loading

Logout succeed

Logout succeed. See you again!

ebook img

The role of NF-B in the antiviral action of interferon and interferon-regulated gene expression PDF

pages331 Pages
release year2004
file size1.42 MB
languageEnglish

Preview The role of NF-B in the antiviral action of interferon and interferon-regulated gene expression

The role of NF-(cid:1)B in the antiviral action of interferon and interferon-regulated gene expression Lawrence M. Pfeffer‡, Jong-Gwan Kim‡, Susan R. Pfeffer‡, Dennis J. Carrigan‡, Darren P. Baker§, Lai Wei¶, and Ramin Homayouni¶ D Departments of Pathology and Laboratory Medicine‡, and of Neurology¶, ow n lo a d e University of Tennessee Health Science Center, Memphis, TN 38103 d fro m h Biogen Idec, Inc.§, 14 Cambridge Center, Cambridge, MA 02142 ttp://w w w .jb c .o rg b/ y RUNNING TITLE: The role of NF-(cid:1)B in IFN action g u e s t o n M a rc h 2 6 To whom correspondence should be addressed: Lawrence M. Pfeffer, , 2 0 1 9 Department of Pathology and Laboratory Medicine, University of Tennessee Health Science Center, 930 Madison Avenue (Room 530), Memphis, TN 38103 Fax: 901-448-6979: Telephone: 901-448-7855; Email:[email protected] The abbreviations used are: IFN, interferon; NF-(cid:1)B, nuclear factor kappa B; KO, knockout; I(cid:1)B, inhibitor of (cid:1)B; ISGs, IFN-stimulated genes; STAT, signal transducer and activator of transcription; pfu, plaque-forming units; VSV, vesicular stomatitis virus; MEFs, mouse embryo fibroblasts; DCS, defined calf serum; RT-PCR, real-time PCR; EMSA, electrophoretic mobility shift assay; Mx1, myxovirus resistance 1; IFIT1, interferon-induced protein with tetratricopeptide repeats 1; NMi, n-Myc / STAT-interacting protein; ISG15, IFN-stimulated gene 15. D o w n lo a d e d fro m h ttp ://w w w .jb c .o rg b/ y g u e s t o n M a rc h 2 6 , 2 0 1 9 2 ABSTRACT Interferons (IFNs) play critical roles in host defense by modulating the expression of various genes via tyrosine phosphorylation of STAT transcription factors. IFN(cid:1)/(cid:1) activates another important transcription factor, nuclear factor kappa B (NF-(cid:1)B), but its role in IFN-mediated activity is poorly understood. The sensitivity to IFN’s antiviral and gene-inducing effects was examined in normal fibroblasts and in NF-(cid:1)B knockout (KO) fibroblasts from p50 and p65 null mice. D o w Antiviral assays demonstrated that NF-(cid:1)B KO fibroblasts were sensitized to the n lo a d e d antiviral action of IFN. Moreover, analysis of IFN-stimulated gene expression by fro m h ttp RT-PCR demonstrated selective effects of NF-(cid:1)B on gene expression. Our results ://w w w .jb c demonstrate that a subset of IFN-stimulated genes is regulated through an NF- .o rg b/ y g (cid:1)B-dependent pathway, and that NF-(cid:1)B may regulate the sensitivity of cells to ue s t o n M a IFN-mediated antiviral activity. rc h 2 6 , 2 0 1 9 3 INTRODUCTION IFNs are a family of multifunctional cytokines that block viral infection, inhibit cell proliferation, and modulate cell differentiation. While type-1 IFNs (IFN (cid:1), ß, and (cid:1)) bind to a common cell surface receptor, the receptor for type II IFN (IFN(cid:1)) is a distinct entity (1). IFNs transduce signals from the cell surface, resulting in selective gene induction through the activation of JAK tyrosine kinases and STAT transcription factors (1-3). Upon JAK-mediated tyrosine D o w phosphorylation, the STATs (STAT1, STAT2, and STAT3) dimerize and n lo a d e d translocate into the nucleus to activate transcription of IFN-stimulated genes fro m h ttp (3). IFN also activates the NF-(cid:1)B transcription factor in a serine/threonine ://w w w .jb c kinase-dependent signaling pathway that protects cells against apoptosis (4,5). .o rg b/ y g NF-(cid:1)B regulates the expression of genes involved in cell signaling, stress ue s t o n M responses, growth, survival, and apoptosis, by binding to cis-acting (cid:1)B sites in arc h 2 6 , 2 0 the promoters and enhancers of these genes. Viruses, cytokines, 1 9 lipopolysaccharides, and other stimulating agents promote NF-(cid:1)B translocation to the nucleus and DNA binding. Active, DNA-binding forms of NF-(cid:1)B are dimeric combinations of Rel proteins (p50, p52, c-Rel, v-Rel, RelA/p65, and RelB). In most cell types, the predominant form of NF-(cid:1)B is the p50:p65 heterodimer. NF-(cid:1)B dimers are retained in the cytoplasm of unstimulated cells in an inactive state by the binding of a family of inhibitory I(cid:1)B proteins. 