loading

Logout succeed

Logout succeed. See you again!

ebook img

Synonymy of three pestiferous Matsucoccus scale insects (Hemiptera: Coccoidea: Matsucoccidae) based on morphological and molecular evidence PDF

release year2006
file size8.3 MB

Preview Synonymy of three pestiferous Matsucoccus scale insects (Hemiptera: Coccoidea: Matsucoccidae) based on morphological and molecular evidence

PROC. ENTOMOL. SOC. WASH. 108(4), 2006, pp. 749-760 SYNONYMY OF THREE PESTIFEROUS MATSUCOCCUS SCALE INSECTS (HEMIPTERA: COCCOIDEA: MATSUCOCCIDAE) BASED ON MORPHOLOGICAL AND MOLECULAR EVIDENCE JANIE M. BOOTH AND PENNY J. GULLAN Department of Entomology, University of California, 1 Shields Avenue, Davis, CA 95616-8584, U.S.A. (e-mail: [email protected]) Abstract.4The scale insect genus Matsucoccus Cockerell (Coccoidea: Matsucoc- cidae) contains several economically important species that cause damage to pine trees, Pinus species, in the United States and elsewhere in the Holarctic Region. Efforts to reconstruct the phylogeny of the group have provided information on genetic variation within and among species. Here, three species of Matsucoccus are synonymized based on newly acquired molecular data and reassessment of morphological data. Matsucoccus resinosae Bean and Godwin, described from the eastern United States, and Matsucoccus thunbergianae Miller and Park, from South Korea, are considered to be new synonyms of Xylococcus (now Matsucoccus) matsumurae Kuwana. The taxonomic confusion surrounding these names _ is discussed. In addition, we suggest that several other species of Matsucoccus, including M. pini Green, should be investigated as possible synonyms of #. matsumurae. Key Words: Margarodidae, Matsucoccus, red pine scale, taxonomy Matsucoccus Cockerell is a morphologi- unpubl. data). One relationship of par- cally conservative group of scale insects ticular interest jis (thattiofi sthree. pest placed either in the scale insect family species, Matsucoccus matsumurae (Ku- Margarodidae (Ben-Dov et al. 2005) or in wana), the Japanese pine bast scale, M. its own family, Matsucoccidae (Koteja resinosae Bean and Godwin, the red pine 1984, 1986; Foldi 2004). All species feed scale, and M. thunbergianae Miller and exclusively on Pinus (Pinaceae) and are Park, the black pine bast scale. New mainly Holarctic, with limited records from evidence supports the synonymy of the the Neotropical and Indotropical regions three species. Entomologists have specu- (Ben-Dov 2005, Ben-Dov et al. 2005). This lated that M. matsumurae and M. genus has received moderate taxonomic resinosae are synonymous (Ray 1982; treatment (Ray and Williams 1984, 1991; McClure 1983b, 1987; Foldi 2004). The Gill 1993; Foldi 2004), and 34 extant species recent catalogue of Margarodidae (Ben- are recognized (Ben-Dov 2005). Dov 2005) treats these two species Recent research to reconstruct the separately, but mentions previous work phylogeny of Matsucoccus has provided suggesting that M. resinosae may be the first hypothesis of species relation- a junior synonym of M. matsumurae ships based on molecular and morpho- (McClure 1983a, Young et al. 1984, Park logical data (Booth, Cook and Gullan, et al. 1986). 750 PROCEEDINGS OF THE ENTOMOLOGICAL SOCIETY OF WASHINGTON Matsucoccus resinosae infests red pine, thunbergianae from M. matsumurae and Pinus resinosa, on the east coast of the M. resinosae, based on the adult females United States. Red pine scale was first or the first-instar nymphs, but #. recognized in 1946 in Easton, Connecti- thunbergianae is said to differ from the cut (Plumb 1950), and its rapid spread other two species in the size of the adult and the high tree mortality that it caused male, in the number of generations per suggested that 1t was a new introduction year, and in overwintering as the second- (Bean and Godwin 1955). It has been instar nymph (as the first-instar nymph hypothesized that it was introduced in the other