Logout succeed
Logout succeed. See you again!

The innate immune repertoire in Cnidaria - ancestral complexity and stochastic gene loss PDF
Preview The innate immune repertoire in Cnidaria - ancestral complexity and stochastic gene loss
Open Access 2MeVRt0o iea0llulls7e.mreea 8r,c Ishsue 4, Article R59 The innate immune repertoire in Cnidaria - ancestral complexity c and stochastic gene loss o m m David J Miller¤*, Georg Hemmrich¤†, Eldon E Ball‡, David C Hayward‡, e n t Konstantin Khalturin†, Noriko Funayama§, Kiyokazu Agata§ and Thomas CG Bosch† Addresses: *ARC Centre of Excellence in Coral Reef Studies and Comparative Genomics Centre, James Cook University, Townsville, Queensland 4811, Australia. †Zoological Institute, Christian-Albrechts-University Kiel, Olshausenstrasse, 24098 Kiel, Germany. ‡ARC Centre re v for the Molecular Genetics of Development, Research School of Biological Sciences, Australian National University, Canberra ACT 2601, ie Australia. §Department of Biophysics, Kyoto University, Kitashirakawa-Oiwake, Sakyo-ku, Kyoto 606-8502, Japan. w s ¤ These authors contributed equally to this work. Correspondence: ThomasCGBosch. Email: [email protected] r Published: 16 April 2007 Received: 2 November 2006 e p Revised: 22 December 2006 o Genome Biology 2007, 8:R59(doi:10.1186/gb-2007-8-4-r59) r Accepted: 16 April 2007 ts The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2007/8/4/R59 © 2007 Miller et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which de permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. po tcI<onapitnr>iaenA tgaen r aaiemnl ypcmsireiesuns noet nfeo gtrr ieeignnpi noeremrst pfoiorcierr rs emee isnnaot nuaCytrni ccviedoessma a ropvifaao tinhlaeebn blteas sfooaflr t cchnneii ddinaanrriiaaatnne sci mlraesmvse uAanlneetd hs ytohsztaoetam s, eb.<vue/trp aa>rl ek meyi scsoimngp ionn Henytds roaf, tah me veemrtbeebrr oaft et hine ncalatess i mHmydurnozeo rae,p ienrd-i- sit e d r e s e a Abstract rc h Background: Characterization of the innate immune repertoire of extant cnidarians is of both fundamental and applied interest - it not only provides insights into the basic immunological 'tool re fe kit' of the common ancestor of all animals, but is also likely to be important in understanding the r e global decline of coral reefs that is presently occurring. Recently, whole genome sequences became ed r available for two cnidarians, Hydra magnipapillata and Nematostella vectensis, and large expressed e s e sequence tag (EST) datasets are available for these and for the coral Acropora millepora. a r c h Results: To better understand the basis of innate immunity in cnidarians, we scanned the available EST and genomic resources for some of the key components of the vertebrate innate immune repertoire, focusing on the Toll/Toll-like receptor (TLR) and complement pathways. A canonical Toll/TLR pathway is present in representatives of the basal cnidarian class Anthozoa, but neither a in t classic Toll/TLR receptor nor a conventional nuclear factor (NF)-κB could be identified in the er a c anthozoan Hydra. Moreover, the detection of complement C3 and several membrane attack tio complex/perforin domain (MAC/PF) proteins suggests that a prototypic complement effector ns pathway may exist in anthozoans, but not in hydrozoans. Together with data for several other gene families, this implies that Hydra may have undergone substantial secondary gene loss during evolution. Such losses are not confined to Hydra, however, and at least one MAC/PF gene appears to have been lost from Nematostella. in fo Conclusion: Consideration of these patterns of gene distribution underscores the likely rm significance of gene loss during animal evolution whilst indicating ancient origins for many at io components of the vertebrate innate immune system. n Genome Biology 2007, 8:R59 R59.2 Genome Biology 2007, Volume 8, Issue 4, Article R59 Miller et al. http://genomebiology.com/2007/8/4/R59 Background text. The others play a role in development [10], most The innate immune system is the first line of defense against famously in controlling differentiation in the dorsal/ventral pathogens, and in non-chordates is assumed to be the sole axis. means by which any non-self cells are detected and either killed or contained [1]. Innate immunity in vertebrates is The significance of gene loss in animal evolution has recently essentially a two-tier system consisting on one hand of phago- been brought into focus by preliminary expressed sequence cyte activation by the interaction of specialized surface recep- tag (EST) and