loading

Logout succeed

Logout succeed. See you again!

ebook img

The genus Leucophenga (Diptera, Drosophilidae), part I: the abbreviata species group from the Oriental region with morphological and molecular evidence PDF

release year2013
file size1.4 MB
languageEnglish

Preview The genus Leucophenga (Diptera, Drosophilidae), part I: the abbreviata species group from the Oriental region with morphological and molecular evidence

Zootaxa 3637 (3): 361–373 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2013 Magnolia Press ISSN1175-5334(online edition) http://dx.doi.org/10.11646/zootaxa.3637.3.8 http://zoobank.org/urn:lsid:zoobank.org:pub:19493296-421C-475E-AA1A-39129F2A4BBF The genus Leucophenga (Diptera, Drosophilidae), part I: the abbreviata species group from the Oriental region with morphological and molecular evidence YIRUI SU, JINMINGLU&HONGWEI CHEN1 Department of Entomology, South China Agricultural University, Wushan-lu 483, Tianhe, Guangzhou 510642, China 1Corresponding author. E-mail: [email protected] Abstract A new species group, the abbreviata group is established within the genus Leucophenga based on one known and three new species, all of which are endemic to the Oriental region: L. abbreviata (de Meijere, 1911), L. brevivena sp. nov., L. sujuanaesp. nov. and L. zhenfangae sp. nov. A key to four species of the abbreviata group and the DNA barcoding are provided. Twenty-three mtDNA COI sequences belonging to the above species are analyzed; the molecular data are used as interactive evidence to evaluate the species boundaries defined by the morphological data. Key words: DNA barcoding, Leucophenga abbreviata species group, new species, Oriental region Intrduction A total 203 species of the genus Leucophenga Mik, 1886 (Diptera: Drosophilidae) have been reported from the world, 69 spp. from the Afrotropical region, 40 spp. from the Australasian region, eight spp. from the Nearctic region, 21 spp. from the Neotropical region, 75 spp. from the Oriental region and 25 spp. from the Palearctic region (Brake & Bächli 2008); and approximately 142 species of these are orgainzed in the following ten species groups established (Bächli 1971; Okada 1990; Bächli et al. 2002): the argentata group (6 spp.), the cuthbertsoni group (2 spp.), the flaviseta group (4 spp.), the flavopuncta group (9 spp.), the maculata group (22 spp.), the mutabilis group (37 spp.), the ornata group (25 spp.), the proxima group (17 spp.), the sorii group (3 spp.) and the subpollinosa group (18 spp.) (Bächli 2012), the rest can not be placed to any of the above species groups. In the present study, three new species from southern China and Nepal are described; they are morphologically similar to Leucophenga abbreviata (de Meijere, 1911) in wing M vein distally abbreviated, not reaching wing 1 margin (Fig. 2), which is unique in the genus. Thus, a new species group is established here, the abbreviata group, based on one known and three new species. Two Afrotropical species: Leucophenga apicifera (Adams, 1905) and L. subvittata Duda, 1939, share wing M vein being distally abbreviated (Bächli 1971; Fig. 38, t, u), but the 1 postocellar seta are longer than the inner vertical seta distinctly at least in L. apicifera (Bächli 1971; Fig. 17, k), while the postocellar seta are as long as the inner vertical seta in all the Oriental species; we