two species). Matsucoccus during the 1939 New York World Fair thunbergianae is univoltine or has only on exotic pines imported as a display, a partial second generation (Miller and because the same truck that transported Park 1987), whereas M. matsumurae the exotic pines from the port was used and M. resinosae are bivoltine or have to transport red pines from Easton to the a partial third generation (McClure fairgrounds (Doane 1959). The feeding 1977, Miller and Park 1987). Matsucoc- cyst stage of M. resinosae can damage cus thunbergianae 1s considered a pest 1n the needles, causing extensive flagging Korea on black pine (Miller and Park and needle drop (McClure 1976, Duda 1987, Chung et al. 2000). 1977). Damage is particularly severe in Several available pieces of biological plantations found south of red pine9s evidence support the synonymy of these native range (Bean and Godwin 1955), three Matsucoccus species. First, the sex apparently because low winter tempera- pheromones of MM. matsumurae, M. tures in the pine9s natural range to the thunbergianae, and M. resinosae have north prevent survival of red pine scale been shown to be cross attractive in nymphs (Doane 1959; McClure 1983a, bioassay studies (Young et al. 1984, Park b). Damage from the red pine scale has et al. 1986). The primary component of resulted in almost complete removal of the sex attractant was identified and the once abundant red pine plantations in pheromone is identical for the three Connecticut and New York states and it species and has been named <8matsuone=9 is now difficult to locate intact stands (Lanier et al. 1989, Hibbard et al. 1991). (J. Booth pers. observation, Providence Second, all species occur on hosts found Water Supply Board 2005). in the same Pinus subsection, subsection The Japanese pine bast scale, M. Pinus, of the pine tree phylogeny of matsumurae, has similar biology and Gernandt et al. (2005). Matsucoccus morphology to M. resinosae (McClure matsumurae occurs on seven Pinus spe- 1976, 1983a). This scale is a pest in Asia, cies (McClure 1983a), Matsucoccus thun- especially on black pine, Pinus thunbergii bergianae only on P. thunbergii and P. (Taketani 1972, Cheng and Ming 1979). densiflora (Miller and Park 1987), and The species was described originally by M. resinosae is found on P. resinosa Kuwana as Xylococcus matsumurae (Ku- (Kuwana 1905, Bean and Godwin 1971, wana 1905, 1907), and later transferred Miller and Park 1987), which is the only to Matsucoccus by Cockerell as the type species of the Pinus subsection Pinus in species of his new genus (Cockerell the United States (Gernandt et al. 2005). 1909). Ray (1982) and McClure (McClure The third species, M. thunbergianae 1983b) went further and noted that M. Miller and Park, from South Korea, was resinosae and M. matsumurae are more described as similar to M. matsumurae specifically found only on members of and M. resinosae (Miller and Park 1987). the Sylvestres group of the subsection if is not possible to distinguish M. Pinus. However, the Sylvestres group 1s VOLUME 108, NUMBER 4 Til Table I. Specimens of adult females examined for morphological analysis. SSS Species Name #- Slides (# Females) Collection Information Depository M. matsumurae 1 (1 non-type) JAPAN: Kanagawa-ken, ex pine tree, 13.v.1919; BME Coll. S. I. Kuwana (mounted from dry material sent by Kuwana to F. B. Herbert) 1 (2 non-type) JAPAN: Nagashima, ex P. densiflora, 10.v.1970; BME Coll. M. Inoure 2 (2 non-type) JAPAN: Nagashima, ex P. densiflora, 4.v.1970; USNM Coll. M. Inoure 3 (4 non-type) JAPAN: Japan: Mie Prefecture, Shimagahara BME Village, ex P. thunbergii; 24.11.2004; Coll. T. Kondo M. pini 3 (5 paralectotypes) ENGLAND: Oxshott, Surrey, ex P. sylvestris, BMNH 31.x.1922; Coll. F.C. Withycombe M. resinosae 3 (holotype and 2 USA: Connecticut, Easton, ex P. resinosa, USNM paratypes) 2.v.1948; Coll. George H. Plumb M. 4 (holotype and 5 SOUTH KOREA: Kohung, Chollanam-do, USNM