genomic analyses of some 'basal' animals (Fig- tors with pathogens or pathogen-derived components, and on ure 1), particularly the anthozoan cnidarians Acropora mille- the other of the direct opsonization and lysis of pathogens via pora and Nematostella vectensis [12,13] and the planarian the complement cascade. Whilst the vertebrate innate Dugesia japonica [14]. Paradoxically, the genomes of these immune system has been the subject of intense investigation morphologically simple animals contain many genes previ- and is relatively well understood, studies of invertebrate ously thought to have evolved much later in the context of ver- immunity, which have focused primarily on the arthropods tebrate complexity, and most of the complexity of signaling Drosophila and various horseshoe crab species [2-4], have pathways and transcription factors associated with higher revealed some striking similarities. For example, in both Dro- animals is represented in the anthozoan datasets [13,15-17]. sophila and vertebrates, the Toll/Toll-like receptor (TLR) In contrast to Drosophila and Caenorhabditis, which have mediates the activation of appropriate response genes to undergone substantial gene loss, for at least some groups of microbial challenge [5,6]. genes Acropora and Nematostella appear to have preserved much of the genetic complexity of the common metazoan Toll and the TLRs are transmembrane proteins with a charac- ancestor. For example, whereas fly and worm have each lost teristic domain structure consisting of an extracellular approximately half of the ancestral Wnt complement, all but amino-terminal domain containing leucine-rich repeats one of the 12 known Wnt subfamilies is represented in Nema- (LRRs) responsible for pattern recognition and an intracellu- tostella [15]. The emerging cnidarian EST and genomic data- lar Toll interleukin receptor (TIR) domain that mediates sig- sets are, therefore, potentially highly informative with respect nal transmission. Although the Toll and TLR families of to the ancestral immunological repertoire. In addition to this arthropods and mammals are thought to have independently basic evolutionary significance, understanding the bases of diversified [7,8], all Tolls and TLRs signal via a common path- cnidarian immunity is of major applied significance in light of way that is conserved between Drosophila and mammals. the dramatic decline in coral health that has occurred on a The ultimate step in this pathway is translocation of nuclear global scale over the past 20 years. Increasing human activity factor (NF)-κB or its fly counterpart (the Dif/Rel het- in coastal zones throughout the world has led to declines in erodimer) into the nucleus, where it stimulates transcription water quality with increased sediment, nutrient and heavy of appropriate response genes. The immune repertoire of the metal concentrations. These have all had detrimental effects horseshoe crab Carcinoscorpius includes a complex comple- on corals with an associated increase in the prevalence of dis- ment pathway that has both opsonic and lytic effector func- ease, and perhaps led to some new diseases, although this is tions [9]. Horseshoe crab complement C3 is functionally less certain, as coral diseases are very poorly understood. homologous with mammalian C3, mediating phagocytosis of Most are named for their symptoms, for example, 'white band bacteria (by hemocytes) in a strikingly similar manner. disease', 'black band disease', and 'rapid wasting syndrome' and causative agents are frequently unknown. In the face of Whilst these specific studies imply that at least some innate this uncertainty it is important that coral defense mecha- immune mechanisms have been conserved, broader compar- nisms should be better understood. ative studies highlight the extent of gene loss and divergence in various metazoan lineages. For example, although Carci- Although cnidarians have no specialized immune cells, at noscorpius clearly uses a vertebrate-like complement system, least some display highly specific allorecognition characteris- none of the central components of the cascade (C2, C3, C4, tics. Allorecognition, xenorecognition, and killing mecha- C5) are encoded by the genomes of the ecdysozoans Dro- nisms have been demonstrated in several hydrozoans [18-20] sophila, Caenorhabditis or Anopheles. Moreover, the sole and anthozoans [21-23]. Allorecognition is thought to protect Toll/TLR in Caenorhabditis elegans and C. brigssae is not colonial cnidarians from fusion with genetically different known to function in the