provisionally exclude the two Afrotropical species in the abbreviata group to avoid further confusion. It’s widely accepted that molecular data have the potential to facilitate both the identification of known species and the discovery of new ones. DNA barcoding, initially proposed by Hebert et al. (2003a), is the use of a standardized segment of the genome for rapid species identification. The 5’ end region of the mitochondrial cytochrome c oxidase I (COI) gene is recommended as the universal and standard barcoding marker for species identification (Hebert et al. 2004a; Ward et al. 2005; Ratnasingham & Hebert 2007). Various methods for DNA barcoding analysis are available and these include genetic distances, phylogenies and character attribute evaluation (Hebert et al. 2003b; DeSalle et al. 2005; Rach et al. 2008; Yassin et al. 2010; Reid et al. 2011; Zou et al. 2011). In this research, we analyze twenty-three barcode sequences of COI gene belonging to the one known and three new species in order to evaluate these species hypotheses. Accepted by S. Gaimari: 20 Feb. 2013; published: 11 Apr. 2013 361 Licensed under a Creative Commons Attribution License http://creativecommons.org/licenses/by/3.0 Material and methods Morphological study. All specimens examined were collected by sweeping on tussocks and tree trunks along streams in forest. The type specimens are deposited in Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China (KIZ) and Department of Entomology, South China Agricultural University, Guangzhou, China (SCAU). We followed Zhang & Toda (1992) and Chen & Toda (2001) for the definitions of measurements, indices and abbreviations. Molecular study. Twenty-three specimens of the abbreviata group (twelve samples of L. abbreviata, one sample of L. brevivena, seven samples of L. sujuanae and three samples of L. zhenfangae) were analyzed for molecular work in this study and the localities where they were collected are listed in Table 1. TABLE 1. Sampling and Genbank accession numbers for the COI sequences employed. Taxa Localities Accession numbers of COI L.abbreviata–GD1 Dinghushan, Zhaoqing, Guangdong, China JX235946 L.abbreviata–GD2 Huolushan, Guangzhou, Guangdong, China JX235945 L.abbreviata–GD3 Huolushan, Guangzhou, Guangdong, China JX235944 L.abbreviata–GD4 Huolushan, Guangzhou, Guangdong, China JX235943 L.abbreviata–GD5 Dinghushan, Zhaoqing, Guangdong, China JX235939 L.abbreviata–GX Bapeng, Fusui, Guangxi, China JX235936 L.abbreviata–HN Jianfengling, Ledong, Hainan, China JX235937 ♀ L.abbreviata ( )–TW1 Maolin, Gaoxiong, Taiwan, China JX235953 L.abbreviata–TW2 Taidong, Taiwan, China KC424636 L.abbreviata–YN1 Menglun, Mengla, Yunnan, China JX235951 L.abbreviata–YN2 Menglun, Mengla, Yunnan, China JX235933 L.abbreviata–YN3 Zhengxing, Jinggu, Yunnan, China JX235942 L.brevivena Menglun, Mengla, Yunnan, China JX235938 L.sujuanae–YN1 Zhengxing, Jinggu, Yunnan, China JX235935 L.sujuanae–YN2 Yixiang, Puer, Yunnan, China JX235950 L.sujuanae–YN3 Menglun, Mengla, Yunnan, China JX235934 L.sujuanae–YN4 Hesong, Menghai, Yunnan, China JX235947 L.sujuanae–YN5 Hesong, Menghai, Yunnan, China JX235948 L.sujuanae–YN6 Hesong, Menghai, Yunnan, China JX235941 L.sujuanae–YN7 Muyiji Park, Ximeng, Yunnan, China JX235952 L.zhenfangae–YN1 Yixiang, Puer, , Yunnan, China JX235949 L.zhenfangae–YN2 Hesong, Menghai, Yunnan, China JX235940 