thunbergianae paratypes) ex P. thunbergiana (now P. thunbergii), collected x1i1.1983, lab reared iv.1984; CollNSAE* Park 1 (2 paratypes) SOUTH KOREA: Kohung, ex P. thunbergii, BME collected xi1.1983, lab reared iv.1984; Coll. Sa@a bank not recognized in the most current Pinus material was examined for M. resinosae phylogeny (Gernandt et al. 2005). Third, and M. thunbergianae, whereas subse- the distribution of M. matsumurae, M. quent material collected by the original resinosae and M. thunbergianae supports author was studied for M. matsumurae their synonymy. McClure (1983b) point- (see below under <8Type material=; also ed out that the first two species are Table 1). Specimens from each collection restricted to a similar northern latitudi- were scored for 14 morphological char- nal limit: 41°509N in the U.S., 41°309N in acters (Table 3), including those previ- Japan, and 41°309N in China. Similarly, ously recognized by Ray (1982). The M. thunbergianae has been reported only diagnosis was prepared based on the from South Korea (Miller and Park specimens listed in Table 1. Specimens 1987), for which the northern boundary examined are housed at the Bohart lies at about 39°N. Museum of Entomology (BME), Uni- Here we present the first molecular versity of California, Davis; The Natural data and reassess the morphological History Museum, London (BMNH); and evidence to show that specimens de- the Coccoidea Collection of the National scribed as M. matsumurae, M. resinosae Museum of Natural History, Smithso- and M. thunbergianae belong to the same nian Institution (USNM) in Beltsville, species. We synonymize M. resinosae and Maryland. M. thunbergianae under the senior syno- Genetic analysis.4Molecular data nym M. matsumurae and provide a new were acquired for 13 specimens belong- diagnosis for this species. ing to six named Matsucoccus species that the authors field collected or that MATERIALS AND METHODS colleagues donated (Table 2). Specimens Morphology.4Morphological charac- were stored in 75% ethanol for slide ters were evaluated and measured using mounting and 100% ethanol for molecu- a Leica compound microscope. Type lar work. Genomic DNA was extracted N O T G SHIN MsBAIGUNY] <q ayeway yNpe ALEr.9T1I <N, IO. SOOT Hp 8opureurloyyD 8Aud nlexy :va1oy yINoAVA FOF SHMSD s IZOGING avunisiaquny) <Py A W Joe F 8M-H-2puOpurS[IDDO eepqLO jeq TTuo0 nyDo j| O DSOUISIAA <q ayeuUlay yNpe M,61co¬L 8N,10 Japug, Jo uonounl 8ueeuryd :oD preyyouT LO 8vsa OCOAWEL IDSOUISAA <A TY Ioog <f TOD <pOOT XS Feary es eidniny E DSOUISAA <q ysAO M,ProEl <NLS. apLAdnadvjey 8apiaaadvjeyT 20D ssoysing AN <WSN STOAWE IDSOUISAA <J I C BuldsurA <XK TOD 8SOOT AST *RUIYD O S UBAIGUNY] 8q ysAO Ay leSGl NFO JSBOYION SSOUIAOIgG Ulf Ul AJUNOD Suoji,A :vuryD LPOAWL avanuinsypiut wy L o<M-WLpypS oeuOo oc y A 11s4aquny] <q a]euldy yNpe AL¬0.9¬1 8N,9P SOBR][IA VILYRSCUNIYS 8oINOIJoIg Ap :uedee FIOPING avaniuinsjpiul <Py C I JOP <Cs pue yoog <f <S[IOD -SOOT HES OG DUDIUIBAIA <ql ss30 N,£S.9L <N,10 SAUW[IOB] INNS <OPPASIag :OD .ses10ay s9UuLIg CW 9COaWL SNOIYIDS <WW OL y100g <f MOD -pOOT XE! -peoy peotyioary M DPB 8 ys M,6¬.CL N.SS SOYSHOY ISVY <PRsysIATY :OD ALOJNS AN poouWer SnJOIN]DS <W O T UIaITID) <CM MOD -v00XcV O T EN DpIsld o[eulo} y[Npe M.8P0CL <N.CSo 8OL WxO <Cop AMP <9][IATOURI :OD YLOHNS AN tcOaWe SNJOIIVS "W YIOOg <f [OD {POOT' A] {4191U9D S.AOUSIA 189104 HE 119]]NOD 8dq syduiAu NM,STo9IT (NZS oZE [PUONEN purpaagyD 8vunse Til 70D osaiq ures VO 6cOAIWL Snsojasiq <W T 4100 <f TOD -POOTAT6 Aled OF psosapuod 8q S330 NM, COcIZI <N.ZI a1e1g soul osidurgq 8AaT[@A SSBPID 70D BPRAON WO 9TOAIWL SNSOJASIG <JV opuoy \L pue yioog <f <SOD 8POOT ANT <PU o8Pray GS vsosapuod 8q sydwiAu M,9ScITI <Ns 8To UMOJI[SUIYS ppTST <UMO}JI[SUIYS 70D vIseYS WO ¬lLOAWe SNSOJASIG <We IN yycydouow 8gq syduicu M,9S.811 <N6b.PE AIPM <CF WOD 1007 L AW4ed Jozery sop UE WD OOM INE SNIdAJDID <PW ED yIoog <f TOD 8SOOT HEOE +68 AMH JO JJO E SIMA Gl