context of immunity, nor does that individuals and to prevent germ line parasitism. The effector reported in the horseshoe crab Tachypleus tridentatus [10]. mechanisms range from contact avoidance involving chemi- There are also important differences between the Toll/TLR cal sensing, to barrier formation, or usage of nematocysts. For systems of Drosophila and mammals. For example, some example, the sea anemone Anthopleura xanthogrammmica mammalian TLRs themselves act as pattern recognition will 'tolerate' adjacent clonal individuals, but will attempt to receptors (PRRs) upon microbial challenge, whereas in fly 'reject' heterogenic clones with which it comes into contact this is not the case [11]. Moreover, whereas most of the ten or [24,25]. In the anthozoans, Stylophora pistillata and Monti- so vertebrate TLRs function primarily in immunity, only one pora verrucosa branches within one colony will readily fuse of the nine fly (and ten mosquito) Tolls functions in this con- while branches of genetically different individuals never Genome Biology 2007, 8:R59 http://genomebiology.com/2007/8/4/R59 Genome Biology 2007, Volume 8, Issue 4, Article R59 Miller et al. R59.3 Results Bilateria The toll receptor and other proteins containing the TIR domain c Anthozoa Searching the Hydra predicted protein collection using the o m Acropora, Nematostella, available hidden Markov models (HMMs) identified only four m Porites, Swiftia e TIR domain-containing proteins, two of which are clearly n t Hydrozoa related to MyD88, which functions downstream of TLRs Cnidaria Hydra (Table 1). Consistent with their assignment as MyD88 family Cubozoa members, both of these Hydra proteins also contain the char- acteristic DEATH domain. The two other Hydra TIR proteins Scyphozoa are atypical transmembrane proteins in having relatively short extracellular domains that are devoid of the LRR re v domains that characterize Toll and the TLRs (Figure 2). ie Porifera w cDNAs encoding these proteins have previously been isolated s Suberites, Ephydatia by the Bosch laboratory (unpublished data) and their func- tions are presently under investigation; these proteins are RFieglautrioen 1ships at the base of the Metazoa known as HyTRR-1 and HyTRR-2. Surprisingly, extensive Relationships at the base of the Metazoa. Cnidarians are amongst the searching of the Hydra genome and all available EST/cDNA simplest animals at the tissue grade of organization, and are often regarded resources failed to identify any proteins having the canonical as the closest outgroup to the Bilateria. Within the Cnidaria, the class Anthozoa is basal, whereas the Hydrozoa is derived. The sponges Toll/TLR structure, characterized by possession of both LRR re p (Porifera) are unquestionably animals, but represent a lower level of and TIR domains. o r organization. The affinities and relationships of genera mentioned in the ts text are indicated. Whereas only four TIR proteins are present in Hydra, sub- stantially more could be identified amongst the predicted undergo fusion [22,26,27]. Fusion of two conspecific individ- proteins from Nematostella using HMM-based search meth- uals is occasionally referred to as 'natural transplantation'. ods. Five of them were sufficiently complete to be included in d e Observations in sea anemones (Anthopeura elegantissima, the analyses presented here. These include a single MyD88 po s Phymactis clematis) and gorgonians (Eunicella stricta) indi- homolog (NvMyD88) and a protein (NvTLR-1) clearly related it e cate that individual colonies possess unique sets of histocom- to members of the Toll/TLR family (Figure 2). Whereas the d r e patibility elements, which are recognized as nonself by all mammalian TLRs, and some members of the fly Toll/TLR s e a other conspecific colonies [23,28]. In Hydrozoa, the same family, have only a carboxy-terminal cysteine-rich motif r c h phenomenon was reported for Millepora dichotoma [29] and flanking the LRRs proximal to the membrane, Nematostella studied in great detail in the colonial marine hydroid Hydrac- NvTLR-1 is predicted to contain both carboxy- and amino- tinia echinata [30]. Hydractinia in fact was among the first terminal-flanking cysteine-rich motifs in the extracellular r e invertebrates shown to display a genetically based system of part of the protein (Figure 2). This suggests that fly and anem- fe r intolerance against allogenic tissue: for more than 50 years it one Toll more closely reflect the ancestral domain structure ee d has been known that allorecognition and the inability to fuse than do the