L.zhenfangae–Nepal Beni, Dhawalagini, Nepal JX235954 DNA Extraction and sequencing. For each species, total DNA was extracted using Tiangen® DNA extract kit following the manufacture’s protocols. The 5’ end region of COI gene sequences were PCR-amplified and then sequenced following the methods in He et al. (2009), using the primers COI-F1: CGCCTAAACTTCAGCCACTT (He et al. 2009) and HCO2198: TAAACTTCAGGGTGACCAAAAAATCA (Folmer et al. 1994). All sequences generated in this study were submitted to GenBank. The accession numbers are given in Table 1. Sequences were aligned using the ClustalW (Thompson et al. 1994) method implemented in MEGA 5.0 (Tamura et al. 2011) with default options. MEGA 5.0 was also used to calculate sequence divergences and to create a neighbor-joining (NJ) tree based on the Kimura-2-parameter (K2P) model which was recommended by Hebert et al. (2003a). The “barcoding gap” was estimated as the difference between the maximal intraspecific distance and 362 · Zootaxa 3637 (3) © 2013 Magnolia Press SU ET AL. minimal interspecific distances (Meyer & Paulay 2005; Meier et al. 2008). The character-based analysis was implemented using the Characteristic Attribute Organization System (CAOS) (Sarkar et al. 2008), a method that defines “DNA diagnostics”, i.e. character states shared by members of a given taxon and simultaneously absent from comparable groups. The guide tree from the NJ analysis was incorporated into a nexus file containing COI sequence data in MacClade v4.06 (Maddision & Maddision 2000). Next, the nexus file was exported to the CAOS software online program (Sarkar et al. 2002, 2008; Bergmann et al. 2009; http://boli.uvm.edu/caos-workbench) in order to define for each nominal species the set of its COI diagnostic nucleotides. TABLE 2. Combinations of diagnostic nucleotides for L. abbreviata,L. brevivena,L. sujuanae and L. zhenfangae. 1 1 1 1 1 1 1 2 2 2 2 2 2 2 1 4 5 7 7 9 9 9 9 0 0 2 3 4 7 7 0 0 1 2 3 3 4 5 2 1 0 2 0 3 6 9 3 5 9 2 4 1 4 1 8 3 3 1 4 3 L. abbreviata T T G C T A T C A C T C A T A T A C T C T T T L. brevivena T T G T A T T A A C T T A C A T T C T T C A C L. sujuanae A T A C T A T C A C T T A A G A A C A T A T C L. zhenfangae T A T C T T C T T T A T T C A A A T A T A T T TABLE 2. (Continued) 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 4 6 7 7 8 8 9 0 0 0 1 1 3 3 3 4 5 5 6 7 8 8 9 6 7 0 7 5 8 4 3 6 9 2 5 3 6 9 5 4 7 9 8 4 7 3 L. abbreviata T T C T T C A A C A T G A A T T T T T T T T T L. brevivena C A T T T T T G T A A A A A A T A T T T A T A L. sujuanae T T T C T T T A C T A G G T T A A C A C A A A L. zhenfangae T T T C A T T G C A T G A A T A T T A T G T A TABLE 2. (Continued) 3 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 5 5 5 5 9 0 1 1 2 2 2 3 4 5 6 6 8 8 8 8 9 9 9 0 1 1 2 7 2 2 8 0 3 9 2 4 0 2 8 0 3 4 9 2 6 8 4 0 1 5 L. abbreviata T T C T A A T T G A A A A T A T C T A A C C A L. brevivena T T C T A C T T A A T T A A A T T T A T T T T L. sujuanae T T C C A T T T A A A A A T A T T T A A T T A L. zhenfangae C A T C T T C C G T A A T T T A T C T A T T T TABLE 2. (Continued) 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6 2 3 4 4 4 5 5 5 7 7 8 9 9 9 9 1 2 2 3 3 3 4 8 7 0 4 6 0 2 3 3 9 8 1 2 4 7 8 4 7 0 3 9 2 L. abbreviata A T A T A C A T T A G T C T A A C C G T T A L. brevivena A T A T A T A T C A A A T A T T T C T A G T L. sujuanae T T T T A T A T T T A T C T