o[euloy yNpe M.IToCIT NuCbove 8sstq UIA SNBUTPY JO AA TU C*] OD redearyx ZY ScOdWN snidAjpon <Py C O yIoog <fF TOD *sOOTHEOE -A9TIPA TOMAS PR synp2 <d a]RUldy Npe NM SEoTIT (NU 6ToVE jo q sojiw 9 8py uiseg toddoad :oD iedearx ZV LEOUWe sniddjpov <We JSOH{ Snug aBeIS IIT so] RUIpIOOD UONBWIOJUT UOTIDAT[OD 2P9D VWNA auRN saroedg <SISATBUR IP[NSITOU IOJ pasn suoumtdedg "~ FQuLl VOLUME 108, NUMBER 4 YS) using a Qiagen DNeasy® kit (Qiagen Inc., ograms of individuals within species were Valencia, California, U.S.A.). DNA was aligned in Sequencher 4.0.5 and examined extracted non-destructively in many sam- to identify variable sites and indels. ples so that the cuticle could be saved for identification. In the remaining cases, RESULTS AND DISCUSSION a dead adult female found in association Molecular evidence supports the syn- with the other life stages used for DNA onymy of M. matsumurae and M. extraction was preserved and mounted resinosae with the new inclusion of M. for identification. Identification was per- thunbergianae. Morphological analysis formed using published keys and descrip- corroborates this information - no dis- tions (Kuwana 1905, Bean and Godwin cernible consistent morphological differ- 1955, Ray 1982, Miller and Park 1987, ences are observed. Foldi 2004) supported by knowledge of Nucleotide sequence data.4Matsu- each species9 known distribution and coccus matsumurae, M. resinosae, and host-plant(s) and, in the case of #. M. thunbergianae had identical sequences thunbergianae, by the authorative identi- for thel8S and 28S D10 regions. The fication of Seung-Chan Park who was one D24D3 region of 28S revealed a total of of the describers of this species (Miller four polymorphisms among these three and Park 1987). Standard methods for species. This amount of divergence is scale insect DNA analysis were utilized similar to that seen in other Matsucoccus for molecular work (Cook et al. 2002, species in terms of polymorphic sites or Downie and Gullan 2004). Targeted intraspecific divergence, as exemplified DNA sequences (Table 4) were obtained by M. acalyptus Herbert, M. bisetosus using Polymerase Chain Reaction, gel Morrison, and M. gallicolus Morrison agarose DNA visualization, and auto- (Table 5). A pairwise difference compar- mated DNA sequencing at the UC Davis ison showed a maximum of 0.1% se- Division of Biological Sciences DNA quence difference in the D24D3 region of Sequencing Facility. Sequences were edi- 28S between M. matsumurae, M. resino- ted in Sequencher version 4.0.5 (Gene sae, and M. thunbergianae (Table 6). Codes Corp, Ann Arbor, Michigan, This is less than the 0.8% recorded U.S.A.) and aligned in Se-Al (Rambaut within M. acalyptus, 0.7% within M. 1996). PAUP* (Swofford 2003) was used bisetosus and 0.9% within M. gallicolus for determining pairwise differences (Table 6). Maximum parsimony recon- among species of Matsucoccus. As part struction revealed no phylogenetic struc- of a larger phylogenetic project, sequence ture among the individuals of M. matsu- data from two nuclear ribosomal genes murae, M. resinosae, and M. thunber- were analyzed (Booth, Cook, and Gullan, gianae. However, the clade containing unpublished data). The markers exam- M. matsumurae, M. resinosae and M. ined were the small subunit ribosomal thunbergianae had 100 percent bootstrap gene (SSU rDNA or 18S) and the D2, D3 support and Bayesian posterior proba- and D10 expansion regions of the large bilities value of 100 (Booth, Cook, and subunit ribosomal gene (LSU rDNA or Gullan, unpublished data). 