Logout succeed
Logout succeed. See you again!

The Helicobacter pylori flbA flagellar biosynthesis Proteus mirabilis PDF
Preview The Helicobacter pylori flbA flagellar biosynthesis Proteus mirabilis
J.Med.Microbiol.—Vol.51(2002),958–970 #2002SocietyforGeneralMicrobiology ISSN0022-2615 BACTERIAL PATHOGENICITY The Helicobacter pylori flbA flagellar biosynthesis and regulatory gene is required for motility and virulence and modulates urease of H. pylori and Proteus mirabilis DAVID J. McGEE, CHRISTOPHER COKER(cid:1), TRACI L. TESTERMAN, JANETTE M. HARRO(cid:1), (cid:1) SUSAN V. GIBSON{ and HARRY L. T. MOBLEY Departments of Microbiology & Immunology and {Comparative Medicine, University of South Alabama College of Medicine, Mobile, AL 36688 and (cid:1)Department of Microbiology & Immunology, University of Maryland School of Medicine, Baltimore, MD 21201, USA Helicobacter pylori and Proteus mirabilis ureases are nickel-requiring metallo-enzymes that hydrolyse urea to NH and CO . In both H. pylori and in an Escherichia coli model 3 2 of H. pylori urease activity, a high affinity nickel transporter, NixA, is required for optimal urease activity, whereas the urea-dependent UreR positive transcriptional activator governs optimal urease expression in P. mirabilis. The H. pylori flbA gene is a flagellar biosynthesis and regulatory gene that modulates urease activity in the E. coli model of H. pylori urease activity. All flbA mutants of eight strains of H. pylori were non-motile and five had a strain-dependent alteration in urease activity. The flbA gene decreased urease activity 15-fold when expressed in E. coli containing the H. pylori urease locus and the nixA gene; this was reversed by disruption of flbA. The flbA gene decreased nixA transcription. flbA also decreased urease activity three-fold in E. coli containing the P. mirabilis urease locus in a urea- and UreR-dependent fashion. Here the flbA gene repressed the P. mirabilis urease promoter. Thus, FlbA decreased urease activity of both H. pylori and P. mirabilis, but through distinct mechanisms. H. pylori wild-type strain SS1 colonised gerbils at a mean of 5:43106 cfu=g of antrum and caused chronic gastritis and lesions in the antrum. In contrast, the flbA mutant did not colonise five of six gerbils and caused no lesions, indicating that motility mediated by flbA was required for colonisation. Because FlbA regulates flagellar biosynthesis and secretion, as well as forming a structural component of the flagellar secretion apparatus, two seemingly unrelated virulence attributes, motility and urease, may be coupled in H. pylori and P. mirabilis and possibly also in other motile, ureolytic bacteria. Introduction and urease-negative mutants fail to colonise various animalmodels[5–7].Becauseureaseisanickel-requiring Helicobacter pylori causes gastritis [1], is strongly enzyme, nickel transporters, such as NixA, are required associated with the development of peptic ulcers [2] for full urease activity in both H. pylori [8] and in an and constitutes a risk factor for gastric adenocarcinoma Escherichia coli model of H. pylori urease [9,10]. H. [3,4]. The mechanisms behind the development of pylori urease was thought initially to be constitutively these diseases are not well understood. expressed [11,12], but mounting evidence suggests otherwise. Recently, a number of genes, including a Urease,whichcatalysesthehydrolysisofureatoCO and flagellar biosynthesis and regulatory gene, flbA, was 2 NH þ,iscentraltothepathogenesisofH.pyloriinfection demonstrated to modulate urease activity [9]. Further- 4 more,ureaseproteinlevels[13]andactivity[14,15]are elevated under acidic conditions and nickel has been Received 6 March 2002; revised version accepted 17 June 2002. shown to activate H. pylori urease expression transcrip- Corresponding author: Dr D. J. McGee (e-mail:dmcgee@ tionally [16]. Thus, H. pylori may modulate urease jaguar1.usouthal.edu). activityinvivoinresponsetospecificenvironmentalcues. ROLE OF flbA IN VIRULENCE, MOTILITYAND UREASE 959 Proteus mirabilis causes urinary tract infections nated sheep blood 10% v=v in a CO 5% incubator 2 including pyelonephritis and kidney stone formation, with 100% humidity for 2 days. Alternatively, H. pylori particularly in patients with indwelling catheters or was grown on F-12 agar or in F-12 broth containing structural abnormalities of the urinary tract [17–19]. fetal bovine serum 4% [38]. Kanamycin (5–20 (cid:1)g=ml) Like H. pylori, the urease of P. mirabilis is required for was added to the growth medium for selection and virulence [20]. However, in contrast with H. pylori, P. maintenance of transformants. E. coli and P. mirabilis mirabilis urease is activated transcriptionally by UreR strains(Table 1)weregrown on Luria (L) agar andin L [21] in the presence of urea [22]; no UreR homologues broth plus appropriate antibiotics at 378C. For urease exist in the H. pylori genome [23,24], and H. pylori assays with E. coli containing the H. pylori urease gene urease is not urea-inducible [25]. UreR is transcribed cluster on pHP8080, bacteria were grown in M9 from its own promoter and then activates the minimal medium as described previously [9]. For divergently transcribed ureDABCEFG urease operon urease assays with E. coli containing the P. mirabilis [21]. E. coli carrying the P. mirabilis urease gene urease gene cluster on pMID1010, bacteria were grown cluster also has urease activity that is inducible by urea in L broth to mid-log phase, and urea (100mM) was [22] and requires UreR [26], but optimal urease activity added to induce expression of the urease promoter in does not require addition of a nickel transporter gene, the presence of UreR (1 h). Cultures grown in the as it does in E. coli containing the H. pylori urease absence of urea served as uninduced controls. For (cid:2)- gene cluster. Urea-induced expression of the P. galactosidase assays with the H. pylori urease or nixA mirabilis urease (ureD) promoter-lacZ transcriptional promoters, E. coli strains were grown to mid-log phase fusion is likewise dependent on a functionally intact in M9 minimal medium. For (cid:2)-galactosidase assays UreR [26]. Clearly, P. mirabilis urease is regulated with the P. mirabilis urease promoter, E. coli strains differently from that of H. pylori. were grown in L broth to mid-log phase and urea (100mM) was added to induce urease promoter The flbA gene, which modulates H. pylori urease expression. activity, is a cytoplasmic membrane protein of 80 kDa of the LcrD protein family that is thought to be a Oligonucleotide primers used for PCR and sequence structural component of the flagellar secretion appara- analyses are listed in Table 1. Plasmids (detailed in tus [9,27,28]. Although much in-vitro data suggest Table 1) were constructed by standard molecular that FlbA homologues are involved in virulence [29– biology techniques [39,40]. Constructs were verified 33], these have not been assessed in vivo for virulence. by restriction endonuclease digestions or PCR analyses, H. pylori motility is required for colonisation of or both, and subsequently confirmed by sequence gnotobiotic piglets [34,35], mice [36] and gerbils analysis of restriction endonuclease site junctions. [37]. However, in the gerbil study, undefined and non- Plasmids pBS-flbA, pBR322-flbA and their correspond- isogenic non-motile variants of H. pylori were ing kanamycin disruption constructs are represented employed. Thus, no specific H. pylori flagellar diagrammatically in Fig. 1. biosynthesis gene has been tested for its role in virulence in the gerbil model. Motility assay A previously described isogenic flbA mutant of one Motility was assessed on F-12 soft agar. F-12 powder strain of H. pylori had both loss of motility and mix (Life Technologies) was reconstituted to a 23 elevated urease activity in a qualitative assay [27], and stock, filter sterilised and mixed with an equal volume another study indicated that flbA significantly decreased of Bacto agar (0.7%). Fetal bovine serum was added to urease activity and protein levels in E. coli containing a final concentration of 4%. Strains were inoculated by the H. pylori urease gene cluster and the nixA nickel stabbing the agar and the plates were incubated at 378C transporter gene (on pHP8080) [9]. New matters were for several days in a CO 5% incubator with 100% 2 generated by these studies. For example, urease activity humidity. Strains were considered motile if they moved and motility have not been quantified in flbA mutants away from the initial stab within 2–3 days, whereas of H. pylori, nor has the effect of flbA on urease of non-motile strains remained at the inoculation site. other motile bacterial species, such as P. mirabilis, been addressed. Furthermore, the in-vivo relevance of flbA Construction and confirmation of H. pylori homologues has not been demonstrated. The present isogenic mutants of flbA study examined these matters. H. pylori strains were electroporated (800 ohms, 2.5 kV, 25 (cid:1)F; Gene Pulser II, BioRad, Hercules, CA, Materials and methods USA) with insertionally inactivated flbA to generate flbA1 mutants (derived from pBS-flbA::aphA3) or flbA2 Bacterial strains, growth conditions, primers and mutants (derived from pBR322-flbA::aphA3) (Fig. 1 plasmids and Table 1). Two different flbA mutant constructs were H. pylori strains (Table 1) were grown at 378C on employed to ensure reproducibility of the data. The Campylobacter blood agar (CBA) containing defibri- kanamycin cassette was