A T T T T A A A L. zhenfangae A A T C T T T C T T A T T A A T T C A T T A Molecular result Prior to analysis the aligned sequences were edited to fragments of 678 base pairs, and no insertions/deletions or LEUCOPHENGA ABBREVIATA SPECIES GROUP Zootaxa 3637 (3) © 2013 Magnolia Press · 363 codon stops were found as expected in the functional sequences. The intraspecific distances of L. abbreviata, L. sujuanae and L. zhenfangae ranged from 0 to 0.59%, 0 to 2.70%, and 0.59% to 1.34%, respectively. It was impossible to measure the intraspecific distance of L. breviena because only a single specimen was applied in our study. The interspecific distances ranged from 8.36% of 11.39%. The differences between the maximal intraspecific distance (K2P) and minimal interspecific distances of L. abbreviata, L. sujuanae and L. zhenfangae were 7%, 5% and 8%, respectively (Fig. 1). FIGURE 1. Distribution of the intraspecific genetic variabilities of L. abbreviata (in green), L. sujuanaee (in blue), L. zhenfangae (in red) and the interspecific genetic variabilities (in orange). For the NJ tree-based analysis, all individuals of a species were recovered as a monophyletic lineage (Fig. 2) with strong support (bootstrap values = 100). For the character-based analysis, 91 diagnostic sites were found in the COI gene region for these four species of the abbreviata group (Table 2). All species revealed a unique combination of character states at 91 nucleotide positions. Systematic account Leucophenga abbreviata species group Diagnosis.M distally abbreviated, not reaching wing margin (Fig. 3A, 3D, 3G, 3J). 1 Description. Male and female: Eyes red to brownish red. Ocellar triangle dark brown to black, with a pair of setae above ocellar setae. Postocellar seta usually small. Frons brown, narrow, nearly parallel, with a few minute setulae medially. All orbital setae large; proclinate and anterior reclinate orbital setae very close together, separated by distance less than 1/2 of that between anterior reclinate and posterior reclinate. Pedicel yellow; first flagellomere brownish; arista long plumose. Face mostly yellow; facial carina undeveloped. Clypeus yellow. Palpus brownish yellow, slender in both sexes. Vibrissa prominent; other orals small. Gena and postgena narrow. Mesonotum yellow to brown, not pollinose. Postpronotal lobe with 2–4 long setae and a few of shorter setae. Acrostichal setulae in ca. 12–14 irregular rows. Prescutellar setae large. Katepisternum yellowish, with small setae medially, and 2 large ones anteriorly and posteriorly, respectively. Subscutellum swollen. Basal medial-cubital crossvein absent. Wing costal vein between R and R distally with more than 5, 6 peg-like spinules on ventral surface; R sometimes curved 2+3 4+5 2+3 to costa at tip. Halter mostly yellowish white. Legs mostly yellowish. Abdominal tergites variable in the color and 364 · Zootaxa 3637 (3) © 2013 Magnolia Press SU ET AL. pattern. Male terminalia: Epandrium usually with sparse pubescence and several setae around posterodorsal to ventral margins; apodeme usually developed (Figs 5–8A). Surstylus broad, flat, nearly entirely pubescent, with several setae on outer and inner surface (Figs 5–8A). Cercus separated from epandrium, with several setae, lacking pubescence (Figs 5–8A). Hypandrium (gonopod in Bächli et al. 2004) anteriorly fused to aedeagal apodeme, laterally