28S) for a total of approximately 2,070 Morphology.4Many 4 coccidologists base pairs. These sequences were aligned have treated M. matsumurae and M. and compared to assess the amount of resinosae as synonyms based on mor- genetic difference between purported spe- phology and life history data (Herbert cies. Polymorphic sites within individuals 1921,= Morrison9 "1928; <Ray, 1932. were identified by examining electropher- McClure 1983b, Kosztarab 1996) but ograms in Sequencher 4.0.5. Electropher- no formal synonymy has been published 754 PROCEEDINGS OF THE ENTOMOLOGICAL SOCIETY OF WASHINGTON Table 3. Morphological features of adult females examined for cladistic analysis. Morphological Characters Character States Size (a) under 3 mm; (b) typically larger than 3 mm Body Shape (a) elongate-ovoid; (b) ovoid with two parallel lobes; (c) club shaped Dorsum Bilocular tubular duct distribution (a) on apical part of abdomen; (b) in rows on entire body Cicatrix bands (a) absent; (b) 1-4 bands; (c) =5 bands Cicatrix diameter (a) <9 um; (b) 9-20 um; (c) =25 um (a) absent; (b) reduced; (c) fully developed Antennal segmentation (a) 243; (b) 4-8: (c) 9 Segment 5 of antennae with 142 (a) absent; (b) present fleshy setae Long trochanter setae (a) 1 long setae; (b) 2 long setae; (c) 0 setae Long setae near coxae (a) absent; (b) present Long setae midventrally on abdominal (a) absent; (b) present segments V4VII Abdominal spiracles (a) 3 pairs; (b) >3 pairs Multilocular disk pores (a) absent; (b) present Setae in marginal abdominal bands (a) absent; (b) present of bilocular ducts (see Ben-Dov 2005). Below we formally description of M. thunbergianae recog- synonymize these three names. No dis- nizes this similarity (Miller and Park cernible and consistent morphological 1987), but notes that the main differences differences were observed among speci- lie in the morphology of the adult male mens identified as M. matsumurae, M. and several biological characteristics, as resinosae, and M. thunbergianae. A re- we explained in the introduction. The view of the morphology of the adult morphological differences among the females for a larger cladistic study males of the three species are primarily (Booth, Cook and Gullan, unpublished) size differences. However, there is sub- shows the three species to be identical stantial overlap among the three species based on 14 characters, including pore in the size ranges for all morphological types, antennal morphology, and setal features measured by Miller and Park characters, typically used to distinguish (1987), including: penial sheath length, species of Matsucoccus (Table 3). The aedeagus length, length of antennal Table 4. Genes and associated primers used for molecular analyses. Gene Region Primer Sequence (59439) Primer Name Primer Source 18S 24-585 CTGGTTGATCCTGCCAGTAG 18S42880 Tautz et al. (1988) CCGCGGCTGCTGGCACCAGA 18S4B von Dohlen and Moran (1995) 28S D2-D3 GAGAGTTMAASAGTACGTGAAAC $3660 Dowton and Austin (1998) expansion TCGGARGGAACCAGCTACTA A335 Whiting et al. (1997) region D10 expansion GAATGGATTAACGAGATTCTCAA None Modified from region Dietrich et al. (2001) CACAATGATAGGAAGAGCC None Dietrich et al. (2001) VOLUME 108, NUMBER 4 ~) Nn Nn Table 5. Genetic differences among species for DNA sequences 18S and 28S. rr Number of Polymorphic Number of Polymorphic Species Sites within Individuals Sites within Species M. acalyptus JMBO037 0 5 sites + two indels JMBO038 JM B040 0 M. bisetosus JMBO13 0 6 sites; no indels JMB026 JMBO029 0 M. gallicolus JMBO023 0 1 site: no indels JMBO024 JMB036 0 M. matsumurae; M. resinosae; M. thunbergianae (matsumurae ) JMBO014 4 sites: no indels JMB047 (resinosae) JMBO025 JM B030 (thunbergianae) JMBO21 4D444oS segments II4X, hind femur length, hind described (in part) by Herbert under tibia length, forewing length, ratio of the name matsumurae.