mammalian TLRs. Moreover, a phylogenetic r e stolons of different colonies is under the control of one poly- analysis (Figure 3) groups the TIR in Nematostella NvTLR-1 se a morphic gene [31,32]. Recent efforts using defined genetic with its fly and human counterparts, with strong bootstrap rc h lines of the hydroid Hydractinia symbiolongicarpus have support. Surprisingly, three more of the predicted Nemato- confirmed this and shown that the single chromosomal stella TIR proteins also contain multiple immunoglobulin region contains at least two loci [33]. (Ig) domains (Figure 2), and thus reflect the domain structure of mammalian interleukin 1 receptors (IL-1Rs). NvIL-1R1 and in The availability of whole genome sequences of two basal cni- NvIL-1R2 each contain three Ig domains, and NvIL-1R3 con- te r darians at respectably high levels of redundancy - the hydro- tains two predicted Ig domains (Figure 2) but may be incom- ac t zoan Hydra magnipapillata (>6-fold coverage) and the plete. In the phylogenetic analysis based on TIR domains the io n s anthozoan Nematostella vectensis (>7.6-fold coverage [17]) - Nematostella IL-1R-like proteins form a clade distinct from together with large-scale EST datasets for these and for the both the MyD88 and Toll/TLR types (Figure 3), although coral Acropora millepora potentially offer new perspectives these cnidarian TIRs appear to be distinct from those in the on the origins of mammalian immune functions. Here we vertebrate IL-1Rs (data not shown). Several other TIR pro- report the results of a screen of the available genomic and EST teins were detected amongst the sequences of Nematostella in resources for the cnidarian counterparts of key components (Additional data file 1), but were not subjected to further anal- fo r m of the vertebrate innate immune repertoire. ysis as the TIR domains were incomplete or the sequences a t were judged likely to be artifactual. Two complete TIRs were io n identified by searching the available coral datasets. The trace archive yielded one TIR from Acropora palmata (ApGe- Genome Biology 2007, 8:R59 R59.4 Genome Biology 2007, Volume 8, Issue 4, Article R59 Miller et al. http://genomebiology.com/2007/8/4/R59 Table 1 Overview of innate immunity components present or absent in selected Cnidaria Anthozoa Hydrozoa Nematostella Acropora Hydra Accession no. e-value Accession no. e-value Accession no. e-value TLR pathway LBP + gnl|ti|1139929806 7e-51 ND + gb|DT619160 2e-13 CD14 - ND - TLR + gnl|ti|573160901 1e-47 + gb|EF090256 2e-7 - gnl|ti|566578628 gnl|ti|558319530 gnl|ti|567085258 gnl|ti|581064934 MyD88 + gnl|ti|1139972660 4e-26 ND + gb|CV182656 1e-18 IRAK + gnl|ti|1146119691 3e-14 ND + gb|DT608600 2e-10 TRAF6 + gnl|ti|1135509399 2e-51 + gb|DY583189 1e-38 + gb|CV985667 3e-41 TAK1 + gnl|ti|1135635219 1e-51 + gb|DY583694 8e-119 + gb|DN812953 1e-45 IκK + gnl|ti|1135636054 5e-68 ND + gb|CV985420 2e-60 NF-κB + gnl|ti|1139960940 1e-74 + gb|DY582971 3e-36 - IFN pathway TRAM + gnl|ti|1139940977 9e-66 + gb|DY579224 5e-72 + gb|DT615400 1e-58 TRIF + gnl|ti|1139933368 4e-07 ND ? TBK-1 ? ND ? IRF3 + gnl|ti|1146121907 6e-13 ND + gb|DT609518 2e-14 p65 - ND - IFN-β - ND - ECSIT pathway ECSIT + gnl|ti|1139978500 4e-35 ND + gnl|ti|1223628 2e-18 732 MEKK1 + gnl|ti|1139956887 2e-28 + gb|DY581138 3e-83 + gnl|ti|1226566 3e-25 543 MKKs + gnl|ti|557758729 1e-14 ND + gnl|ti|1121918 1e-18 104 Genome Biology 2007, 8:R59 http://genomebiology.com/2007/8/4/R59 Genome Biology 2007, Volume 8, Issue 4, Article R59 Miller et al. R59.5 Table 1 (Continued) Overview of innate immunity components present or absent in selected Cnidaria c o m JNK + gnl|ti|1135503269 1e-106 ND + gnl|ti|8773345 2e-33 m 88 e n t p38 + gnl|ti|1139959014 1e-114 + gb|DY579712 5e-111 + gnl|ti|6860485 7e-39 04 AP1 + gnl|ti|1139792930 3e-10 + gb|DY581320 3e-09 + gb|CX771032 7e-10 ATF + gnl|ti|1139796564 4e-11 ND + gb|CN624618 3e-06 r e v ie w s Other TLR related proteins HyTRR-1 - ND + gb|DQ449929 0 HyTRR-2 - ND + gb|DQ449930 0 r e p IL1-R related proteins or t s IL1R-1 + gnl|ti|573182253 0 ND - IL1R-2 + gnl|ti|557993643 0 ND - IL1R-3 + gnl|ti|567060226 0 ND - de p o s it e d r Complement system related e proteins se a r c h C3/A2M related + gnl|ti|557724205 1e-84 + gb|EF090257 1e-134 + gb|DT618439 gnl|ti|559738307 gb|CN554187 gnl|ti|558391450 gb|CO376061 gnl|ti|573218050 gnl|ti|558266068 re gnl|ti|573218146 fe gnl|ti|586367083 r e gnl|ti|557912603 e gnl|ti|573084165 d r e s e C6/C7/C8 - ND - a r c h MAC/PF domain-containing proteins in t Apextrins - + gb|EF091848 6e-15 + gb|CV185005 4e-04 e r gb|DT613346 a