significant changes in liver mirnA profiles this mechanism revealed that least in part adverse effect associ- Group 1 Group 2 ated with shRNA expression are due to the saturation of several rate-limiting components in the miRNA pathway. Specifically it B6-mock control PiZ-mock control was noted that shRNA saturated exportin-5 which is involved in Mean intensity Mean intensity log reporter name P value (n = 5) (n = 5) (G2/G21) the nuclear export or pre-miRNAs as well as all four human Ago proteins.22 Saturation of Ago proteins has serious implications mmu-miR-762 2.39E-02 525 1,099 1.07 since these proteins are involved in miRNA biogensis, oogen- mmu-miR-23a 4.03E-02 1,247 1,593 0.35 esis, embryogensis, and a myriad of other cellular pathways23–29 mmu-miR-1 4.95E-02 126 2,776 4.46 To determine if our rAAV9 expressed anti-AAT miRNAs were mmu-miR-341a 4.97E-02 4,340 2,287 −0.92 disturbing the endogenous miRNA profiles of the liver, we inter- PiZ-cB-GFP PiZ-mock control rogated the livers of 30 mice with a miRNA microarray. Neither did the delivery of rAAV9-GFP or those expressing miRNAs have mmu-miR-1 6.03E-03 5 2,776 9.13 a significant impact on miRNA profiles. Notably mir-122 which mmu-miR-148a 7.48E-03 1,841 1,058 −0.80 is the most abundant miRNA produced in the liver and regulates mmu-miR-720 9.33E-03 1,264 3,440 1.44 fatty acid metabolism was unaffected in any group. While a few mmu-miR-30c 1.03E-02 2,830 1,757 −0.69 miRNAs were found to be statistically different among the groups, mmu-miR-146a 1.71E-02 362 175 −1.05 they were mostly confined to a twofold change with the exception of miR-1. In the array experiments comparing untreated mice, mmu-miR-30d 4.64E-02 627 454 −0.47 miR-1 was one of the miRNAs that was found to be upregulated PiZ-PolyA 3Xmir PiZ-mock control in PiZ mouse livers when compared to wild-type mice. More mmu-miR-2145 1.40E-02 573 114 −2.32 importantly downregulation to near wild-type levels of miR-1 mmu-miR-1 2.28E-02 22 2,776 6.95 was observed in all PiZ mice livers receiving rAAV9 (Figure 6a). mmu-miR-690 2.41E-02 3,071 534 −2.52 Interestingly this correction of miR-1 levels was observed in the rAAV9-GFP group as well, suggesting that the downregualtion mmu-miR-720 4.31E-02 1,816 3,440 0.92 of miR-1 was not due to artificial miRNA expression by the vec- PiZ-double 6XmirPiZ-mock control tor but a consequence of rAAV9 transduction itself. While these mmu-miR-146a 1.53E-02 445 175 −1.35 results highlight the relatively unperturbed nature of miRNA pools mmu-miR-1 3.04E-02 115 2,776 4.59 in the liver after artificial miRNA delivery with rAAV9, it does aSignificant values are listed in the P value column. not address whether endogenous miRNA function is affected. Recent studies by Khan et al. demonstrate that shRNA, miRNAs, intron, their translation into protein may be hindered as observed in and small interfering RNAs (siRNAs) transfection in vitro can all the decrease circulating M-AAT levels in the serum of these mice. lead to altered gene regulation as RNA-induced silencing com- If viral vector expressed miRNA-based therapy is to be trans- plex or machinery downstream of exportin-5 is saturated.30 Their lated into the clinic, one of the most pressing safety concerns is to findings included the de-repression of miRNA-regulated genes as determine what effect the expression of artificial miRNA has on transfected small RNAs presumably competed with endogenous endogenous miRNAs of the target organ? The question is a natu- miRNAs for loading onto the RNA-induced silencing complex. ral progression from the data that has been accumulating using These findings warrant further research using gene micorarrays first generation viral vector mediated RNAi. Emerging data from to assess the consequences of rAAV delivered miRNAs on global several labs using shRNA-mediated RNAi treatment for genetic gene profiles in vivo. Thus in summary, miRNA profiles seemed disorders have reported severe adverse effects. An early land- unperturbed and in some cases “corrected” back to wild-type lev- mark paper by Kay et al. described substantial hepatotoxicity and els with rAAV9 delivery. fatalities among mice receiving rAAV vector expressing shRNAs.12 Considered more broadly, these findings raise the possibility Similarly other early reports noted striatal neurotoxicity in mice that other diseases states requiring the combination of augmenta- treated with shRNA targeting the huntingtin gene and Purkinje cell tion of a functional allele and suppression of a mutant allele might loss in mice treated with shRNA against SCA1.13,14,19 More recently be addressed in a similar fashion. Disorders such as amyotrophic these initial findings have been corroborated in a mouse model lateral sclerosis, Huntington disease cerebral ataxia, and optic atro- of the dominantly inherited neurological disease DYT1 dystonia. phies, in