non-polar, thereby minimising 960 D. J. McGEE ET AL. Table1. Oligonucleotide primers, plasmids and bacterial strains Oligonucleotide primers Sequence (59–39) Remarks FlhA-F1 GCGCGGATCCGTGGCAAACGCCTTAATGAT Forward primer; upstream region of H. pylori flbA (BamHI site underlined) FlhA-R1 GCGCATCGATTGGTAAACTTGCATCATTCTCC Reverse primer; downstream of translational stop (ClaI site underlined) codon of H. pylori flbA KanDM-F2 GCGCGAGCTGTATGATTTTT Forward primer; 39 end of aphA3 KanDM-R2 CCAATTCACTGTTCCTTGCAT Reverse primer; 59 end of aphA3 LacZ-R1 TGTGCTGCAAGGCGATTAAG Reverse primer; 59 endof lacZ; used for sequence confirmation of pRS415-ureAP and pLX2106- nixAP NixA-F2 TCCCCCGGGGGAGAAGGTTCAGCCCAACAAA 59 H. pylori nixA promoter primer (SmaI site underlined) NixA-R2 CGGGATCCCGCAATTTCACAACACGCCTTT 39 H. pylori nixA promoter primer (BamHI site underlined) UreDA-F1 GCGAATTCGAAATACTTGCAAATCCTTTTGA 59 H. pylori ureA promoter primer (EcoR1 site underlined) UreDA-R1 GCGGATCCTCTTTTGGGGTGAGTTTCATC 39 H. pylori ureA promoter primer (BamHI site underlined) Source or Plasmids Parent Description reference pBluescript II SK and KS (–) ColE1 ori; Apr; cloning vectors Stratagene pACYC184 p15A ori, Cmr, Tcr; low copy cloning vector New England Biolabs pBR322 ColE1 ori; Apr ; Tcr; cloning vector New England Biolabs pKHKS303 pBluescript II KS (–) p15A ori; Cmr; low copy cloning vector with blue-white J. Kyle Hendricks screen pHP1 pUC19 ColE1 ori; Apr; Knr; source of aphA3 non-polar cassette H. Kleanthous, Acambis pBS-Kan pBluescript II SK (–) 1.2-kb EcoRI aphA3 non-polar cassette from pHP1 This study cloned into same site in pBluescript II SK (–) pBS-flbA pBluescript II SK (–) ColE1 ori; Apr; H. pylori 2.4 kb flbA gene including 9 promoter cloned into the BamHI and ClaI sites of pBluescript II SK (–) pBS-flbA::aphA3 (flbA1) pBS-flbA Apr; Knr; flbA disrupted by insertion of blunted 1.2-kb This study aphA3 cassette from pHP1 into NheI site (bp 727 within flbA coding sequence) in pBS-flbA pBR322-flbA pBR322 PCR-amplified 2.4-kb flbA gene including promoter This study (primers FlhA-F1 and FlhA-R1) from pBS-flbA using Vent DNA polymerase and cloned into unique SspI site of pBR322 pBR322-flbA::aphA3 (flbA2) pBR322-flbA flbA disrupted by insertion of the 1.2-kb SmaI-HincII This study aphA3 cassette from pBS-Kan into the unique SspI site (bp 669 within flbA coding sequence) in pBR322-flbA pMID1010 pBR322 ColE1 ori, Apr; pBR322 encoding the entire P. mirabilis 21 urease gene cluster p˜R10bureD-lacZ pBluescript II SK (–) ColE1 ori; Apr; encodes P. mirabilis ureR and a ureD- 26 lacZ transcriptional fusion pCC038 pKHKS303 p15A ori, Cmr; 2.4-kb SpeI-KpnI flbA gene including This study promoter from pBS-flbA ligated to same sites in pKHKS303 pRS415 pBR322 ColE1 ori; Apr; 10.8 kb; promoterless lacZYA 62 pRS415-ureAP pRS415 651-bp PCR-amplified fragment (primers UreDA-F1 and This study UreDA-R1) containing the urease promoter, with pHP8080 as template, and cloned into the BamHI/EcoRI sites of pRS415 (transcriptional fusion) pLX2106 pACYC184 and pRS415 p15A ori; Cmr; 11.3 kb; promoterless lacZYA from Xin Li pRS415 cloned into EagI and EcoRV sites in pACYC184; has BamHI and SmaI cloning sites upstream of lacZYA pLX2106-nixAP pLX2106 606-bp PCR-amplified fragment (primers NixA-F2 and Susan Harrington NixA-R2) containing the nixA promoter from pUEF201 (contains nixA from H. pylori strain 43504) cloned into SmaI and BamHI sites of pLX2106 (transcriptional fusion) pWSK29 pSC101 ori, Apr; low copy cloning vector; 5.4 kb 63 pWSK29-flbA pWSK29 2.4-kb BamHI and ClaI flbA gene including promoter This study from pBS-flbA cloned into same sites in pWSK29 pUEF201 pBluescript II SK (–) nixA-containing clone from H. pylori strain 43504 10 pHP8080 pACYC184 H. pylori urease gene cluster cloned from strain 9 UMAB41 and nixA cloned from strain 43504 continued overleaf ROLE OF flbA IN VIRULENCE, MOTILITYAND UREASE 961 Table1. (continued) Source or Bacterial strains Relevant genotype or description reference E. coli DH5Æ F(cid:3)supE44, ˜lacU169 ((cid:4)80 lacZ ˜M15), hsdR17, recA1, Bethesda Research endA1, gyrA96, thi-1, relA1 Laboratories MC1061 araD139, ˜(ara-leu)7696, ˜(lac)174, galU, galK, rpsL, American Type thi-1, hsdR2 (rk(cid:3)mk+), mcrB1 Culture Collection SE5000 F(cid:3), araD139, ˜(argF-lac)U169, rpsL, relA1, ptsF25, 64 rbsR, flbB5301, recA56 P. mirabilis HI4320 Wild-type, pyelonephritis strain 17 H. pylori 26695 Wild-type, genome sequenced, non-motile variant 24 ATCC 43504 Wild-type, type strain American Type Culture Collection HPDJM17 Wild-type, clinical isolate obtained by biopsy from a This study patient with suspected gastritis at the University of Maryland Hospital, Baltimore, MD J68 Duodenal ulcer isolate, cag(–) Richard Peek J75 Gastritis