loading

Logout succeed

Logout succeed. See you again!

ebook img

The Molecular Biology of Bacterial Virus Systems PDF

pages93 Pages
release year1988
file size4.208 MB
languageEnglish

Preview The Molecular Biology of Bacterial Virus Systems

Current Topics in Microbiology 136 and Immunology Editors A. Clarke, ParkvilleNictoria . R W. Compans, Birmingham/Alabama . M. Cooper, Birmingham/Alabama H. Eisen, Paris . W. Goebel, Wiirzburg . H. Koprowski, Philadelphia . F. Melchers, Basel . M. Oldstone, La Jolla/California . P.K Vogt, Los Angeles H. Wagner, U1m . I. Wilson, La Jolla/California The Molecular Biology of Bacterial Virus Systems Edited by G. Hoborn and R. Rott With 20 Figures Springer-Verlag Berlin Heidelberg New York London Paris Tokyo Prof. Dr. G. HOBOM lnstitut fiir Mikrobiologie und Moiekularbiologie der Universitat Frankfurter Str. 107, D-6300 Giessen Prof. Dr. R. ROTT lnstitut fiir Virologie der Universitat Frankfurter Str. 107, D-6300 Giessen ISBN-13: 978-3-642-73117-4 e-ISBN-13: 978-3-642-73115-0 DOl: 10.1007/978-3-642-73115-0 This work is subject to copyright. All rights are reserved, whether the whole or part of the material is concerned, specifically the rights of translation, reprint ing, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in other ways, and storage in data banks. Duplication of this publication or parts thereof is only permitted under the provisions of the German Copyright Law of September 9, 1965, in its version of June 24, 1985, and a copyright fee must always be paid. Violations fall under the prosecution act of the German Copyright Law. © Springer-Verlag Berlin Heidelberg 1988 Softcover reprint of the hardcover 1st edition 1988 Library of Congress Catalog Card Number 15-12910 The use of registered names, trademarks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. Product Liability: The publisher can give no guarantee for information about drug dosage and application thereof contained on this book. In every individual case the respective user must check its accuracy by consulting other pharmaceuti cal literature. 2123/3130-543210 Table of Contents G. GUARNEROS: Retroregulation of Bacteriophage A. int Gene Expression. With 7 Figures and 1 Table . .. 1 R.W. HENDRIX: Tail Length Determination in Double- Stranded DNA Bacteriophages. With 3 Figures 21 P.O. BAAS and H.S. JANSZ: Single-Stranded DNA Phage Origins. With 9 Figures and 2 Tables . 31 M. SALAS: Initiation of DNA Replication by Primer Proteins: Bacteriophage rfo29 and Its Relatives. With 1 Figure 71 Subject Index 89 Indexed in Current Contents List of Contributors You will find the addresses at the beginning of the respective contribution BAAS, P.D. 31 GUARNEROS, G. 1 HENDRIX, R.W. 21 JANSZ, H.S. 31 SALAS, M. 71 Retroregulation of Bacteriophage A int Gene Expression G. GUARNEROS 1 Introduction 1 2 Inhibition of int Gene Expression by the sib Region 3 2.1 The sib Region 3 2.2 RNase III Processing of the sib Transcript 5 2.3 Exonucleolytic Degradation of the Processed int Transcript 5 2.4 sib Inhibition Is Limited by Distance 7 3 Positive Retroregulation 7 3.1 The Role of RNase III 9 4 Developmental Control of int by Retroregulation 10 5 Other RNase III Processing Sites in }, Transcripts and Their Possible Regulatory Role 11 6 Retroregulation in Other Systems 13 7 Concluding Remarks 15 References 16 1 Introduction Upon infection of Escherichia coli, bacteriophage A may elicit either a lytic or a lysogenic response. In the lytic response the infected cell is killed but produces many copies of the phage. In the lysogenic program the phage's lytic functions are repressed, and its DNA persists in the surviving cell integrated in the chromosome as a prophage. The prophage may be induced into the lytic cycle by inactivating the repression system. When this occurs, the phage DNA is excised from the host chromosome, replicated, and packaged into viral particles. Many copies of the phage are produced, as in the lytic response to infection. Both integration of phage DNA into, and excision of prophage DNA from the bacterial