= Ray (1982) also length of femur/length of tarsus, and lists Herbert9s M. matsumurae as a syno- length of longest tubular duct on ab- nym of M. gallicolus. This information dominal segment VII. was not included in the recent catalogue Bean and Godwin (1955) differentiat- of the Margarodidae (Ben-Dov 2005). ed adult females of M. matsumurae and Tang and Hao (1995) questioned the M. resinosae based on life history and species concept of M. matsumurae used a subtle morphological disparity con- by American authors, partly because of cerning the position at which the trachea the confusion created by Herbert9s enters the thoracic spiracles in the in- (1921) and Morrison9s (1928) mixing up termediate or cyst instar (Bean and of M. matsumurae and M. gallicolus, and Godwin 1955). Herbert (1921) had re- also because they surmised that there described M. matsumurae based on both may be two species of Matsucoccus in Japanese and American material. How- Japan. Tang and Hao (1995) suggested ever, Herbert based his description partly that M. thunbergianae might be synony- on American material collected by Mr. mous with Kuwana9s (1905, 1907) con- J.G. Sanders from the host species P. cept of M. matsumurae, and that M#. rigida and P. virginiana. These pines are resinosae and M. liaoningensis Tang may both known hosts of M. gallicolus, and be synonyms. They based their argument not hosts of M. resinosae (Ben-Dov on purported differences in biology and 2005). As a consequence of this confu- adult body size of the two species pairs, sion with M. gallicolus, Morrison (1928) but they were selective in their use of even suggested that M. matsumurae may morphological data and their assertions be indigenous to the Atlantic seaboard of cannot be supported. the USA. Later, Morrison (1939) recog- In addition, certain morphological nized this error and, in his original features in Matsucoccus can vary in description of M. gallicolus, noted: <<This response to environmental conditions. is the insect which was figured and For example, Miller and Park (1987) 756 PROCEEDINGS OF THE ENTOMOLOGICAL SOCIETY OF WASHINGTON Table 6. Pairwise differences table (uncorrected): D24D3 region of 28S. M. M. M. M. M. M. M. M. acalyptus acalyptus 4 acalyptus 4acalyptus 4_acalyptus bisetosus __ bisetosus bisetosus (JMB002) (JMB037) (JMBO038) (JMBO039) (JMB040) (JMBO013) (JMB026) (JMBO029) M. acalyptus (JMBO02) M. acalyptus (JMB037) 0.001 M. acalyptus (JMBO038) 0.001 0.000 M. acalyptus (JMBO039) 0.004 0.003 0.003 M. acalyptus (JMB040) 0.007 0.006 0.006 0.008 M. bisetosus (JMBO13) 0.111 0.109 0.111 0.107 0.112 M. bisetosus (JMBO026) 0.109 0.108 0.109 0.106 0.110 0.000 M. bisetosus (JMBO29) 0.115 0.114 0.116 0.112 0.116 0.007 0.007 M. gallicolus (JMBO023) OMB7 0.137 0.136 0.133 0.136 Osmy, 0.117 0.118 M. gallicolus (JMBO24) 0.129 0.128 0.127 0.124 0.128 0.111 0.111 0.114 M. gallicolus (JMB036) 0.129 0.128 0.127 0.124 0.128 0.111 0.111 0.114 M. matsumurae (JMB047) 0.097 0.095 0.097 0.094 0.098 0.032 0.031 0.037 M. matsumurae (JMBO14) 0.098 0.097 0.098 0.095 0.100 0.034 0.032 0.038 M. resinosae (JMBO25) 0.099 0.097 0.098 0.095 0.100 0.034 0.033 0.038 M. resinosae (JMB030) 0.097 0.095 0.097 0.094 0.098 0.033 0.031 0.037 M. thunbergianae (JMBO021) 0.099 0.098 0.099 0.096 0.100 0.034 0.033 0.039 M. M. M. M. M. M. M. gallicolus gallicolus gallicolus matsumurae 4 matsumurae resinosae resinosae (JMB023) (JMBO024) (JMB036) (JMB047) (JMBO14) (JMBO025) (JMBO030) M. gallicolus (JMBO24) 0.007 M. gallicolus (JMB036) 0.009 0.000 M. matsumurae (JMB047) 0.115 0.108 0.108 M. matsumurae (JMBO14) 0.117 0.110 0.110 0.000 M. resinosae (JMBO25) 0.115 0.108 0.108 0.001 0.001 M. resinosae (JMBO30) 0.116 0.108 0.108 0.000 0.000 0.000 M. thunbergianae 0.118 0.111 0.110 0.000 0.000 0.001 0.000 (JMBO21) examined the overwintering and summer 1952, Foldi 2004). Boratynski (1952) generations of both M. matsumurae from indicates in his published key to the China and M. resinosae from the U.S.A. genus that the main difference between and showed that the adult females of the M. matsumurae and M. pini is the width overwintering generation of both species of the dorsal cicatrices, the number of had more multilocular pores and larger peripheral loculi in the multilocular cicatrices than the summer populations pores, the host tree, and the country of (Miller and Park 1987). Furthermore, origin. Foldi (2004) states that #. morphological plasticity in body