gb|CF655657 ct gb|DT620043 io n s Tx60-A + gnl|ti|1139936806 7e-48 + gb|DY579588 9e-48 + gb|CV464226 1e-07 gb|DY579588 3e-35 gb|CD680300 gb|BP512716 gb|CV464282 gb|DN246811 in MPEG + gnl|ti|613559286 5e-59 ND - fo r m a t io Plus or minus indicate presence or absence of genes, respectively; components marked 'ND' could not be determined within the limited available Acropora dataset; question n marks indicate not resolvable Blast results, mostly within kinase domain encoding sequences. All accession numbers originated either from GenBank (gb) or from NCBI trace archive (gnl|ti). The given e-values were obtained by BlastX searches against the NCBI nr protein database. Genome Biology 2007, 8:R59 R59.6 Genome Biology 2007, Volume 8, Issue 4, Article R59 Miller et al. http://genomebiology.com/2007/8/4/R59 Acropora Nematostella Hydra AmTIR-1 NvTLR-1 NvIL-1R1 NvIL-1R2 NvIL-1R3 HyTRR-1 HyTRR-2 LRR LRR LRR LRR-CT IG IG LRR-NT IG IG LRR IG LRR IG IG IG LRR-CT TIR TIR R TIR TIR TIR R R TIR TIR IT IT IT NvMyD88 DEATH HmMyD88-1 DEATH DEATH HmMyD88-2 B C D E F FSuigmumrear 2y of domain structures of TIR domain-containing proteins identified in selected Cnidaria Summary of domain structures of TIR domain-containing proteins identified in selected Cnidaria. nomic) and a second was encoded by an A. millepora EST transcriptionfactor 1) factors. Toll/TLR signaling via JNK/ (AmTIR-1). These two coral TIRs are most similar to those in MAPK requires the participation of the ECSIT (evolutionarily the Nematostella IL-1R-like proteins (Figure 3), but no linked conserved signaling intermediate in Toll pathways) adaptor domains have yet been identified in these cases. protein [35], which also provides a link between the Toll/TLR and TGF-b (transforming growth factor-beta)/BMP (bone The Müller group recently reported the identification of morphogenic protein) pathways [36]. The presence of ECSIT MyD88 in a demosponge, Suberites domuncula [34]. How- as well as the key components of the JNK/MAPK pathway in ever, whilst phylogenetic analyses clearly grouped the TIR in the cnidarian datasets (Table 1, Figure 4) indicates an early this sponge sequence with those present in unambiguous origin for this variant of Toll/TLR signaling. The discovery of MyD88 orthologs (Figure 3), domain searching indicates that a conserved predicted ECSIT coding sequence in the fresh the predicted sponge protein may not have a functional water sponge Ephydatia fluviatilis (N Funayama, personal DEATH domain. observation) additionally supports this view. The Toll/TLR pathway is ancestral but some Wiens et al. [34] have suggested that a sponge-specific cell components are missing or highly divergent in Hydra surface protein known as SLIP (sponge LPS-interacting pro- Most of the intracellular mediators of Toll/TLR signaling tein) functions as a pattern recognition receptor and effec- could be identified in Nematostella and Acropora, but some tively substitutes for Toll/TLR in antimicrobial defence. The key components appear to have either been lost or diverged sponge MyD88-related protein nominally functions down- beyond recognition in Hydra (Table 1). The absence of a Toll/ stream of SLIP in the proposed pathway [34]. In support of TLR protein sensu stricto from Hydra is discussed above, but the idea that sponges lack Toll/TLRs, the authors cite a lack in addition only a single highly derived Rel domain could be of TLRs in a screen of 15,000 ESTs. As sponge 'MyD88' and found in Hydra whereas unambiguous NF-κB homologs are SLIP are co-immunoprecipitated by the reciprocal antibodies present in both Nematostella and Acropora (Table 1). In [34], they clearly can interact in vitro. Some TLR pathway addition to the pathway leading to nuclear localization of NF- components could also be identified in the available sponge κB, Toll/TLR signaling can activate the Jun N-terminal data, but the equivocal status of the sponge MyD88 related kinase (JNK) and p38 mitogen-activated protein kinase protein means that it is unclear at this time whether sponges (MAPK) pathways, leading to transcription of a range of tar- have a canonical Toll/TLR pathway. get genes via the AP1 (activating protein 1)/ATF (activating Genome Biology 2007, 8:R59 http://genomebiology.com/2007/8/4/R59 Genome Biology 2007, Volume 8, Issue 4, Article R59 Miller et al. R59.7 NvMyD88 90 c o 84 HsMyD88 m 46 m DmMyD88 e 94 SdMyd88 nt 96 HmMyD88-1 HmMyD88-2 MyD88 type 73 77 Dmtoll 91 NvTLR-1 HsTLR-4 Toll/TLR type r e 76 99 NvIL-1R3 vie w HyTRR-1 s 51 69 NvIL-1R1 92 ApGenomic 85 NvIL-1R2 AmTIR-1 IL-1R type HyTRR-2 r