Logout succeed
Logout succeed. See you again!

The ability to cross the blood-cerebrospinal fluid barrier is a generic property of acute ... PDF
Preview The ability to cross the blood-cerebrospinal fluid barrier is a generic property of acute ...
Williams, M. T.S. et al. (2016) The ability to cross the blood-cerebrospinal fluid barrier is a generic property of acute lymphoblastic leukaemia blasts. Blood, (doi:10.1182/blood-2015-08-665034) This paper is a postprint of a paper submitted to and accepted for publication in IET Radar, Sonar and Navigation and is subject to Institution of Engineering and Technology Copyright. The copy of record is available at IET Digital Library. There may be differences between this version and the published version. You are advised to consult the publisher’s version if you wish to cite from it. http://eprints.gla.ac.uk/116438/ Deposited on: 10 March 2016 Enlighten – Research publications by members of the University of Glasgow http://eprints.gla.ac.uk Williams et al. Title: The ability to cross the blood-cerebrospinal fluid barrier is a generic property of acute lymphoblastic leukaemia blasts. Running title: CNS infiltration in BCP-ALL Authors: Mark TS Williams1*, Yasar M Yousafzai1,2*, Alex Elder3*, Klaus Rehe3,8, Simon Bomken3,8, Liron Frishman-Levy4,5, Sigal Tavor6, Paul Sinclair3, Katie Dormon3, Dino Masic3 , Tracey Perry7, Victoria J Weston7, Pamela Kearns7, Helen Blair3, Lisa J Russell3, Olaf Heidenreich3, Julie AE Irving3, Shai Izraeli4,5,Josef Vormoor3, 8, Gerard J Graham1, Christina Halsey9,10. 1 Centre for Immunobiology, Institute of Infection, Immunity and Inflammation, College of Medical, Veterinary and Life Sciences, University of Glasgow, UK. 2 Institute of Basic Medical Sciences, Khyber Medical University, Peshawar, Pakistan. 3 Northern Institute for Cancer Research, Newcastle University, UK. 4 Functional Genomics and Childhood Leukemia Research Center, Sheba Medical Center, Tel-Hashomer, Ramat Gan, Israel 5 Department of Human Molecular Genetics and Biochemistry, Sackler Medical School, Tel Aviv University, Tel Aviv, Israel 6 Goldyne Savad Institute of Gene Therapy, Hadassah Hebrew University Hospital, Jerusalem, Israel. 7 Institute of Cancer and Genomic Sciences, University of Birmingham, UK. 8 Department of Paediatric and Adolescent Haematology and Oncology, Great North Children’s Hospital, Newcastle upon Tyne Hospitals NHS Foundation Trust, Newcastle upon Tyne, UK. 1 Williams et al. 9 Wolfson Wohl Cancer Research Centre, Institute of Cancer Sciences, College of Medical, Veterinary and Life Sciences, University of Glasgow, UK 10 Department of Paediatric Haematology, Royal Hospital for Children, Glasgow, UK. * These three authors contributed equally to this work Corresponding author: Dr Christina Halsey, Institute of Cancer Sciences, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow G61 1QH, UK. Email: [email protected], telephone +44 141 3308135, Fax +44 141 3304297. Financial Support: This work was supported by the Kay Kendall Leukaemia Fund (KKL454, KKL515) (CH, LR) with additional funding from Cancer Research UK (C27943/A12788) (JV, OH), Leukaemia & Lymphoma Research (DM, TP, KD, PK), the European Research Council (PS), the WLBH Foundation & Chief Scientist Health Ministry ERA-NET grant (SI), the Chief Scientists’ Office (SCD/08) (CH), the Scottish Funding Council (CH) a Wellcome Trust Senior Investigator award (GG) and the Medical Research Council (G0901113, G0802259) (GG, SB). 2 Williams et al. ABSTRACT Prevention of central nervous system (CNS) relapse is critical for cure of childhood B- cell precursor acute lymphoblastic leukaemia (BCP-ALL). Despite this, mechanisms of CNS infiltration are poorly understood and the timing, frequency and properties of BCP-ALL blasts entering the CNS compartment are unknown. We investigated the CNS-engrafting potential of BCP-ALL cells xenotransplanted into immunodeficient NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ mice. CNS engraftment was seen in 23/29 diagnostic samples (79%), 2/2 from patients with overt CNS disease and 21/27 (78%) from patients thought to be CNS-negative by diagnostic lumbar puncture. Histological findings mimic human pathology and demonstrate that leukaemic cells primarily transit the blood-cerebrospinal-fluid barrier sitting in close proximity to the dural sinuses – the site of recently discovered CNS lymphatics. Retrieval of blasts from the CNS showed no evidence for chemokine receptor-mediated selective trafficking. The high frequency of infiltration and lack of selective trafficking led us to postulate that CNS tropism is a generic property of leukaemic cells. To test this we performed serial dilution experiments, CNS engraftment was seen in 5/6 mice following transplantation of as few as 10 leukaemic cells. Finally, clonal tracking techniques confirmed the polyclonal nature of CNS infiltrating cells with multiple clones engrafting in both the CNS and periphery. Overall, these findings suggest that sub-clinical seeding of the CNS is likely to be present in the majority of BCP-ALL patients at original diagnosis and efforts to prevent CNS relapse should concentrate on augmenting effective eradication of disease from this site, rather than targeting entry mechanisms. 