size and matsumurae and M. pini differ in the additional features has been observed for length of the bilocular tubular ducts and other species of Matsucoccus (Boratynski the number of multilocular pores at the 1952, Ben-Dov 1981). apex of the abdomen. We examined the A fourth species of Matsucoccus, M. paralectotype females of M. pini housed pini (Green), is found on a member of the at the BMNH and their morphology falls Pinus subsection, namely Pinus sylvestris within the range of variation of #. (Green 1925). This species is distributed matsumurae. Foldi (2004) states that the throughout Europe and differs only average body size for M. pini is 2.8 mm subtly from M. matsumurae (Boratynski long, which is less than we recorded for VOLUME 108, NUMBER 4 Ul the specimens of M. matsumurae that we 14 years after Kuwana9s first description measured, however, Foldi also provides of the species. The latter specimens a greater body size range for M. matsu- were collected by Kuwana outside of murae (2.544.5 mm long). Tokyo, Japan, in 1919, whereas Kuwa- No specimens of M. pini were avail- na9s original collection was from Su- able for molecular analysis, but given the gamo, Tokyo. evidence of seasonal plasticity in size of Holotype of Matsucoccus resinosae cuticular features in Matsucoccus, the Bean and Godwin, adult female: USA: synonymy of M. pini with M. matsu- Connecticut, Easton, on Pinus resinosa, murae seems likely. Other species that June 2, 1948, collected by George H. should be examined in this context are Plumb;'"" label -also9 <iwithy ~ number the Chinese species M. dahuriensis Hu **50.2156= (USNM). In their original and Hu described from P. sylvestris var. description, Bean and Godwin (1955) mongolica (Hu and Hu 1981), M. liao- referred to an adult female holotype as ningensis ex P. tubulaeformis (Tang well as paratypes of different stages. 1QIS)S Me. <yunnanensis. Ferris9 *ex <P: However, no slides of the type series yunnanensis (Ferris 1950), and the Rus- (all in the USNM) bear any label in- sian species M. boratynskii Bodenheimer dicating which adult female is the desig- and Neumark ex P. sy/vestris (Bodenhei- nated holotype. There are two slides of mer and Neumark 1955). These host adult females with collection data match- Pinus species all belong to the same ing those given for the holotype in the Pinus subsection (Gernandt et al. 2005) original description; one slide has four as M. matsumurae and appear morpho- adult females and the other has five, but logically similar to it based on available neither slide has a type label of any kind. drawings of the adult females. In the absence of an identifiable holo- type, Ray (1982), in his unpublished Matsucoccus matsumurae (Kuwana) dissertation, chose one specimen as the primary type and clearly indicated this Xylococcus matsumurae Kuwana 1905: information on the slide, but incorrectly 91; Kuwana 1907: 209 (described again labeled it <8lectotype= instead of holo- ASmuae Sp): type. Here we properly label the pre- Matsucoccus matsumurae: Cockerell 1909: viously unlabeled holotype (as recom- 56 (change of combination). mended by F. Christian Thompson, Matsucoccus resinosae Bean and Godwin personal communication to P. J. Gul- 1955: 166. New synonymy. lan); the specimen is on the slide that has Matsucoccus thunbergianae Muller and four adult females and is the second Park 1987: 50. New synonymy. adult female from the right of the data Type material.4Syntypes of Xy/ococ- label (body length: 4.2 mm; width: cus matsumurae Kuwana: JAPAN: To- 2.2mm). Paratypes of M. resinosae: kyo, at Sugamo, on bark of the trunk of various life stages including adult fe- pine-tree; collected May 20, 1903. The males (see Bean and Godwin 1955, page type specimens of X. matsumurae were 169 for paratype information). destroyed in an earthquake in 1923 Holotype of Matsucoccus thunbergia- (Kuwana 1925, Tang and Hao 1995). nae Miller and Park, adult female: Tang