Arabidopsis e p o r t 0.1 substitutions/site s PFhigyulorgee n3etic analysis of cnidarian TIR sequences in comparison to a selection of TIR domains from other species Phylogenetic analysis of cnidarian TIR sequences in comparison to a selection of TIR domains from other species. The maximum likelihood (ML) tree d shown is the result of analysis of an HMM-based alignment of TIR domains. A number of the TIR sequences identified and discussed in the text are ep o incomplete due to the presence of introns of unknown size, and hence were not included in the phylogenetic analyses. Three clades are resolved by these s analyses, corresponding to the TIR domains characteristic of the 'MyD88-type', 'Toll/TLR-type' and 'IL-1R-type'. In addition to the TIR domain, the first of ite d these types contains a death domain and the second contains multiple LRRs. Like the mammalian receptors for interleukin 1, the three Nematostella r e proteins falling into the third clade each also contain multiple immunoglobulin domains. Note that HyTRR1 does not contain such domains and that it is s e not yet clear whether either of the Acropora proteins does. The Acropora sequences included in the analysis were predicted from A. palmata genomic clones a r (ApGenomic) and from an A. millepora cDNA clone (AmTIR-1). Hydra lacks a canonical Toll/TLR, having only two MyD88 genes and the two sequences ch known as TRR-1 and TRR-2; H. magnipapillata and N. vectensis sequences are indicated by the prefixes Hy and Nv, respectively. Reference sequences: HsMyD88, human MyD88 (SwissProt:Q99836); DmMyD88, fly MyD88 (GenBank:AAL56570); SdMyD88, Suberites MyD88 (EMBL:CAI68016); Dmtoll, fly Toll (SwissProt:P08953); HsTLR4, human TLR4 (EMBL:CAD99157); Arabidopsis (GenBank:AAN28912). r e fe r e e d Cnidarian complement C3 and related proteins domains characteristic of C3 (ANATO, C345C; Figure 5f) r e The complement component C3 has recently been reported in could not be detected in any Hydra protein. Although lacking se a another anthozoan cnidarian, the octocoral Swiftia [37], and a canonical C3, Hydra contains a gene encoding A2M related r c h the corresponding gene has recently been cloned from Acro- domains. Interestingly, in situ hybridization in Hydra using a pora (Hayward, unpublished data). The Acropora C3 (C3- probe covering these typical A2M-related domains (Figure 5f; Am) gene is first expressed strongly in the endoderm of the A2M-comp/A2M-recep) showed expression restricted to the planula as it elongates following gastrulation (Figure 5a). The endodermal epithelium (Figure 5g), as was the case with in endodermal expression is not uniform, being most intense in Acropora C3. te r a subset of dark staining cells that have not yet been charac- ac t terized. As the planula elongates expression becomes some- MAC/PF domain containing proteins in Cnidaria io n what weaker, with the strongest expression localized to the Searching for other components of the complement cascade, s aboral endoderm (Figure 5b). Post-settlement (Figure 5c-e) we identified proteins containing a membrane attack com- expression is limited to the endoderm and is particularly plex/perforin domain (MAC/PF) similar to that present in strong in the endoderm of the polyp as it rises from the calci- complement component C6 and related proteins. HMM fying platform at its base (for example, Figure 5d). searching identified just two MAC/PF domain-containing in proteins in Hydra (Table 1), whereas four proteins were iden- fo r C3 has a complex domain structure. Whilst anthozoan C3s tified in Nematostella. Two MAC/PF proteins were also iden- m a resemble their deuterostome counterparts both in domain tified amongst the Acropora ESTs. Database searches and tio n structure (Figure 5f) and sequence, not only could no corre- analyses of predicted domain structures revealed that most of sponding gene be identified in Hydra, but also some of the the cnidarian MAC/PF sequences are likely to fall into three Genome Biology 2007, 8:R59 R59.8 Genome Biology 2007, Volume 8, Issue 4, Article R59 Miller et al. http://genomebiology.com/2007/8/4/R59 groups corresponding to the known proteins types MPEG, oral (blastopore) end of the embryo as it begins to elongate TX-60A and apextrin (Table 1, Figure 5h). following blastopore closure (Figure 5k). As the embryo con- tinues to elongate expression increases in intensity and the TBlastN-based searches of the Nematostella genome identi- zone of expression spreads toward the aboral end, initially fied a gene matching strongly to the human macrophage still in scattered