isolate, cag(–) Richard Peek J166 Duodenal ulcer isolate, cag(+) Richard Peek B194A Gastritis isolate, cag(+) Richard Peek SS1 Wild-type mouse-adapted strain Adrian Lee UMAB41 Wild-type, clinical isolate obtained by biopsy from a 45 patient with suspected gastritis at the University of Maryland Hospital, Baltimore, MD FlhA-F1 FlhA-R1 (cid:2)185 (cid:1)1 (cid:1)2202 (cid:1)2246 pBS-flbA (2.4 kb insert) flbA (hp1041) and pBS-flbA::aphA3 (flbA1) B C (cid:1)727 N KanDM-R2 KanDM-F2 aphA3 (non-polar; 1.2 kb) FlhA-F1 FlhA-R1 pBR322-flbA (2.4 kb insert) flbA (hp1041) and pBR322-flbA::aphA3 (flbA2) (3.6 kb insert) S’B CS’ (cid:1)669 S Fig.1. flbAconstructsused.PlasmidspBS-flbA,pBS-flbA::aphA3(forgenerationofflbA1mutantsinH.pylori),pBR322-flbAand pBR322-flbA::aphA3 (for generation of flbA2 mutants in H. pylori) were constructed as indicated in Table 1. Large arrows, directionoftranscription;smallarrows,primersusedforPCRconfirmationofH.pyloriflbAmutants;B,BamHIsite;C,ClaIsite; N,NheIsite;S,SspIsite;S’,SspIsitelostuponcloning;+1referstotranslationstartsite.TheNheIandSspIsiteswithinflbAwere lostuponcloningofthebluntedkanamycinresistancecassette. effects on adjacent downstream genes. Chromosomal firmation of mutants. The following PCR primer pairs DNA was isolated [41] from kanamycin-resistant were used (Table 1 and Fig. 1): FlhA-F1 and KanDM- transformants and was used to re-transform wild-type R2 (1.2-kb product only in mutants), FlhA-R1 and strains to remove potential background mutations. KanDM-F2 (1.8-kb product only in mutants), FlhA-F1 Because H. pylori urease activity decreases signifi- and FlhA-R1 (2.4-kb product in wild-type, 3.6-kb cantly upon in-vitro passage (D. J. McGee and H. L. T. product in mutants). PCR conditions were: 948C for 5 Mobley, unpublished observations), first-passage trans- min (first cycle only), 30 cycles of 948C for 60 s, 608C formants were used for urease extracts and transfor- for 90 s and 728C for 90 s, followed by extension for 5 mants were passaged a second time for isolation of min at 728C. The expected size product (or lack of chromosomal DNA and subsequent PCR-based con- product) was obtained in all cases (data not shown). 962 D. J. McGEE ET AL. Urease extract preparations, protein determinations employed. p,0.05 was considered statistically signifi- and urease activity determinations cant. For H. pylori [42] or for E. coli containing the H. pylori urease gene cluster [9], extracts were prepared Results and protein concentration was determined as described. Effect of flbA on H. pylori motility The phenol hypochlorite assay for urease activity was as described previously [9, 42]. For P. mirabilis or for To understand the role of flbA in H. pylori motility, E. coli containing the P. mirabilis urease gene cluster, urease activity and virulence, flbA mutants were extracts were prepared and measured for protein generated in nine strains by two different strategies concentration and for urease activity by the phenol (Table 1, Fig. 1 and Materials and methods). All flbA red urease assay as described previously [25]. mutants tested in strain backgrounds SS1, UMAB41, 43504, HPDJM17, J68, J75, B194A and J166 were non-motile on F12-modified soft agar, in contrast to the (cid:2)-galactosidase activity determinations corresponding wild-type strain. It was confirmed that wild-type strain 26695 was non-motile [44]; this strain E. coli cells were grown to mid-exponential phase with appropriate antibiotics as described above. (cid:2)-Galacto- could not be distinguished from the flbA mutant in the soft agar assay. However, a revertant of wild-type strain sidase activity was determined by the method of Miller 26695, designated as 26695m, was isolated that was [43]. motile in the soft agar assay. Inoculation of gerbils, tissue processing and Urease activity of H. pylori flbA mutants recovery of H. pylori Eleven of 14 flbA mutants of strain UMAB41 [45] and Animal experiments were performed at the University two of three flbA mutants of strain 43504 had elevated of Maryland, with the approval of the Institute Animal urease activity compared with the corresponding wild- Care and Use Committee. Male Mongolian gerbils type strain (Fig. 2a and b, respectively; representatives (Meriones unguiculatus; Charles River) were inocu- shown). In contrast, flbA mutants of strains 26695 (21 lated twice orally (2 days apart) with 50 (cid:1)l of F12- of 31 mutants tested) and HPDJM17 (4 of 4 mutants broth-grown H. pylori strains (SS1 background) tested), showed reduced urease activity (Fig. 2c and d, suspended in sterile PBS (pH 7.4) to 109 viable cfu/ respectively; representatives shown), whereas flbA ml. Control animals received PBS. At 4 weeks after mutants of the fresh clinical isolate J75 had no infection, animals