broad, usually with paramedian setae subbasally. Gonopods (dorsal arch in Bächli et al. 2004) fused with each other, forming slightly triangular plate, anterioventrally with curved, median rod. Paramere (outer paraphysis in Bächli et al. 2004) contiguous to arm of aedeagal apodeme basally, lacking pubescence (Figs 5–8B). Aedeagus glabrous (Figs 5–8C); basal bridges contiguous to median rod of gonopod; apodeme with a pair of arms each contiguous to base of paramere. In the following descriptions of each species, only characters that depart from the upper universal characters are provided for brevity. FIGURE 2. Neighbor-joining tree of the abbreviata group inferred from the COI sequences. Bootstrap values generated from 1000 pseudoreplicates are given next to the nodes, and only the values above 50% are shown. Leucophenga abbreviata(de Meijere, 1911) (Figs 3A, 3B, 3C, 4A, 5) Drosophila abbreviata de Meijere, 1911: 400. Drosomyiella abbreviata. Hendel, 1914: 113. Leucophenga (Leucophenga)abbreviata. Duda, 1924: 185. Leucophenga abbreviata. Okada, 1966: 18. LEUCOPHENGA ABBREVIATA SPECIES GROUP Zootaxa 3637 (3) © 2013 Magnolia Press · 365 Diagnosis. This species is similar to L. sujuanaesp. nov. in the patterns of abdominal tergites (Fig. 4A), but can be differentiated from it by having the black bands of abdominal second to fifth tergites continuous on posterior margins (Fig. 4A), the pleura with a curved, brown longitudinal stripe above (running from base of foreleg to base of halter), but sometimes variable in length (Fig. 3C), the aedeagus round apically (Fig. 5C). FIGURE 3. Wing, mesonotum, scutellum and pleura of male: A, B, C. Leucophengaabbreviata(de Meijere, 1911); D, E, F. Leucophengabrevivena sp. nov.; G, H, I. Leucophengasujuanae sp. nov.; J, K, L. Leucophengazhenfangae sp. nov. Description. Mesonotum and scutellum mostly brownish yellow (Fig. 3B). Postpronotal lobe yellow. Katepisternum yellowish, pale below (Fig. 3C). Halter white basally, grayish brown apically (Fig. 3C). Abdominal fifth tergite sometimes nearly entirely black in some Taiwan samples. Male terminalia: Epandrium with sparse pubescence and ca. 8 setae near posterodorsal to ventral margins per side; apodeme developed (Fig. 5A). Hypandrium with a few minute sensilla subbasolaterally (Fig. 5B). Paramere slender, with a few minute sensilla distally (Fig. 5B). ♂ ♀ ♂ ♀Measurements. BL = 3.0♂2–3.82 mm in 6 , 2♀.96–3.40 mm in 5 , ThL =♂ 1.42–1.52 mm in ,♀ 1.40–1.48 mm in , WL = 2.60–3.11 mm in , 2.48–3.00 mm in , WW = 1.16–1.47 mm in , 1.08–1.24 mm in , arb = 5–7/3– 5, avd = 0.79–1.00, adf = 2.50–2.80, flw = 2.00–2.27, FW/HW = 0.30–0.32, ch/o = 0.05 (0.05–0.06), prorb = 0.50– 0.72, rcorb = 0.48–0.78, vb = 0.40–0.55, dcl = 0.50–0.56, presctl = 0.37–0.39, sctl = 1.47–1.52, sterno = 0.60–1.00, 366 · Zootaxa 3637 (3) © 2013 Magnolia Press SU ET AL. orbito = 1.80–2.33), dcp = 0.23–0.25, sctlp = 0.67– 0.71, C = 1.88–2.66, 4c = 0.92–1.16, 4v = 1.25–1.71, 5x = 0.83–1.00, M = 0.21–0.44, C3F = 0.67–0.88. FIGURE 4. Patterns of abdominal tergites of male: A. Leucophengaabbreviata(de Meijere, 1911); B. Leucophengabrevivena sp. nov.; C. Leucophengasujuanae sp. nov.; D. Leucophengazhenfangaesp. nov. FIGURE 5. Leucophenga abbreviata (de Meijere, 1911), male terminalia. A. Epandrium (epan), cercus (cer) and surstylus (sur) (lateral view); B. Hypandrium (hypd), paramere (pm) and aedeagal apodeme (aed a) (lateral view); C. Aedeagus (aed) and gonopods (gon) (lateral view). Scale lines = 0.1mm. ♀ Specimen examined. CHINA: 1 (SCAU, No. 122273), Maolin, Gaoxiong, Taiwan, alt. 300m, 3.vi.2011, XY ♂ ♀ ′ ′ Liu; 8 1 (SCAU, Nos. 122300–122308), Xiushan, Na♂nto♀u, Taiwan, 23°46N, 120°45E, alt. 350m, 18.x.2012, swept from tree trunks and tussock, HW Chen, JJ Gao; 1 1 (SCAU, Nos 122309–10), Zhiben, Taidong, Taiwan, ′ ′ ♂ ♀ 23°10N, 121°03E, 30.x.2012, alt. 340m, swept fro′m tree tru′nk, HW Chen; 14 12 (SCAU, Nos. 122274– 122299), Huolushan, Guangzhou, Guangdong, 24°50N, 123°52E, alt. 230m, 19.iii.2005, 5.iv.2005, JJ Jiang, MF ♂ ♀ Xu; 8 13 (SC♂AU, Nos 122311–31), Dinghushan, Zhaoqing, Guangdong, 24′.xi.2004, 1′5.iv.2005, HL Cao, HW Chen, MF Xu; 1 (SCAU, No. 122334), Jianfengling, Ledong, Hainan, 18°41N, 108°52E, alt. 940m, 24.iv.2007, ♂ ♀ ′ ′ T Li; 1♂1♀ (SCAU, Nos 122332, 33), Bapeng, Fusui, Guangxi, 22°05N,′ 107°32E, ′alt. 220m, 18.viii.2004, HW Chen; 2 6 (SCAU, Nos 122357–64), Zhengxing, Jinggu, Yunnan, 22°49N, 100°02E, alt. 1100m, 24.vii.2009, L ♂ ♀ ♂ ♀ ♂ ♀ ′ Wang, ′L Wu; 9 15 (4 4 in KIZ; 5 11 in SCAU, Nos 122335–50), Menglun, Mengla, Yunnan, 21°41N, 101°25E, alt. 700m, 12.ix.2002, 24–26.xii.2003, 17.iv.2007, 12.iv.2010, 27, 28.ix.2011, HW Chen, JJ Gao, YR Su, ♂ ♀ ′ ′ L Wang, L Wu; 1 5 (SCAU, Nos 122351–56), Wangtianshu, Mengla, Yunnan, 21°28N, 101°38E, alt. 600m, 13.iv.2010, JJ Gao, YR Su. Distribution. China (Taiwan, Guangdong, Hainan, Guangxi, Yunnan), Myanmar, Nepal, India (Orissa), Sri Lanka, Malaysia, Singapore, Indonesia (Sumatra, Java). LEUCOPHENGA ABBREVIATA SPECIES GROUP Zootaxa 3637 (3) © 2013 Magnolia Press · 367 Leucophengabrevivenasp. nov. (Figs 3D, 3E, 3F, 4B, 6) Diagnosis. This species is similar to L. zhengfangae in the patterns of abdominal tergites (Fig. 4B), but can be differentiated from it by having the mesonotum mostly yellowish brown and the scutellum brown (Fig. 3E), the pleura with a dark brown longitudinal stripe above (Fig. 3F), the katepisternum dark brown above, yellow below (Fig. 3F), the aedeagus acute apically (Fig. 6C). Description. Halter white basally, brownish distally (Fig. 3F). Abdominal tergites brownish; second yellow medially and a small patch laterally; third and fourth each with narrow bands on anterior margins and a small patch laterally (Fig. 4B). Male terminalia: Epandrium with pubescence except for anterior margin and ca. 10 setae near posterodorsal to ventral margins per side; apodeme developed (Fig. 6A). Hypandrium with a few minute, sensilla subbasolaterally (Fig. 6B). Paramere slender, with a few minute♂ sensill♀a distally (Fig. 6B). ♂ Measurements.BL = 3.60 mm in the holotype (range in 2 and 2 paratypes: 3.08–3.80 mm in ,3.20–3.40 ♀ ♂ ♀ ♂ mm in ♀), ThL = 1.60 mm (1.40–1.80 mm in♂ , 1.28–1.60 mm in♀ ), WL = 2.88 mm (2.16–3.08 mm in ,2.68 mm in ), WW = 1.36 mm (1.00–1.40 mm in ,1.08–1.24 mm in ), arb = 7/4 (7–8/4–6), avd = 0.77 (0.67–0.83), adf = 2.60 (2.20–2.40), flw = 2.20 (2.00–2.20), FW/HW = 0.29 (0.27–0.31), ch/o = 0.06 (0.05–0.06), prorb = 0.67 (0.59–0.81), rcorb = 0.72 (0.65–0.79), vb = 0.63 (0.42–0.67), dc1 = 0.48 (0.44–0.52), presct1 = 0.58 (0.47–0.55), sct1 = 0.90 (0.90–1.29), sterno = 0.79 (0.82–0.92), orbito = 1.20 (1.17–1.75), dcp = 0.52 (0.32–0.67), sct1p = 0.77 (0.73–1.25), C = 2.33 (1.60–2.37), 4c = 0.94 (0.77–1.00), 