cells (Figure 5l), but as elongation continues expressed protein 1 (MPEG1; GenBank:XP_166227) and its apparently in all ectodermal cells (Figure 5m), as is clear in abalone homolog abMPEG1 (GenBank:AAR82936) [38]. A transverse section (Figure 5n). As the planula settles, expres- clearly related gene in S. domuncula has recently been impli- sion becomes less obvious at the oral end, eventually becom- cated as an effector in a hypothetical sponge innate immune ing limited to a belt marking the transition between the tissue defence pathway [34]. Recombinant Suberites MPEG has that was formerly aboral (bottom), and the end bearing the anti-bacterial activity against Gram-negative bacteria, and is oral pore, which subsequently forms the mouth of the polyp up-regulated after lipopolysaccharide (LPS) treatment [34]. (Figure 5o). These expression data suggest that the primary The MPEG1 family clearly has an ancient evolutionary history function of apextrin-Am is in the ectoderm leading up to met- (the sponge and human sequences have 28% identity and amorphosis; hence, secondary loss of the corresponding gene 46% similarity) [34] but only in Suberites has any functional from Nematostella may be explicable in terms of the very dif- characterization been done. Despite the presence of MPEG1 ferent modes of development of these two animals (see in the sponge and an anthozoan, no corresponding gene could Discussion). be identified in Hydra. In adult Hydra, whole mount in situ hybridization showed an The nematocyst venom of at least some anthozoans contains expression of the apextrin-like gene in groups of ectodermal the protein TX-60A [39], and two of the Nematostella MAC/ cells arising from the interstitial cell lineage (Figure 5j), which PF proteins and one of the Acropora ESTs clearly correspond may reflect a possible functional shift in an organism where to this protein type (Table 1). TX-60A has an epidermal metamorphosis is absent. growth factor (EGF) domain immediately carboxy-terminal of the MAC/PF domain. In Hydra, this domain structure can In addition to the above, the Nematostella dataset yielded be found in Hy-MAC, one of the two Hydra MAC/PF proteins MAC/PF domain-containing proteins having high similarity (Figure 5h, Table 1). However, it is unclear whether the to the neural cell adhesion molecule spondin-1 (Additional Hydra and anthozoan sequences are orthologous, as overall data file 1). sequence identity is low. In situ hybridization analysis shows that expression of Hy-MAC is restricted to gland cells that are interspersed throughout the endoderm of Hydra (Figure 5i). Discussion Since endodermal gland cells and nematocysts are terminally These preliminary analyses of the newly available genomic differentiated [40], this pattern of expression is not easy to and EST datasets indicate that a surprising number of key reconcile with a common function for the venom TX-60A and components of the innate immune system, including the Toll/ Hy-MAC. TLR pathway and some complement cascade components, were in place at the base of the Eumetazoa. Also represented Apextrin, a gene lost from Nematostella in the datasets are proteins strongly matching both the tumor The third class of cnidarian MAC/PF proteins represented in necrosis factor (TNF) and Nod-like receptors and with the the Hydra and Acropora ESTs (Figure 5h) contains no iden- same domain structures (data not shown). tifiable domains other than MAC/PF. These proteins have moderate overall similarity to the echinoderm apextrins The analyses presented here are consistent with the idea of a [41,42] and to the apicomplexan protein family to which the genetically complex common metazoan ancestor [12,13]; Plasmodium membrane attack ookinete protein (MAOP) clearly the Toll/TLR, MyD88 and IL-1R protein families were [43] belongs. MAOP is responsible for rupture of epithelial distinct prior to the divergence of the Cnidaria from the Bila- cells in the insect host by the ookinete stage of the parasite. teria, and a Toll/TLR pathway may predate even the Porifera/ Surprisingly, apextrin seems to be a case of gene loss from Eumetazoa split. The discovery of proteins with the same Nematostella as, despite clearly related genes being present domain structure as the IL-1R in Nematostella indicates that in Hydra and Acropora, extensive searching of both the pre- this receptor type predates chordate origins and that its orig- dicted protein collection and the anemone genome using a inal ligands may not have been interleukins. However, as the variety of tools failed to identify an apextrin-related gene TIR domains in the cnidarian IL-1R-like and mammalian IL- (Table 1). 