which mutant alleles cause a severe autosomal dominant This study demonstrated striatal atrophy associated with behav- disease, but in which an allele-specific knockdown might only be ioral dysfunction and death in mice receiving both therapeutic feasible if the functional allele were modified to convey resistance to and control shRNA expressing rAAV vectors. Importantly the tox- a miRNA-based knockdown. It is also significant that our manipu- icity was encountered in wild-type and DYT1 mice.20 Collectively lations result in minimal perturbations of endogenous miRNA these studies convincingly suggest that vectors expressing high profiles. This is potentially important for considering the safety of amounts shRNAs driven by strong pol-III promoters (e.g., U6 and single agent miRNA-based approaches, which would have an even H1) have the potential to be highly toxic. Initial evidence from broader scope of uses, such as antiviral therapy directed against two studies implicated the exogenous shRNA constructs could hepatitis B virus or hepatitis C virus. As with the genetic diseases cause dysfunction of the endogenous miRNA pathway by over- considered above, these are conditions in which the downregula- saturating key enzymes in the system.12,21 A recent study extending tion of target genes is likely to be necessary for prolonged periods 598 www.moleculartherapy.org vol. 20 no. 3 mar. 2012 © The American Society of Gene & Cell Therapy Knockdown and Augmentation of AAT and Its Effects of time. Therefore, emergence of the rAAV-based miRNA platform real-time rt-Pcr as a means to address these problems could hold great promise in RNA extraction: Flash frozen mouse liver tissue was ground in a pestle this setting as well. There are potential limitations of rAAV-based and mortar and used to extract either small or total RNA using the mirVana miRNA RNA Isolation Kit (Ambion, Austin, TX) according to delivery, as the potential consequence of immune-mediated dele- the manufacturer’s instructions. tion of transduced cells by anti-AAV capsid T cells continues to be microRNA qRT-PCR: mircoRNA was primed and reverse-transcribed an unresolved question. In addition as was evident from the sta- with TagMan MicroRNA reverse transcription Kit (Applied Biosystems, bility and permanence of the Z-AAT polymeric pool in the liver Foster City, CA). Quantitative PCR was performed in duplicate with gene- of treated mice, intervention at an early stage in the disease may specific RT-miRNA primers, and PCR assays were as designed by Applied be necessary to prevent liver damage and disease progression. Biosystems, using TaqMan Gene Expression Master mix (Applied Biosystems) Nonetheless, this approach clearly warrants further study and may in a StepOne Plus real-time PCR instrument (Applied Biosystems). lead to clinical translation for a number of unmet medical needs. PiM and PiZ qRT-PCR: Total RNA was primed with oligo(dT) and reverse-transcribed with SuperScript III First-Strand Synthesis kit for MAterIAls And Methods RT-PCR (Invitrogen). Quantitative PCR were performed by gene-specific primer pairs. PiM and PiZ share the primers but differ in the probes. Forward rAAV9 packaging and purification. Recombinant AAV9 vectors used in primer CCAAGGCCGTGCATAAGG, reverse primer: GGCCCCAGCAGC this study were generated, purified, and titered by the UMass Gene Therapy TTCAGT, PiZ probe: 6FAM-CTGACCATCGACAAGA-MGBNFQ, and Vector Core as previously described.31 To clone in the miRNAs a 425 bp PiM probe: 6FAM-CTGACCATCGACGAGA-MGBNFQ. Reactions were sequence containing all three miRNAs in tandem was cloned into CB intron performed using TaqMan Gene Expression Master mix (Applied Biosystems) by replacing 315 bp intron sequence between enzyme sites SgrAI and XbaI. in a StepOne Plus real-time PCR instrument (Applied Biosystems). Cloning of the miRNAs at the polyA region was accomplished by inserting the 425 bp fragment at the NotI site 5 bp upstream of the polyA region. Z-AAT transgenic mice and rAAV9 delivery. The PiZ-transgenic mice used in this study have been described.11 All animal procedures were per- Cell culture and transfection. HEK-293 cells were cultured in Dulbecco’s formed according to the guidelines of the Institutional Animal Care and Use modified Eagle’s medium supplemented with 10% fetal bovine serum Committee of the University of Massachusetts Medical School. rAAV9 vector and 100 mg/l of penicillin-streptomycin (Gemini Bio-products, West was administered by mouse tail vein injection in a volume of 200 μl with titer Sacramento, CA). Cells were maintained in a humidified incubator at 37 °C of 1 × 1012 vps. The injections were performed in the most accessible vessels and 5% CO. Plasmids were transiently transfected using Lipofectamine veins that run the length of both lateral aspects of the tail by grasping the tail 2 