4 While STATs play crucial roles in the transcriptional response to IFN(cid:1)/(cid:1) and in the induction of antiviral activity, the role of NF-(cid:1)B in IFN signaling and action has not been studied extensively. To identify the functional role of NF(cid:1)(cid:1)B in IFN action, the sensitivity to IFN’s antiviral effect was examined in fibroblasts that either had normal NF-(cid:1)B function or had the functional deletion of the IFN- induced NF-(cid:1)B pathway by germline disruption of p50 and p65 Rel proteins. Antiviral assays demonstrated that NF-(cid:1)B KO fibroblasts were sensitized to the D o w antiviral action of IFN(cid:1). To determine the relationship between gene regulation n lo a d e d by IFN(cid:1) and antiviral activity, microarray analysis was performed on RNA fro m h ttp samples collected from interferon-treated murine fibroblasts. Microarray analysis ://w w w .jb c identified several classical IFN-stimulated genes (ISGs) involved in the antiviral .org b/ y g u action of IFN. Quantitative RT-PCR demonstrated that, while the IFN-induced es t o n M a expression of some ISGs was enhanced in NF-(cid:1)B KO cells relative to wild-type rc h 2 6 , 2 0 mouse fibroblasts, IFN-induced expression of other ISGs was lower in NF-(cid:1)B KO 19 cells. Our results demonstrate the distinctive role of NF-(cid:1)B in the regulation of ISGs and in the induction of antiviral activity. Thus, the IFN-activated NF-(cid:1)B pathway not only counterbalances apoptosis but also regulates the expression of ISGs and the induction of antiviral activity. 5 EXPERIMENTAL PROCEDURES Biological reagents and cell culture. Recombinant, Chinese hamster ovary cell-expressed, rat IFN(cid:1) was obtained from Biogen Idec, Inc (6). The biological activity of IFN was assayed by protection against the cytopathic effect of vesicular stomatitis virus (VSV) on murine fibroblasts and expressed in units/ml using the murine NIH IFN(cid:1) standard for reference. Wild-type mouse embryo fibroblasts (MEFs) and MEFs lacking the p50 and p65 Rel proteins (7), D o w generously provided by Drs. David Baltimore and Alexander Hoffmann (California n lo a d e d Institute of Technology, Pasadena, CA), were plated at 3 x 105 cells per 60 mm fro m h ttp dish every three days in DMEM supplemented with 10% defined calf serum ://w w w .jb c (DCS) (HyClone Labs, Logan, UT). .o rg b/ y g u e s t o n NF-(cid:1)B activity measurements. Nuclei isolated from control and IFN(cid:1)- M a rc h 2 6 treated MEFs were extracted with buffer (20 mM Tris-HCl pH 7.85, 250 mM , 2 0 1 9 sucrose, 0.4 M KCl, 1.1 mM MgCl , 5 mM (cid:1)-mercaptoethanol, 1 mM NaF, 1 mM 2 Na VO , 1 mM PMSF, 5 µg/ml soybean trypsin inhibitor, 5 µg/ml leupeptin, and 3 4 1.75 µg/ml benzamidine), and extracts were frozen and stored at -80oC (8). For EMSA, the nuclear extracts were incubated with a [32P]-labeled (cid:1)B probe (5'-AGTTGAGGGGACTTTCCCAGG-3') derived from an NF-(cid:1)B binding sequence in the immunoglobulin gene promoter and subjected to electrophoresis (9). Gels 6 were quantitated by PhosphorImage autoradiography. Assays for the antiviral activity of IFN. To determine the cellular sensitivity to IFN’s ability to reduce virus titer, cell cultures were pre-incubated overnight with IFN, followed by infection with VSV for 1.5 h at 0.1 plaque- forming units (pfu) per cell. At 24 h post-infection, the virus yield in the medium was assayed by plaque formation on indicator Vero cells (10). To D o determine the sensitivity to protection against the cytopathic effect of VSV, w n lo a d e d