were anaesthetised (Avertin, 125mg/ detectable urease activity (2 of 2 mutants tested; Fig. kg), exsanguinated by cardiac puncture and euthanased 2e). Other strains of H. pylori containing the flbA by cervical dislocation. Stomachs were removed, dis- mutation exhibited no effect on urease activity: strain sected longitudinally along the greater curvature and SS1 (3 of 3), fresh clinical isolates J68 (2 of 2), B194A washed several times in sterile PBS. The antrum was (3 of 3), and J166 (3 of 3). The urease data were dissected into two halves. One was weighed and then consistent regardless of the construct (flbA1 or flbA2) homogenised (Ultra-Turrax T25, IKA Works.) in 1 ml used to obtain the flbA mutants. Two-thirds (42 of 65) of sterile PBS. The other half was fixed in formalin of the flbA mutants and five of nine H. pylori strain 10% for histology. Antrum homogenates and dilutions backgrounds showed changed urease activity, but of them in PBS were plated for viable counts in whether this was an increase or decrease was clearly triplicate on CBA containing nalidixic acid 10 (cid:1)g=ml, strain-dependent. Consistent data were obtained for vancomycin 10 (cid:1)g=ml, amphotericin B 2 (cid:1)g=ml, baci- wild-type and mutants of a single strain. The second tracin 30 (cid:1)g=ml, polymyxin B 10U/ml and trimetho- observation from these experiments was that urease prim 10 (cid:1)g=ml to suppress normal flora. activity among wild-type H. pylori strains varied widely, ranging from 7000 units for strain 26695 to Histology 55000 units for strain HPDJM17 (Fig. 2a–e). Antrum sections were embedded in paraffin, sectioned (5 (cid:1)m), stained with haematoxylin and eosin and H. pylori flbA effect on urease activity in E. coli containing genes for H. pylori urease and NixA evaluated in a blind fashion. nickel transporter Because flbA caused a strain-dependent modulation of Statistical analysis of data urease activity in H. pylori, it would be difficult to Statistical analyses of urease and (cid:2)-galactosidase decipher the reasons for the strain differences without activities were calculated by the alternative Welch’s t extensive genetic characterisation of them. Therefore, test; statistical analysis of colonisation data was made an E. coli model of H. pylori urease activity was used, by the Mann-Whitney t test. Instat 2.03 software in which genetic variability could be minimised. In this (GraphPad Software, San Diego, CA, USA) was model, the H. pylori urease gene cluster and the nixA ROLE OF flbA IN VIRULENCE, MOTILITYAND UREASE 963 a b * 20000 30000 * * * * 15000 * * 20000 * 10000 10000 5000 0 0 1 1 2 3 4 1 2 3 4 43504 flbA1#1 flbA1#2 flbA1#4 4 # # # # # # # # B 1 1 1 1 2 2 2 2 A A A A A A A A A U M flb flb flb flb flb flb flb flb n) ei ot c d pr of 12000 60000 g m n/ 10000 50000 mi (cid:1)/ * H4 8000 40000 N * ol * m 6000 30000 n * ctivity ( 4000 * * * 20000 * a * c * cifi 2000 10000 e p s e 0 0 Ureas 26695 flbA1#21flbA1#22flbA1#23flbA1#24flbA2#32flbA2#33flbA2#34flbA2#35 HPDJM17 flbA1#3 flbA1#4 flbA2#3 flbA2#4 e 10000 8000 6000 4000 * * 2000 0 J75 flbA1#5 flbA1#6 Fig.2. Ureaseactivityofwild-typeandflbAmutantsofH.pylori. Extractsofwild-typeandisogenicflbAmutantsofbloodagar- grown H. pylori were measured for urease activity by the phenol-hypochlorite urease assay. Data are given as urease specific activity(nmolNH þ=min=mgprotein)andSD.RepresentativeflbAmutantsareshown,eachofwhichwasaseparatetransformant. 4 #Transformantnumber.(cid:1)Exceptwherenoted,p,0.05comparedwiththecorrespondingwild-typestrain.(a)StrainUMAB41and isogenicflbAmutants.Datashownareduplicateortriplicatesamplesfromoneexperimentrepresentativeofthree.Eachexperiment was a separate transformation procedure. (b) Strain 43504 and isogenic flbA mutants. Data shown are duplicate or triplicate samplesfromoneexperiment.(c)Strain26695andisogenicflbAmutants.Datashownareduplicateortriplicatesamplesfromone experimentrepresentativeoffive.Eachexperimentwasaseparatetransformationprocedure.(d)FreshclinicalisolateHPDJM17 andisogenicflbAmutants.Datashownareduplicateortriplicatesamplesfromoneexperiment.(e)FreshclinicalisolateJ75and isogenicflbAmutants.Datashownareduplicatesamplesoftwoindependentmutantsfromoneexperimentrepresentativeoftwo. Eachexperimentwasaseparatetransformationprocedure.p¼0:0001betweenwild-typeandflbAmutant. 