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruc- at the distal end. Blood was collected through the facial vein pre-injection and tions. Cell culture supernatants were collected at 24, 48, and 72 hours, and every week after tail vein rAAV9 delivery until termination of the studies. cell lysates were collected at 72 hours. Liver histology. For determination of histological changes, liver samples Serum AAT ELISAs. Human AAT ELISA: Total AAT protein was detected were fixed in 10% neutral-buffered formalin (Fisher Scientific), and by ELISA. High binding extra, 96-well plate (Immulon 4; Dynatech embedded in paraffin. Sections (5 µm) were stained with hematoxylin and Laboratories, Chantilly, VA) were coated with 100 µl of human specific goat eosin and PAS with or without diastase digestion. anti-AAT (1:500 diluted; Biomedicals, Solon, OH) in Voller’s buffer over- Immunohistochemistry for hAAT, was performed as described,13 night at 4 °C. After blocking with 1% non-fat dry milk in phosphate-buff- briefly tissue sections (5 µm) were deparaffinized, rehydrated, and blocked ered saline with Tween 20, duplicate standard curves (Athens Research and for endogenous peroxidase with 3% hydrogen peroxide in methanol for Technology, Athens, GA) and serially diluted unknown samples were incu- 10 minutes. To detect hAAT expression, tissue sections were incubated bated in the plate at room temperature for 1 hour, a second antibody, goat with primary antibody, rabbit antihuman AAT (1:800; RDI/Fitzgerald anti-hAAT(HRP) (1:5,000 diluted; Abcam, Cambridge, MA) was incubated Industries, Acton, MA), for overnight at 4 °C. Staining was detected using at room temperature for 1 hour. The plate was washed with phosphate-buff- ABC-Rb-HRP and DAB kits (Vector Laboratories, Burlingame, CA). ered saline-Tween 20 between reactions. After reaction with TMB peroxi- Histology image analysis. Slides were stained for PASD to remove glyco- dase substrate (KPL, Gaithersburg, MD) reactions were stopped by adding gen. Whole digital slide images were created using an Aperio CS ScanScope 2 N HSO (Fisher Scientific, Hudson, NH). Plates were read at 450 nm on a 2 4 (V, CA) and analyzed using the positive pixel count algorithm (version 9). VersaMax microplate reader (Molecular Devices, Sunnyvale, CA). PASD-positive globules were expressed as the proportion of strong positive Z-AAT ELISA: Human Z-AAT protein levels were detected by ELISA pixels to total pixels using a hue value of 0.9, hue width of 0.15, and color with coating antibody specific for human Z-AAT (1:100 diluted mouse- saturation threshold of 0.25. The intensity threshold for strong positivity anti-human α-1-antitrypsin-Z; Cell Sciences, Fair Lawn, NJ). Standard was set to an upper limit of 100. curves were created with PiZ mouse serum with 5% bovine serum albumin (Sigma, St Louis, MO). Serially diluted unknown samples were Analysis of Z-AAT protein monomer and polymer. For soluble/insoluble pro- incubated in the plate at 37 °C for 1 hour. The secondary antibody and the tein separation, 10 mg of whole liver was added to 2 ml buffer at 4 °C (50 mmol/l next step were same as the standard human-AAT ELISA described above, Tris-HCl (pH 8.0), 150 mmol/l NaCl, 5 mmol/l KCl, 5 mmol/l MgCl, 0.5% 2 except the secondary antibody was diluted in 5% bovine serum albumin Triton X-100, and 80 μl of complete protease inhibitor stock). The tissue was and incubated in the plate at 37 °C for 1 hour. homogenized in a prechilled Dounce homogenizer for 30 repetitions, then c-Myc ELISA: c-Myc tag levels were quantified by a method similar to vortexed vigorously. A 1-ml aliquot was passed through a 28-gauge needle that described above. Plates were coated with a c-Myc antibody (1:1,000 10 times. The total protein concentration of the sample was determined, and diluted Goat anti-c-Myc; Abcam), plates were then blocked with 5% a 5-μg total liver protein sample was aliquoted and centrifuged at 10,000g for bovine serum albumin at 37 °C for 1 hour. To create the standard curve 30 minutes at 4 °C. Supernatant (soluble (S) fraction) was immediately C57Bl/6 mice were dosed via tail vein with c-Myc-AAT expressing vector, removed into fresh tubes; extreme care was taken to avoid disturbing the at 2 weeks serum were collected and pooled. The amount c-Myc-AAT pellet (insoluble (I) fraction). The insoluble polymers pellet (I fraction) was in the serums was then quantified with the human specific AAT ELISA denatured and solubilized via addition of 10 l chilled cell lysis buffer (1% described above. The obtained values were then used to produce a Triton X-100, 0.05% deoxycholate, 10 mmol/l EDTA in phosphate-buffered standard of c-Myc protein for the c-Myc ELISA. saline), vortexed for 30 seconds, sonicated on ice for 10 minutes and vortexed. Molecular Therapy vol. 20 no. 3 mar. 2012 599

See more

The list of books you might like