1R proteins are divergent, separate evolutionary origins can- not yet be ruled out despite the similarities at the level of To explore the significance of this case of apparent gene loss, domain structure. the expression pattern of an apextrin gene was examined by in situ hybridization in Acropora (Figure 5k-o). Apextrin-Am It is also likely that a prototypic complement effector pathway expression first appears in scattered ectodermal cells at the involving C3 and multiple MAC/PF proteins was in place in Genome Biology 2007, 8:R59 http://genomebiology.com/2007/8/4/R59 Genome Biology 2007, Volume 8, Issue 4, Article R59 Miller et al. R59.9 c o m LRR-NT m e n t LRR LLRRRR LRR LLRRRR LRR r e v ie w s LRR-CT R TI re p o r t s 8 8 d- y M K-4 d IRA epo s it e d TRAF-6 re s ECSIT TAK1 ea r c MEKK1 h IKKα MKKs IKKγ re IKKα fer e e d r JpN38K IκB esea r NF-κB ch Immune response genes in t e AP-1 r a ATF NF-κB ct ATGGATATGACCAGATGACATAGCCGTGAGGGATTACCAGTAGAGCACCATATGTCATCGCGCGATTAGGATTAGAAG io n s SFiiggnuarlieng 4 pathways downstream of the Toll/TLRs Signaling pathways downstream of the Toll/TLRs. Pattern recognition, either indirectly or directly, by Toll/TLRs results in activation of NF-κB (vertebrates) or the Dif/Rel heterodimer (Drosophila) and thus transcription of appropriate immune response genes. At TRAF6, the classic Toll/TIR pathway (shown in info the right branch) is linked to the JNK/p38 pathway (shown in the left branch) by the ECSIT protein, which acts as a regulator of MEKK-1 processing [35]. rm Components of both pathways downstream of Toll/TLRs are represented in the cnidarian datasets (Table 1). ECSIT may also act as a link between these a t and the TGF-b signaling pathway, since it forms complexes with BMP-pathway restricted Smads and is essential for regulation of the BMP-target gene Tlx2 io n [36]. All of the components of the TGF-b signaling pathway are also known from anthozoan cnidarians [13]. Genome Biology 2007, 8:R59 R59.10 Genome Biology 2007, Volume 8, Issue 4, Article R59 Miller et al. http://genomebiology.com/2007/8/4/R59 (a) (b) (c) (d) (e) (f) Complement component C3 (g) C3 A2M_N A2M_N2 TANA A2M A2M_COMP R AE2CMEP C345C O Hydra + - - - + + - Nematostella + + + + + + + Acropora + + + + + + + (h) Perforin domain containing proteins (i) (j) MPEG MACPF SigP Tx-60A / Hy-MAC MACPF EGF SigP Apextrin MACPF (k) (l) (m) (n) (o) CFiogmurpele m5ent component C3 and MAC/PF domain-containing proteins in Cnidaria Complement component C3 and MAC/PF domain-containing proteins in Cnidaria. (a-e) In situ hybridization of C3-Am in Acropora. Expression first becomes apparent in scattered endodermal cells concentrated at the aboral end as the planula elongates from sphere to pear (a) and eventually to spindle (b). Endodermal expression continues post-settlement (c-e), becoming especially strong in the upper part of the polyp as it rises from the calcifying base (d). Post-settlement, the polyp consists of a series of hollow chambers interconnected beneath the mouth. The line of strong staining peripherally is the result of viewing the endoderm vertically, while elsewhere one is looking through the staining layer. (f) Domain map and presence (+)/absence (-) data for the various protein domains characteristic of complement C3 components in the Hydra, Nematostella and Acropora datasets. (g) In situ hybridization of the H. magnipapillata A2M-related gene. Hydra A2M-related transcripts are present in the endoderm along the whole body axis. Note that this Hydra gene lacks several of the C3-diagnostic domains that are present in the anthozoan C3s (see text). (h) Domain maps of major cnidarian MAC/PF proteins types. (i) Hydra Tx-60a in situ. The insert shows the sense control. (j) Hydra apextrin in situ. (k-o) Acropora apextrin in situ. Expression is first apparent in scattered ectodermal cells orally as the planula begins to elongate (k). At slightly later stages expression has spread toward the aboral end of the planula, still in scattered cells (l). As the elongation process continues, uniform strong expression is localized in all ectodermal cells in the oral two-thirds of the planula (m). The strong ectodermal expression is clearly apparent in this transilluminated transverse section cut from the central region of the planula (n). Following settlement, expression continues at the oral end of the planula, before frequently becoming limited to a narrow ring separating oral and aboral tissue (o). Genome Biology 2007, 8:R59