chromosome require the phage-directed Int protein and the bacterial integration host factor (IHF). The excision reaction also requires Xis protein encoded by the phage genome (see WEISBERG and LANDY 1983 for a review). Timely expression of in! and xis genes and the direction of the integration excision reaction are regulated by a complex system of transcriptional, posttrans criptional, and protein activity signals (ECHOLS and GUARNEROS 1983). Two promoters, pI and pL, initiate in! gene transcription (Fig. 1). pL is active immedi- Department of Genetics and Molecular Biology, Centro de Investigaci6n y de Estudios Avanzados, A.P. 14-740, Mexico City, Mexico 07000 Current Topics in Microbiology and Immunology, Vol. 136 © Springer-Verlag Berlin' Heidelberg 1988 2 G. Guarneros fn) + I 1 1+ ~ ~ ~1~_f~l ______~ __~ P_I ____~ ________~ ___t_ LI_ _~ __~ P~L=-- sib ott int xis eo22 em NnutL ~I~---------------------------------------------- Fig. 1. Regulation of int gene expression. Immediately after infection, transcription initiated at pL terminates at tLl. Once active N protein is available, it acts at the site nulL and transcription initiated at pL proceeds through tLl and other terminators. The int gene is transcribed but is not expressed from the pL transcript because the regulator sib prevents int mRNA translation into an active Int product. Promoter pI is activated by ell protein later in infection. The pI transcript terminates at tI and is translated efficiently into Int protein. The parallel lines represent a segment of A. DNA; several genetic markers have been positioned between the lines. tI overlaps sib, and pI partly overlaps xis in the DNA. The wavy arrows indicate origin, direction, and extent of A. transcripts. The straight arrows, flanked by + or - signs, indicate stimulatory or inhibitory activities. Encircled N or cII symbolize the respective A.-encoded proteins ately after infection and controls several genes in the so-called }, left operon including the xis and int genes. Protein N, the product of the first gene in the .A. left operon, interacts with the transcription complex through a site, nutL, preventing transcription termination within the left operon. Transcription from pL is reduced within 10 min after infection as part of the phage developmental program (FRIEDMAN and GOTTESMAN 1983). Promoter pI, activated by .A. ell protein, controls int transcription. pI sequences partly overlap with the initiation codon of the preceding gene xis (ABRAHAM et al. 1980; HOESS et al. 1980). There fore ell-stimulated pI-RNA lacks the translation start and other amino terminal codons for Xis protein. ell protein is functional only after it has been synthesized and has accumulated in the cell, which occurs sometime after infection (WULFF and ROSENBERG 1983; FIEN et al. 1984). Thus, pI is activated at about the time pL is repressed. The transcript initiated at pI terminates at tI, 276 nucleotides beyond the stop codon of the int gene (SCHMEISSNER et al. 1984b; OPPENHEIM et al. 1982). The pL transcript does not terminate at tI as a result of the antiter mination activity of N protein (SCHMEISSNER et al. 1984a). This difference deter mines opposite effects on int gene expression for the two transcripts. The N dependent anti terminated pL transcript is defective for Int expression whereas the ell-dependent pI transcript expresses Int efficiently. Expression or lack of expression of the int gene is controlled by signals downstream of int in the mRNA. The signal sib in the anti terminated pL transcript reduces expression of the int transcript. This regulatory system, initiated by an element transcrip tionally distal to the target gene, has been named retroregulation (SCHINDLER and ECHOLS 1981). Another distal element to int, the tI terminator at the end of the ell-stimulated transcript from pI, provides for efficient Int synthesis. To distinguish between these two regulatory effects we propose the names "neg ative retroregulation" for sib inhibition and "positive retroregulation" for tI stimulation of int expression. Retroregulation of Bacteriophage }, int Gene Expression 3 Herein is collected all the available information on gene int negative retrore gulation and other possible instances of RNase III participation in It gene regula tion. Few other cases of gene regulation in phages other than It have been included. I will refer also to It int positive retroregulation and the possible participation of RNase III in this control. Reviews addressing the subject of retroregulation have been published previously (GOTTESMAN et al. 1982; COURT et al. 1983 b, c; ECHOLS and GUARNEROS 1983; GUARNEROS and GALINDO 1984). 