and Hao (1995) incorrectly refer SOUTH KOREA: Kohung, Cholla- to a holotype and paratypes of YX. nam-do, on Pinus thunbergiana (now P. matsumurae; there is no evidence that thunbergii), collected December 1984, lab Kuwana ever designated types and the reared April 1984, collected by S.C. Park so-called 8<8paratypes99 were collected (USNM). Paratypes: 26 adult females, 36 758 PROCEEDINGS OF THE ENTOMOLOGICAL SOCIETY OF WASHINGTON adult males, 5 pupal males, 8 third-instar formation about material held there; F. males, 25 first-instar nymphs: similar Thompson (Systematic Entomology data to holotype (see Miller and Park Laboratory, USDA, Washington D.C.) 1987, page 50, for paratype information). provided nomenclatural advice. We also Diagnosis.4The adult female of M. are grateful to S.-C. Park (Department matsumurae can be diagnosed by the of Entomology, Forest Research Insti- following features: body 3.1-4.1 mm tute, Tongdaemun-gu, Seoul) for speci- long, elongate-ovoid in shape; bilocular mens from South Korea; X. Yingping tubular ducts distributed in segmental (The College of Life Science and Tech- rows on entire dorsum; 5 dorsal cicatrix nology, Shanxi University, Taiyuan) for bands on abdominal segments III to VII, specimens from China; and J. Kelley cicatrix diameter 8-14 um; antennae (Mount Pinos Ranger District, Califor- with 9 segments, segment V of antennae nia), M. Callan (New York State De- without fleshy setae; legs fully developed, partment of Environmental Conserva- one long (80-100 um) trochanter seta, tion, New Paltz), and C. Maier long setae (25434 um) near coxae on all (Connecticut Agricultural Experiment pairs of legs; 7 pairs of abdominal Station, New Haven), who collected spiracles; cluster of multilocular disk material in the U.S.A. J. Martin (The pores on ventral apex of abdomen; long Natural History Museum, London) ar- setae (26-40 um) midventrally on ab- ranged the loan of the type specimens of dominal segments V4VII, and _ setae M. pini. S. Takagi (Graduate School of present in marginal abdominal bands of Agriculture, Hokkaido University) pro- bilocular ducts. vided information on Kuwana9s_ type material. T. Kondo (UC Davis) collected CONCLUSION specimens in Japan, translated some Molecular and morphological data as Japanese literature, and read a draft of well as host use, sex pheromones, and the manuscript; T. K. Qin (Biosecurity biogeography support the formal synon- Australia) translated some Chinese text; ymy of M. matsumurae, M. resinosae and G. Morse (UC Davis) commented on M. thunbergianae. The name Matsucoc- a draft of the molecular results; D. Miller cus matsumurae (Kuwana) has nomen- and C. Ray, Jr. also made valuable clatural priority. Additional species that comments on the manuscript. The De- should be considered for synonymy 1n- partment of Parks and Recreation, Ca- clude M. pini and several other Eurasian lifornia, provided permission to collect in species. state parks. This research was supported by grant DEB-0118718 from the USS. ACKNOWLEDGMENTS National Science Foundation (Partner- L. Cook (School of Botany and ships for Enhancing Expertise in Taxon- Zoology, The Australian National Uni- omy program) to P.J. Gullan and by versity, Canberra) assisted with align- a University of California Davis Center ment and interpretation of the nucleotide for Biosystematics Grant to J. Booth for sequences; DD: Muller-vand!:)D: Creel molecular work. (Systematic Entomology Laboratory, ARS, USDA, Beltsville, Maryland) ar- LITERATURE CITED ranged the loan of specimens from the Bean, J. L. and P. A. Godwin. 1955. Description Coccoidea collection of the USNM; D. and bionomics of a new red pine scale, Miller also generously hosted a visit by J. Matsucoccus resinosae. Forest Science I: 164-176. Booth to the USNM Coccoidea collec- . 1971. Red pine scale. Forest Pest Leaflet tion in March 2005 and provided in- 10: 1-16.

See more

The list of books you might like