3 Williams et al. INTRODUCTION One of the earliest advances in curative treatment for childhood acute lymphoblastic leukaemia (ALL) came with the recognition that without central nervous system (CNS) directed therapy up to 75% of children relapse within the CNS 1. Introduction of universal CNS-directed treatment resulted in a dramatic reduction in overt CNS relapses. However, disease in the CNS still poses many clinical challenges 2. CNS- directed therapy is potentially toxic to the developing brain 3 and efforts to risk-stratify and devise less toxic therapy are hampered by a lack of knowledge regarding mechanisms of CNS disease and the absence of biomarkers predictive of CNS relapse. CNS involvement is classified by identification of lymphoblasts in cytospin preparations of cerebrospinal fluid (CSF); CNS-1 (CSF white cell count (WCC) <5/µl, no blasts), CNS-2 (WCC<5/µl, visible blasts) or CNS-3 (WCC>5/µl). It is important to appreciate that CNS-1 status does not equate with absence of leukaemia in the central nervous system, early post-mortem studies on children succumbing to leukaemia frequently showed leptomeningeal involvement despite negative CSF cytology 4. Cytological classification is insensitive 5-7 and clearly inadequate for risk stratification since the majority of relapses occur in CNS-1 children 8,9 In addition, the CNS is one of the major sites of relapse in children with otherwise excellent prognosis as determined by low-risk bone marrow (BM) minimal residual disease measurements 10 suggesting that factors influencing leukaemic kill in the periphery may not apply to the CNS. It is clear that a better understanding of CNS disease is required in order to develop rational risk-stratified treatment. Two possible models for CNS relapse can be postulated (see Figure 1). Firstly, it is possible that only some leukaemic cells acquire the ability to enter the CNS and the risk 4 Williams et al. of CNS relapse depends on the presence or absence of a clone with the capacity to leave the bone marrow and enter the CNS – this may occur at diagnosis or later during the disease course (model 1). Alternatively, all leukaemic cells may have the ability to seed this compartment and sub-clinical CNS involvement at diagnosis may be universal. In this case CNS relapse is determined by whether cells can adapt to the foreign microenvironment of the CNS and evade elimination by ALL-directed therapy and/or immunological surveillance (model 2). Distinguishing between these two models is critical in order to determine the optimal approaches for risk stratification, development of biomarkers and novel therapeutics to prevent CNS relapse. Here we describe experiments that test these alternative models by addressing the qualitative question of whether every leukaemic blast and/or every individual patient/subtype of leukaemia has the intrinsic capacity to enter the CNS. We demonstrate that primary BCP-ALL blasts, even from low risk CNS-1 patients, frequently infiltrate the CNS in xenograft models by transiting the Blood-CSF barrier. We find no evidence for selective trafficking of subclones to the CNS but rather show that CNS infiltration is a generic and ubiquitous property of BCP-ALL cells. These findings support the current dogma that all children require CNS-directed therapy and suggest that novel therapies to reduce the risk of CNS relapse and/or to provide safer and less toxic CNS directed therapy should concentrate on effective eradication of cells from this site rather than targeting selected entry mechanisms. MATERIALS AND METHODS Cell culture and primary cells 5 Williams et al. SD1, REH (DSMZ, Braunschweig, Germany) and Sup B15 (ATCC, LGC-standards Middlesex, UK) cell lines were grown at 37oC, 5% CO in complete RPMI 1640, 10% 2 fetal bovine serum (FBS), 1% Penicillin/Streptomycin (Invitrogen, Paisley UK). Human primary meningeal cells (Cat #1400) and choroid-plexus epithelial cells (Cat #1310) were obtained from ScienCell laboratories (Carlsbad, CA, USA) and cultured according to supplier’s instructions. Following informed consent, diagnostic bone marrow samples from children with BCP- ALL underwent mononuclear cell enrichment using density-gradient centrifugation (Ficoll-Paque; GE Healthcare, Amersham, UK), cryopreservation in 10% DMSO/90%FBS and storage in liquid nitrogen until use. Samples originated from local institutions and the Leukaemia & Lymphoma Research (LLR) Childhood Leukaemia Cell Bank. Table 1 and supplementary table 1 list patient details. Use of human samples was approved by the West of Scotland Research Ethics Committee. ScienCell primary tissues are obtained following informed consent (www.sciencellonline.com/site /ethics.php). Xenotransplants JAX® NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ (NSG) (Charles River, Europe), or NOD.Cg- PrkdcscidIL2rgtm1Sug/JicTac (CIEA NOG®) (Taconic, Ry, Denmark) mice were kept in sterile isolators with autoclaved food, bedding and water. Xenotransplantation was performed at 6-10 weeks of age using intravenous (tail vein) or intrafemoral injections of up to 1x107 leukaemic cells, as previously described 11. Supplementary tables 2 and 3 give details of individual experiments. Methods for serial dilution