2 Inhibition of int Gene Expression by the sib Region 2.1 The sib Region The evidence that the int gene is subject to retroregulation derived initially from in vivo experiments. Phage It ell - mutants are defective in the expression of Int (KATZIR et al. 1976; CHUNG and ECHOLS 1977; COURT et al. 1977). A deletion in the b region of the It genome, b2, suppresses this defect of elI mutants. These results indicate the presence of an inhibitor in the It b region (GUARNEROS and GALINDO 1979). The inhibitor is selective for the pL transcript because it does not affect Int systhesis directed from the pI promoter. Previous but complex results had indicated effects of b2 on int expression (LEHMAN 1974; ROEHRDANZ and DOVE 1977). In the b region-DNA the position of the inhibitor sib has been precisely determined by deletional analysis and location of sib - point mutations. Func tional analyses of deletion mutants indicate that the 251 base pairs (bp) to the left of the center of the attachment site are important for negative regulation of int (Epp et al. 1981; GUARNEROS et al. 1982). Additional deletions generated by Bal31 resection defined the left end of sib at position -196 (negative numbers refer to base positions to the left of the central base pair in the attachment site that arbitrarily is assigned position zero) (OPPENHEIM et al. 1982; COURT et al. 1983 a). These results agree with observations made in another lambdoid phage. Phage 434 shares DNA homology with It in a segment spanning 110 bp between positions -197 and -87 (MASCARENHAS et al. 1981). A segment of phage 434 DNA containing homology to the sib region causes retroinhibition of int (MASCARENHAS et al. 1983). Sequencing of four sib - point mutations reveales that all the mutations fall in a 50-bp segment of DNA with a hyphenated dyad symmetry that includes bp at positions -195 and -146 (Fig. 2). As will be discussed below, this is the size and location of a minimum estimate for the site sib. It certainly agrees with the left limit at position -196 as defined by deletion. The right limit of the sib sequence, however, remains to be determined. The isolation and characterization of sib - mutants has been very useful in understanding the mechanism of retroregulation. The sib - mutants were isolated as phages able to promote integrative recombination in the absence of ell function (GUARNEROS et al. 1982; MONTANEZ et al. 1986). Genetic map ping of three independent sib- isolates indicates that the mutations lie in the 4 G. Guarneros a sib 3 h.fl3 sib 2 sill 1 T A T T AC~TTG 5'-TGA TGA6AAAAAAT TA!CGCAAGAAGAC AAAAATC C!CT AATGCT CTGTTA CAGGTCAC 3~ACTACTGTTTTTTAATCGCGTTCTTCTGTTTTTAGTGGAACGCGATTACGAGACAATGTCCAGTG • .--... • . .. • 4- • -200 -180 -180 -140 UU U U G U U A b C G U U U G . C5G-A sIb2 U=A U=A U U U U G U G=C U A C5G< c C G u U >G=C-Asibl hefl3 U-C=G U C=G~ASib2 U=A U=A U=A A=U A=U G=C CEG U=A U C GSC-Asibl U G hefI3U-CSG U=A U=A U-G A=U U=A A=U sib3A-G=C U=A U=A _____ ACUAC AUGUC ____ _ U U U U U C GAG A C A AUG U C----- 3' 5' 3' t 5' Fig. 2a-c. DNA sequence and potential RNA structures of the sib/tI region of ),. a A segment of ), DNA between positions - 200 and -140 to the left of aft is shown. The location and base changes of the three sib and one he! mutations are indicated (GUARNEROS et aL 1982). The horizontal arrows underline the region of dyad symmetry in sib. b, c Possible secondary structures for leftward mRNA from this region. The double stem-and-loop (b) can be formed by pL RNA but not by pI RNA. Arrowheads indicate the sites on the RNA where RNase III cuts. The pI transcript terminates at positions -192 or -193 in a stem-and-Ioop structure, followed by a run of uridylate residues (c) (SCHMEISSNER et aL 1984b). Note that structure c shares the upper stem-and-Ioop of structure b. The corresponding mutational changes are indicated in the leftward mRNA structures 241-bp DNA segment to the left of att in the marker order: sib3-sib2-sibl (MONTANEZ et al. 1986). Another mutant, he/B, was isolated independently and mapped to the left of att (ROEHRDANZ and DOVE 1977). The DNA sequence in the 251-bp region to the left of att was determined in the four mutants (GUARNEROS et al. 1982). Each has a single base substitution (Fig. 2). The chan ges confirmed the genetic map inferred from recombination experiments (MON TANEZ et al. 1986). Retroregulation of Bacteriophage}. in! Gene Expression 5 2.2 RNase ill Processing of the sib Transcript The inhibitor sib is a site requiring contiguousness to int in the same chromo some to exert its action; this was first inferred from cis-trans experiments by coinfection with phages sib + and sib - (GUARNEROS and GALINDO 1979; COURT et al. 1983 b; MONTANEZ et al. 1986). This conclusion agrees with the analysis of the sequence in the sib region, which, as defined by deletions and point mutations, does not encode a protein (DANIELS et al. 1983). The host endonuclease RNase III is involved in negative retroregulation of ;. integrase, the int gene product, by sib. Bacterial rnc- mutants, defective in RNase III, lack sib inhibition of Int synthesis (BELFORT 1980; SCHINDLER and ECHOLS 1981) or ofInt activity (GUARNEROS and GALINDO 1979; Epp et al. 1981; GUARNEROS et al. 1982). The pL antiterminated transcript is defective in the expression of int in spite of the fact that efficient expression of other genes located both upstream and downstream of int is observed (Epp et al. 1981; HENDRIX 1971). What causes this singular behavior? Oligonucleotide analysis of the in vivo N-depen dent pL transcript shows that the message extends through the tI terminator and that it is processed at the site sib. Processing does not occur in rnc - bacteria (ROSENBERG and SCHMEISSNER 1982; SCHMEISSNER et al. 1984a). The pL tran script derived from sib mutants extends through tI but is deficiently processed in rnc+ bacteria (MONTANEZ et al. 1986). sib- mutants are defective in negative retroregulation; thus, the absence of transcript processing correlates with int gene expression from pL. Transcripts made in vitro containing the sib region are processed by RNase III. Two cleavages occur 24 nucleotides apart in the sib RNA segment. However, in the secondary structure formed by the RNA, these cleavages are in opposite strands staggered by 2 bp (Fig. 2) (SCHMEISSNER et al. 1984a). Similar 2-bp staggered cuts have been found in T7 mRNA (the 1.1-1.3 cleavage site) and in the 30S ribosomal RNA precursor of E. coli (Ro BERTSON 1982). Infection experiments with;' cII - phages show that the rate of int mRNA synthesis from pL is independent of sib. However sib+ reduced the chemical stability of the int transcript, presumably as a result of RNase III processing (GUARNEROS et al. 1982). 2.3 Exonucleolytic Degradation of the Processed int Transcript Some inferences about the nature of post-transcriptional inhibition by sib derive from the analysis of Int-amber fragments in infection experiments. Synthesis of complete Int protein is severely reduced by sib, but production of amino terminal Int fragments escapes sib regulation (SCHINDLER and ECHOLS 1981). Consistent with these results are those of int mRNA 3'- end analysis by Sl map ping. In ;. cII--infected cells, the predominant 3'-end of the sib+ mRNA is located within the int gene sequence. In contrast, infections of RNase III-defec tive cells with sib+ phage, or of wild-type cells with sib- phage result in full length int transcripts (PLUNKETT and ECHOLS, personal communication). These

See more

The list of books you might like