964 D. J. McGEE ET AL. nickel transporter gene were on plasmid pHP8080 and ureAP/pKHKS303) (p.0.05). Similarly, no differences this permitted urease activity in E. coli [9]. The model were observed when the same constructs were trans- allowed exploration of genes that affect urease or nixA formed into E. coli strain DH5Æ. No (cid:2)-galactosidase expression without the excessive variability observed activity was observed when the H. pylori urease with H. pylori. To investigate further the role of flbA in promoter was omitted from the construct (as plasmid modulating H. pylori urease activity, the flbA gene was pRS415). In contrast, the flbA gene significantly subcloned and the resultant plasmid (pBS-flbA) DNA decreased expression of the nixA promoter in E. coli was transformed into E. coli (pHP8080). Urease MC1061 (pLX2106-nixAP) by about three-fold activity was reduced 15-fold compared with the vector (p,0.0001) (Fig. 4). No (cid:2)-galactosidase activity was control strain (Fig. 3). Disruption of flbA with a observed when the H. pylori nixA promoter was kanamycin resistance cassette restored urease activity omitted from the construct (as plasmid pLX2106). in E. coli (pHP8080/pBS-flbA::aphA3) to levels of the vector control strain, E. coli (pHP8080/pBS) (Fig. 3). This suggested that flbA functioned as a urease- Effect of flbA on P. mirabilis urease activity in E. decreasing factor in the E. coli model. coli Because flbA decreased urease activity of some H. pylori strains, it was of interest to investigate the effect Effect of flbA on the H. pylori urease promoter of flbA on other bacterial ureases. The P. mirabilis and on expression of the nixA promoter urease was chosen as a model because urease The flbA gene may decrease urease activity by regulation is well understood in this system [7]. The decreasing promoter activity of urease or nixA within P. mirabilis urease gene cluster has a positive pHP8080, or by increasing turnover of urease subunits. transcriptional activator of urease gene expression, It was shown previously that flbA decreased expression UreR, which is divergently transcribed from the rest of the urease subunits UreA and UreB, supporting the of the ureDABCEFG urease gene cluster and activates increased turnover model [9]. To address the other two transcription of itself and the ureDABCEFG operon possibilities, flbAwas transformed into E. coli contain- only in the presence of urea. Plasmid pCC038, ing nixA promoter- or urease promoter-lacZ transcrip- containing flbA in low copy, was transformed into E. tional fusion plasmids (Table 1) and the resultant coli DH5Æ harbouring pMID1010, which encodes the strains were assayed for (cid:2)-galactosidase activity. H. entire P. mirabilis urease gene cluster. Transformants pylori flbA had no effect on the H. pylori urease were grown in the presence of 100mM urea and promoter in E. coli strain MC1061 containing pRS415- assayed for urease activity. Urease activity was ureAP (urease promoter-lacZ fusion) and pCC038 decreased seven-fold when compared with the (Table 1; low copy plasmid harbouring flbA); the mean vector control-containing strain, DH5Æ (pKHKS303/ (cid:2)-galactosidase activity was 1275 Miller Units in pMID1010) (p,0.001) (Fig. 5a). Only very low basal MC1061 (pRS415-ureAP/pCC038) versus 1529 Miller levels of urease activity were observed for both strains Units in the vector control strain, MC1061 (pRS415- cultured in the absence of urea. 2500 15000 n) ei 2000 vityprot pecific actimin/mg of 1500 Units 10000 ease s(cid:1)NH/4 1000 Miller * * Urol 500 5000 m n * ( 0 pBS pBS-flbA pBS-flbA::aphA3 0 Fig.3. EffectofH.pyloriflbAonureaseactivityinanE.coli pBS pBS-flbA#1 pBS-flbA#2 model of H. pylori urease. E. coli strain SE5000 containing pHP8080 (H. pylori urease generating system) and the con- Fig.4. EffectofflbAonthenixApromoterby(cid:2)-galactosidase structslistedinthefigureweregrownovernightinM9minimal assaysinE.coli.E.colistrainMC1061containingpLX2106- mediumcontaining1 (cid:1)Mnickelchlorideandureaseactivities nixAPpluseitherpBSortwoindependent,confirmedtransfor- ofcytosolicextractsweredeterminedbythephenol-hypochlor- mants containing pBS-flbA, were grown to mid-log phase in ite urease assay. Data are given as urease specific activity M9 minimal medium and (cid:2)-galactosidase activity was deter- (nmol NH þ=min=mg of protein) and SD and are an average mined.Datashownarerepresentativeoftwoexperimentseach 4 of at least three experiments each conducted in duplicate or conductedintriplicate.Theaverage(cid:2)-galactosidaseactivityin triplicate.(cid:1)p,0.0001comparedwiththevectorcontrolstrain Miller Units and SD are shown. (cid:1)p,0.0001 compared with andwiththeflbA::aphA3vector-containingstrain. thevectorcontrolstrain.