fibroblasts were cultured in 96-well plates, incubated with serial two-fold fro m h ttp dilutions of IFN for 24 h, infected with VSV (0.1 pfu/cell), and scored for ://w w w .jb viability at 24 to 48 h post-infection by uptake of MTS dye (Promega, Madison, c.o rg b/ y g WI). Dye uptake was measured by absorbance at 490 nm in an ELISA plate u e s t o n M reader (Bio-Rad). a rc h 2 6 , 2 0 1 9 RNA preparation and Microarray Analysis. Total cellular RNA from untreated and IFN-treated (1,000 U/ml for 5 h) MEFs was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Approximately 10 µg of RNA was submitted to Genome Explorations Inc. (Memphis, TN) for labeling and hybridization to the murine U74Av2 GeneChip (Affymetrix Inc.) according to the manufacturer’s protocols. Expression values 7 were determined using Affymetrix Microarray Suite (MAS) 5.0 software. A table containing the raw expression data for 6 arrays (performed on RNA prepared from 3 individual untreated and 3 IFN-treated fibroblast cultures) can be found in ‘supporting information’ (Supplemental Table 1). Data Analysis. All data analysis was performed using GeneSpring software (Silicon Genetics, Inc.). The MAS 5.0 gene expression values for each D o gene were normalized across each chip as well as across all experiments. All w n lo a d e d expression values with an average difference of less than 20 and those that fro m h ttp were flagged absent in all samples were deleted from subsequent analysis. ://w w w .jb Statistical significance was calculated using a paired 2-tailed Welch’s t-test, c.o rg b/ y g which assumes unequal variance. Using a subset of genes that were statistically u e s t o n M affected by IFN treatment, hierarchical clustering was performed using standard a rc h 2 6 , 2 correlation values. In addition, the expression changes observed in IFN-treated 0 1 9 fibroblasts were compared with expression changes observed in studies using IFN-treated human peripheral blood mononuclear cells (11) and human fibrosarcoma cell lines (12). Quantitative Real-time PCR. Total RNA was isolated from untreated fibroblasts and fibroblasts treated with IFN for 24 h using TRIzol reagent 8 (Invitrogen, Carlsbad, CA). RNA (2 µg) was reverse transcribed using Omniscript RT kit (Qiagen). Quantitative real-time PCR (RT-PCR) was performed on an iCycler (Bio-Rad) using the SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. Primers used were: Mx-1- forward: 5'TCTGTGCAGGCACTATGAGG3', reverse: 5'GCCTCTCCACTCCTCTCCTT3'; p15- forward: 5'TGACGCAGACTGTAGACACGC3', D o reverse: 5'CTTGTCCTCCATGGGCCTT3'; w n lo a d e d NMi- forward: 5'AGTGGAAAGCGTGGATTATGA3', fro m h ttp reverse: 5'AATGCCTTCTAATCCGGTCA3'; ://w w w .jb c IFIT1-forward:5'AGGCTGGAGTGTGCTGAGAT3', .o rg b/ y g reverse: 5'TCTGGATTTAACCGGACAGC3'; u e s t o n M GAPDH-forward: 5'ATGTGTCCGTCGTGGATCTGA3', arc h 2 6 , 2 reverse: 5'GATGCCTGCTTCACCACCTT3'. 01 9 Cyclic parameters were 95oC for 15 min, amplification at 95oC for 30 sec, 55oC for 30 sec, 72oC for 30 sec, for 40 cycles. The product size was initially monitored by agarose gel electrophoresis and melting curves were analyzed to control for specificity of PCR reactions. The data on IFN-induced genes was normalized to the expression of the housekeeping gene GAPDH (similar results were obtained by normalization to (cid:1)-actin). The relative units were calculated 9 from a standard curve, plotting 3 different concentrations against the PCR cycle number at which the measured intensity reaches a fixed value (with a 10-fold increment equivalent to ~3.1 cycles). Immunoblotting. At 24 h after IFN(cid:1) treatment (1,000 U/ml), cells were lysed directly in Laemmli buffer and equivalent amounts of protein were subjected to SDS-PAGE. Proteins were transferred to PVDF membranes, D o immunoblotted with anti-ISG15, anti-Nmi, or anti-actin and visualized by w n lo a d e d chemiluminescence with the ECL reagent (Amersham). fro m h ttp ://w w w .jb c .o rg b/ y g u e s t o n M a rc h 2 6 , 2 0 1 9 10

See more

The list of books you might like