and sorting of leukaemic subpopulations have been published 11. Mice were humanely killed once they became unwell, had clinical evidence of leukaemia or significant weight loss. All 6 Williams et al. animal experiments were approved by Institutional Ethical Review Process Committees and performed under UK Home Office licences. Histology Murine heads were stripped of soft tissues, fixed in 10% Neutral Buffered Formalin (NBF) (CellPath, Powys, UK) and decalcified in Hilleman and Lee EDTA solution (5.5% EDTA in 10% formalin) for 2-3 weeks. Samples were processed as described previously 12. Anti-CD45 immunohistochemistry on paraffin-embedded sections was performed as previously described 13. Imaging used Axiostar-plus or AxioImager-M2 microscopes with Axiovision and Zen software (Carl Zeiss, Cambridge, UK). Cell retrieval Following terminal CO asphyxiation mice were perfused with phosphate-buffered 2 saline (PBS) to eliminate peripheral blood contamination. Pilot experiments were performed comparing retrieval of leukaemic cells from the meninges alone vs. performing whole brain extracts of meninges and parenchyma. The former produced excellent yields of pure leukaemic cells, whilst the latter did not add to the yield and substantially reduced the viability and purity of the retrieved cells. Therefore, all experiments utilised direct retrieval of leukaemic cells from the leptomeninges by gentle scraping of the skull vault and vortexing the whole brain in PBS for 5 minutes. Femoral BM cells were retrieved by flushing with PBS. Spleen samples were collected by homogenising material through a cell strainer with PBS. Quantitative PCR RNA extraction, on-column DNase digestion, cDNA synthesis and custom designed Taqman low density arrays (TLDA) were performed as described previously 14. Two 7 Williams et al. reference endogenous control genes were included on the plate; TATA binding protein (TBP) and 18sRNA. Gene Assay IDs are given in supplementary data table 4. Both reference genes were validated according to MIQE guidelines15. Data were analysed ΔΔ using the CT method using RQ Manager 1.2.4 software (Applied Biosystems, Paisley, UK). For gene expression arrays, arbitrary expression values were derived from the CT value as described previously 16. Gene expression assay IDs are given in Supplementary Table 4. Flow cytometry Cells were washed twice in PEF (0.5% FCS, 0.5mM EDTA in PBS), incubated with anti-human Fc-receptor binding inhibitor (eBioscience, Hatfield, UK) and then with directly conjugated antibodies (supplementary table 5). Viability staining used Viaprobe (BD Biosciences, Oxford, UK), or DRAQ7 (Biostatus, Shepshed, UK). Data were acquired on a MACSQuant flow cytometer (Miltenyi Biotec) and analysed using FlowJo 7.2.4 software (Tree Star Inc, Ashland, OR USA). Clonal tracking Primograft ALL blasts were lentivirally transduced and transplanted intrafemorally into NSG mice as described previously 17. Genomic DNA was extracted from splenic and leptomeningeal leukaemic blasts using a DNeasy kit (Qiagen). Analysis of lentiviral integration sites using non-restriction-based linear amplification mediated PCR (nrLAM-PCR) was described previously 18. The linear PCR step was performed using a biotinylated primer (Btn-GCACTGACAATTCCGTGGTGTT GTC) for 99 cycles (98 °C for 10 s, 64 °C for 45 s and 72 °C for 15 s). The final amplification used two successive 30 cycle PCR reactions (98 °C for 10 s, 62 °C for 30 s and 72 °C for 2 min) with the following primers: Round 1 Fw GACCCGGGAGATCTGAATTC, Rev GCTACGTAACTCCCAACGAAG; Round 2: Fw AGTGGCACAGCAGTTAGG, Rev 8 Williams et al. GTGTGGAAAATCTCTAGCA). Illumina adaptors were added by PCR and samples were sequenced using an Illumina MiSeq. Reads were considered valid if they perfectly matched the expected vector flanking sequence. Sequences comprising less than 0.1% of the total were removed, and reads with truncations or mismatches within the remaining sequences were merged to create the final list. Statistics Student’s t-tests were used to analyse 2 parametric groups and Chi-squared tests were ≤ used to examine frequency of CNS infiltration. A p-value of 0.05 was considered significant. All analyses were performed using GraphPad Prism (La Jolla, CA, USA). RESULTS CNS engraftment in NSG mice is common and involves passage across the blood-CSF barrier To investigate the frequency and distribution of CNS engraftment, brains were examined from NSG mice xenografted with 29 different ALL samples (diagnostic BM samples and primary cells previously passaged through mice (primografts), see supplementary tables 1-3 for clinical and experimental details). CNS engraftment was observed in 23/29 patient samples (79%) across 13 different cytogenetic subtypes (Table 1). There was no difference in the frequency of CNS engraftment in primary BM samples vs. primografts (p= 0.303, Chi-squared test). CNS engraftment was seen in samples with both high and low risk clinical features (Table 2) and semi-quantitative scoring of the degree of CNS infiltration did not show clear differences between high and low risk samples (supplementary data table 2). Histopathology was consistent; showing early infiltration around the dural venous sinuses, plaques of disease in the 9