#Transformantnumber. ROLE OF flbA IN VIRULENCE, MOTILITYAND UREASE 965 a b 400 25 * n) y 20 ease specific activity(cid:1)NH/min/mg of protei4 320000 uction in urease activitfrom H14329 (%) 1150 Urol 100 ed m R 5 n ( * 0 0 pKHKS303 pCC038 HI4320 HI4320 Vector flbA pKHKS303 pCC038 Vector flbA c 250 200 150 s nit U er Mill 100 * 50 * 0 pKHKS303 pCC038 pKHKS303 pCC038 Vector flbA Vector flbA Urea (cid:2) (cid:2) (cid:1) (cid:1) Fig.5. Effect of flbAon urease of P. mirabilis. (a) Effect of flbA on urease activityof E. coli (pMID1010). E. coli strain DH5Æ containingpMID1010(P.mirabilisureasegeneratingsystem)andtheconstructslistedinthefigureweregrowntomid-logphasein L broth and the urease promoter was induced by growth with 100mM urea for 1h, or left un-induced. Supernatant (cytosolic) extractsfromFrench-pressedlysateswereassayedforureaseactivitybythephenolredassay.Datashownarerepresentativeofsix experimentseachconductedintriplicate.Theaverageureaseactivityand2SDareshown.(cid:1)p,0.001comparedwiththevector controlstrain.(b)EffectofflbAonureaseactivityofP.mirabilis.P.mirabilisHI4320orHI4320containingtheconstructslistedin thefigureweregrownandprocessedasdescribedinFig.5a.Datashownarerepresentativeofthreeexperimentseachconductedin triplicate. Urease activity from vector-free HI4320 ((cid:5)average 35000 nmol NH þ=min=mg of protein) was set to 100%. The 4 percentdecreasefromvector-freeHI4320wascalculatedbythefollowingformula:100(cid:1) [(ureaseactivityofvector-freeHI4320) – (ureaseactivityofvector-containingorflbA-containingHI4320)]=ureaseactivityofvector-freeHI4320.Theaverageand2SD areshown.(cid:1)p,0.001comparedwithHI4320andwithHI4320(pKHKS303).(c)EffectofflbAontheP.mirabilisureasepromoter. E. coli strain DH5Æ containing the P. mirabilis urease promoter (as construct p˜R10bureD-lacZ) and the constructs listed were grown as described in Fig. 5a and (cid:2)-galactosidase activity was determined. Data shown are representative of three experiments eachconductedintriplicate.Theaverage(cid:2)-galactosidaseactivityinMillerUnitsand2SDareshown.(cid:1)p,0.001comparedwith thevectorcontrolstrain. 966 D. J. McGEE ET AL. Effect of flbA on urease activity in P. mirabilis colonised and this one animal had a mean of only HI4320 5:53103cfu=g of antrum, barely above the detection limit of 93102cfu=g. Lack of colonisation by the flbA When grown in the presence of 100mM urea, P. mutant was not due to loss of urease activity, because mirabilis HI4320 (pCC038), which contains flbA, the flbA mutant of strain SS1 had wild-type urease produced 20% less urease activity than P. mirabilis activity. No H. pylori or Helicobacter-like organisms containing the vector control, pKHKS303 (Fig. 5b). were recovered from animals inoculated with buffer This suggested that the flbA gene product of H. pylori alone. These results indicated that flbAwas required for repressed the expression of urease produced by P. H. pylori to colonise gerbils. mirabilis. Only very low basal levels of urease activity were observed for both strains when cultured in the absence of urea. Occurrence of chronic gastritis and ulcers in antral tissue from gerbils infected with wild-type Effect of flbA on P. mirabilis ureD promoter H. pylori and the flbA mutant expression in E. coli The antrum from gerbils inoculated with wild-type H. To determine whether flbA repressed the P. mirabilis pylori strain SS1 exhibitedmicro-ulcer formation (three urease promoter, plasmid pCC038 containing flbA or of six animals) (Fig. 6a), lymphoid follicle formation thevector control, pKHKS303, was transformed into E. and lymphocytic infiltration (one of six animals) (Fig. coli DH5a harbouring plasmid p˜R10bureD-lacZ, 6b), disruption of the ordered gastric pit and glandular which encodes the P. mirabilis ureD promoter tran- architecture (six of six animals) and small foci of scriptionally fused to lacZYA [26]. This plasmid also necrosis. In contrast, the antra from gerbils inoculated has the functional ureR gene, which is required with the flbA mutant (six of six animals) (Fig. 6c) or for expression of the ureD promoter. (cid:2)-Galacto- sterile buffer (Fig. 6d) exhibited no lesions. sidase activity from urea-induced cultures of DH5Æ (p˜R10bureD-lacZ/pCC038) was decreased 4–5-fold (p,0.001), as compared with the vector control strain, Discussion DH5Æ (p˜R10bureD-lacZ/pKHKS303) (Fig. 5c). Only nominal basal levels of (cid:2)-galactosidase activity were H. pylori FlbA is a cytoplasmic membrane protein that detected in the uninduced controls grown in the is required for motility and virulence and acts as an absence of urea. This suggested that the flbA-mediated urease-decreasing factor in E. coli models containing decrease of urease activity was dependent on urea and either the H. pylori or the P. mirabilis urease gene a functional UreR. clusters. Although FlbA affects the urease of both human pathogens, the mechanisms are distinct due to dissimilarities in the regulation of the urease gene Requirement for flbA for colonisation of gerbils clusters (Table 3). For P. mirabilis, the urease gene by H. pylori cluster is activated by the transcriptional regulator Previous work based solely on in-vitro data has UreR in the presence of urea and