4v = 1.06 (1.04–1.29), 5x = 0.67 (0.56–1.00), ac = 3.25 (3.25–5.33), M = 0.31 (0.16–0♂.33), C3F = 0.67 (0.56–0.68). Type material.Holotype (SCAU, No. 122365), CHINA: Menglun, Mengla, Yunnan, alt. 700m, 12.ix.2002, ♂ ♀ HW Chen. Paratypes: 2 2 (SCAU, Nos 122366–69), same data as holotype. Etymology. A combination of the Latin words: brevis (= short) and vena (= vein), referring to the M not 1 reaching wing margin. Distribution. China (Yunnan). FIGURE 6.Leucophengabrevivenasp. nov., male terminalia. A.Epandrium,cercus andsurstylus; B. Hypandrium, paramere and aedeagal apodeme; C. Aedeagus and gonopods. Scale lines = 0.1mm. Leucophenga sujuanaesp. nov. (Figs 3G, 3H, 3I, 4C, 7) Diagnosis. This species is similar to L. abbreviata in the patterns of abdominal tergites (Fig. 4C), but can be differentiated from it by having the black bands of abdominal second and third tergites discontinuous on posterior 368 · Zootaxa 3637 (3) © 2013 Magnolia Press SU ET AL. margins at least, sometimes also occur on fourth and fifth tergites (Fig. 4C), the pleura brownish yellow above, yellow below, sometimes with a small brown patch below base of wing (Fig. 3J), the aedeagus acute apically (Fig. 7C). Description. Mesonotum mostly yellow (Fig. 3H). Scutellum mostly yellow, slightly brownish laterally, pale at tip (Fig. 3H). Halter mostly white (Fig. 3I). Male terminalia: Epandrium with sparse pubescence and ca. 9 setae near posterodorsal to ventral margins per side; apodeme slightly developed (Fig. 7A). Hypandrium with 1 long sensilla and ca. 4 sensilla subbasolaterally (Fig. 7B). Paramere slender, with a few minute sensilla distally (Fig. 7B). ♂ ♀ ♂ Measurements. BL = 3.60 mm in the holotype (range in 5 and 5 paratypes: 2.72–4.00 mm in ,2.60–4.15 ♀ ♂ ♀ ♂ mm in ), T♀hL = 1.68 mm (1.28–1.96 mm in , 1.2♂4–2.00 mm in ), W♀L = 2.92 mm (2.40–3.40 mm in ,2.32– 3.50 mm in ), WW = 1.44 mm (1.24–1.60 mm in ,1.08–1.60 mm in ), arb = 8/4 (6–8/3–5), avd = 0.80 (0.56– 1.18), adf = 2.00 (1.57–2.57), flw = 2.80 (1.71–2.80), FW/HW = 0.25 (0.18–0.30), ch/o = 0.06 (0.06–0.07), prorb = 0.78 (0.45–0.67), rcorb = 0.50 (0.44–0.70), vb = 0.43 (0.44–0.75), dc1 = 0.38 (0.29–0.58), presct1 = 0.58 (0.50– 0.75), sct1 = 1.37 (0.78–1.70), sterno = 0.75 (0.58–1.00), orbito = 1.29 (1.13–2.67), dcp = 0.25 (0.25–0.52), sct1p = 1.00 (0.63–1.36), C = 2.33 (2.27–3.52), 4c = 0.83 (0.56–1.07), 4v = 1.11 (1.13–1.35), 5x = 0.54 (0.60–1.00), M = 0.19 (0.22–0.36), C3F = 0.83 (0♂.67–0.81). Type material. Holotype (SCAU, No. 122370), CHINA: Zhengxing, Jinggu, Puer, Yunnan, alt. 1100m, ♂ ♀ ♂ ♀ 24.vii.2009, L Wang. Paratypes: CHIN′ A: 36 31′ (SCAU, Nos 122371–122437), same data as holotype; 14 23 (KIZ), Yixiang, Puer, Yunnan, 22°47N, 101°02E, alt. 1200m, 6.xii.2000, 18, 19.ix.2007, 2.x.2011, HW Chen, JJ ♂ ♀ ′ ′ Gao; 90 98 (SCAU, Nos 122438–625♂), X♀imeng, Puer, Yunnan, 22°37N, 099°35E, alt. 1100m, 31.iii–4.iv.2011, JM Lu, ZF Shao, YR Su, SJ Yan; 19 25 (SCAU, Nos 122626–69), Menglun, Mengla, Yunnan, alt. 700m, ♂ ♀ 17.iv.2007, 12.iv.2010, H′ W Chen, ′JJ Gao, YR Su, L Wang, L Wu; 2 6 (SCAU,♂ Nos♀ 122670–77), Wangtianshu, Mengla, Yunnan, 21°28N, 101°38E, alt. 670m, 25.iv.2007, HW Chen, JJ Gao; 10 11 (SCAU, Nos 122678–98), ′ ′ Hesong, Menghai, Yunnan, 21°28N, 101°38E, alt. 1900m, 16,17.iv.2010, 2.iv.2011, 8–11.iv.2011, 17.vi.2011, 6.v.2012, HW Chen, JJ Gao, ZF Shao, YR Su, SJ Yan. Etymology.Patronym