a high affinity nickel speculated that flbA homologues are important in transporter is not required for optimal urease activity in virulence [29–33]. To determine whether flbA was the E. coli model (Table 3). When provided in trans, H. important for virulence in vivo, gerbils were inoculated pylori flbA decreased urease activity in E. coli with either wild-type H. pylori strain SS1, the isogenic (pMID1010) – i.e., with the urease-generating system flbA mutant or sterile buffer. Of six animals inoculated of P. mirabilis – and in wild-type P. mirabilis HI4320 with SS1, five were colonised with a mean of in the presence of urea and UreR (Fig. 5a and b) by 5:43106cfu=g of antrum (Table 2). In contrast, only specifically repressing transcription from the P. mir- one of six animals inoculated with the flbA mutant was abilis urease promoter (Fig. 5c). In contrast with P. Table2. Role of H. pylori flbA in colonisation of gerbils SS1 flbA mutant Animal no. meancfu=g of antrum Animal no. meancfu=g of antrum (cid:1) 1 1:93107 7 ,9:03102 (cid:1) 2 5:83106 8 ,9:03102 (cid:1) (cid:1) 3 ,9:03102 9 ,9:03102 (cid:1) 4 1:23106 10 ,9:03102 (cid:1) 5 1:93103 11 ,9:03102 6 6:83106 12 5:53103 Mean (SD) 5:43106(7:33106) Mean (SD) 1:63103(1:93103)y Animals were inoculated with either H. pylori wild-type strain SS1 or its isogenic flbA mutant andantrumsampleswereprocessedasdescribedinMaterialsandmethods.Homogenisedantrum samples were plated in triplicate. (cid:1)No H. pylori recovered. Limit of detection was 93102cfu=g of antrum. yp¼0:027 between wild-type SS1 and the flbA mutant. ROLE OF flbA IN VIRULENCE, MOTILITYAND UREASE 967 Fig.6. Effect of H. pylori flbA on histopathology in the antrum of gerbils. All sections (5 (cid:1)m thick) are antrum tissue of the stomachandwerestainedwithhaemotoxylinandeosin.Magnification,1803.(a)Antrumfromgerbilsinoculatedwithwild-type H.pyloristrainSS1.Arrow,micro-ulcerformation.(b)Antrumfromgerbilsinoculatedwithwild-typeH.pylori.Arrow,lymphoid follicleformationandlymphocyticinflammation.(c)AntrumfromgerbilsinoculatedwiththeflbAmutantofH.pylori.(d)Antrum fromgerbilsinoculatedwithsterilebuffer. Table3. Differences in urease properties and flbA-mediated modulation of urease in H. pylori and P. mirabilis High affinity nickel Mechanism of FlbA- transporter required Nickel concentration mediated urease Organism Urease gene cluster Urease regulation for urease activity? in in-vivo niche modulation H. pylori ureABIEFGH FlbA, pH, NikR Yes Serum/gastric milieu: NixA expression 0.1–0.5(cid:1)g/L repressed P. mirabilis ureRDABCEFG H-NS (repressor), UreR No Urine: 1–3(cid:1)g/L Urease promoter + urea (activator), FlbA repressed (repressor) mirabilis urease, the H. pylori urease is not regulated the differences in the importance of a high affinity by a UreR homologue nor by urea, but requires the nickel transporter (Table 3) and the distinct niches that NixA high affinity nickel transporter for urease activity these two organisms occupy in vivo. H. pylori, which in the E. coli model [9, 10] (summarised in Table 3). In has very few regulatory genes [23,24], may exert the presence of flbA, urease activity was almost regulatory control of gene expression through more abolished in E. coli containing the H. pylori urease subtle mechanisms than observed for organisms with gene cluster (Fig. 3). However, this was not due to larger genomes and more regulatory genes such as P. repression of the urease promoter as it was for P. mirabilis. H. pylori is found in a very low nickel mirabilis, but rather of the nixA promoter (Fig. 4). environment (0.1–0.5 (cid:1)g/L inserumand presumably in Because NixA is required for urease activity in the E. similar amounts in the gastric milieu [46–48]) and thus coli model of H. pylori urease, it is believed that the has evolved the high affinity nickel transporter nixA for flbA-mediated decrease in H. pylori urease activity is optimal delivery of nickel to apo-urease. In contrast, P. due to decreased nixA expression, whereby less nickel mirabilis resides in the urinary tract, where nickel would be delivered to apo-urease. This may render the concentrations are about 10-fold higher (1–3 (cid:1)g/L protein more susceptible to proteolytic degradation and [47,49]) and thus a high affinity nickel transporter is would explain the observation that the urease structural unnecessary. subunits UreA and UreB are markedly reduced in E. coli containing flbA and pHP8080 [9]. Although both H. pylori and P. mirabilis ureases were examined in E. coli models that were optimised for The contrasting mechanisms of flbA-mediated modula- urease activity, urease activities in both models were tion of urease in H. pylori and P. mirabilis may reflect significantly lower (10–30-fold for H. pylori urease,