of the collector Ms. Sujuan Yan (SCAU). Distribution. China (Yunnan). FIGURE 7.Leucophengasujuanae sp. nov., male terminalia.A.Epandrium,cercus andsurstylus; B. Hypandrium, paramere and aedeagal apodeme; C. Aedeagus and gonopods. Scale lines = 0.1mm. LEUCOPHENGA ABBREVIATA SPECIES GROUP Zootaxa 3637 (3) © 2013 Magnolia Press · 369 Leucophengazhenfangaesp. nov. (Figs 3J, 3K, 3L, 4D, 8) Diagnosis. This species is similar to L. brevivena sp. nov. in the patterns of abdominal tergites (Fig. 4D), but can be differentiated from it by having the mesonotum mostly yellow, the scutellum grayish yellow (Fig. 3K), the pleura yellow, slightly pale below (Fig. 3L), the aedeagus bifurcated from base to dorsal 1/3, round apically (Fig. 8C). Description. Halter grayish yellow (Fig. 3L). Abdominal tergites brown; second yellow medially and along lateral margins; third and fourth each with distinct W-shaped patches medially (Fig. 4D). Male terminalia: Epandrium with pubescence except for anterior margin and ca. 10 setae near posterodorsal to ventral margins per side; apodeme developed (Fig. 8A). Hypandrium with 2 minute, sensilla subbasolaterally (Fig. 8B). Paramere slightly broadened, with a few minute sensilla distally (Fig. 8B). ♂ ♀ ♂ ♀Measurements.BL = 3.51 mm in the♂ holotype (rang♀e in 5 and 1 paratypes: 3.25–3.47 m♂m in ,2.67 m♀m in ), ThL = 1.64 mm (1.47–1.78 mm in , 1.25 mm in ), WL = 2.80 mm (2.58–2.98 mm in ,2.40 mm in ), ♂ ♀ WW = 1.24 mm (1.11–1.25 mm in , 0.98 mm in ), arb = 9/4 (6–8/3–4), avd = 0.89 (0.71–1.00), adf = 3.00 (1.75–3.00), flw = 2.67 (2.25–3.33), FW/HW = 0.29 (0.29–0.40), ch/o = 0.07 (0.06–0.08), prorb = 0.59 (0.58– 0.91), rcorb = 0.65 (0.56–0.75), vb = 0.33 (0.33–0.50), dc1 = 0.38 (0.38–0.50), presct1 = 0.50 (0.42–0.70), sct1 = 1.50 (0.79–1.67), sterno = 0.70 (0.71–0.83), orbito = 2.00 (1.50–2.33), dcp = 0.31 (0.21–0.30), sct1p = 1.14 (1.14– 1.50), C = 2.12 (2.00–2.35), 4c = 1.06 (0.89–1.33), 4v = 1.38 (1.18–1.67), 5x = 0.71 (0.71–1.00), M = 0.31 (0.29– 0.42), C3F = 0.76 (0.73–0.81). ♂ Type ma♂ter♀ial. Holotype (SCAU, No. 122698), Yix♂iang, Puer, Yunnan, alt. 1200m, 2.x.2011, HW Chen. Paratypes: 3 1 (122699–702), same data as holotype; 1 (SCAU, No. 122703), Ximeng, Puer, Yunnan, alt. ♂ 1100m, ZF♂ Shao; 1 (SCAU, No. 122704), Hesong, Mengh′ai, Xishu′angbanna, alt. 1900m, 9.iv.2011, ZF Shao. NEPAL: 1 (SCAU, No. 122705), Beni, Dhawalagini, 27°42N, 85°19E, alt. 820m, 17.xii.2011, XS Chen. Etymology.Patronym of the collector Ms. Zhenfang Shao (SCAU). Distribution. China (Yunnan), Nepal (Beni). FIGURE 8. Leucophenga zhenfangae sp. nov., male terminalia. A. Epandrium, cercus and surstylus; B. Hypandrium, paramere and aedeagal apodeme; C. Aedeagus and gonopods. Scale lines = 0.1mm. A key to the Oriental species of the abbreviata group 1. M distally abbreviated, not reaching wing margin. . . . . . . . . . . . . . . . . . . . . . . . . . . abbreviata group . . . . . . . . . . . . . . . . . . .2 1 - M reaching wing margin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . other Leucophenga species 1 2. Abdominal fifth tergite brown, with yellow patches. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .3 - Abdominal fifth tergite entirely brownish to brown . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .4 370 · Zootaxa 3637 (3) © 2013 Magnolia Press SU ET AL.

See more

The list of books you might like