Logout succeed
Logout succeed. See you again!

Three new species of Ophryotrocha (Annelida: Dorvilleidae) from a whale-fall in the North-East Atlantic PDF
Preview Three new species of Ophryotrocha (Annelida: Dorvilleidae) from a whale-fall in the North-East Atlantic
Zootaxa 2228: 43–56 (2009) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2009 · Magnolia Press ISSN1175-5334(online edition) Three new species of Ophryotrocha (Annelida: Dorvilleidae) from a whale-fall in the North-East Atlantic HELENA WIKLUND1, 3, ADRIAN G. GLOVER2 & THOMAS G. DAHLGREN1 1Department of Zoology, University of Gothenburg, PO Box 463, SE-40530 Göteborg, Sweden. 2Zoology Department, The Natural History Museum, Cromwell Rd., London SW7 5BD, U.K. 3Corresponding author. E-mail: [email protected] Abstract Three new Ophryotrocha species are described from sites with high levels of organic carbon flux including a whale-fall at 125 m depth off the Swedish coast and sediment sampled at 104 m depth beneath a fish farm in a Norwegian fjord. Phylogenetic analyses based on the nuclear gene H3 and the mitochondrial genes COI and 16S using MrBayes and Maximum Likelihood analyses show that Ophryotrocha eutrophila sp. nov. is a close relative to Ophryotrocha puerilis, while Ophryotrocha craigsmithi sp. nov. falls together with Palpiphitime lobifera, and Ophryotrocha scutellus sp. nov. occur within the 'hartmanni' clade. The genus Ophryotrocha is in our study monophyletic only if the genera Iphitime and Palpiphitime are included. Two representatives of Ophryotrocha previously described from anthropogenically-enriched sediments are here reported for the first time in very high abundance from a naturally occurring habitat. We suggest that whale falls are important habitats for the evolution of ecosystem services such as the degradation of complex organic compounds. Key words: Polychaeta, organic enrichment, phylogeny, chemosynthetic ecosystem Introduction Whale carcasses that sink to the sea floor constitute a substantial addition of nutrients that can be utilised by benthic organisms as food (Smith & Baco, 2003). After the soft tissue is consumed by mobile scavengers, the bones can still sustain a diverse fauna for many years, where some species consume the complex organic carbons within the bones (e.g. Osedax Rouse et al., 2004) or use the diverse microbial communities that form bacterial mats at the surface of the bones. New species from several different annelid genera have been recently described from whale-fall habitats, e.g. five species of the siboglinid genus Osedax from the Pacific (Rouse et al., 2004; Fujikura et al., 2006; Rouse et al., 2008) and Atlantic Ocean (Glover et al., 2005), two species of the chrysopetalid genus Vigtorniella (Kiseleva, 1992) from the Pacific (Dahlgren et al., 2004) and Atlantic Ocean (Wiklund et al., 2009) and the new hesionid genus Vrijenhoekia Pleijel et al., 2008 described from a whale-fall off California. In this study we describe three new species of Ophryotrocha Claparède & Mecznikov, 1869 found on an experimentally implanted whale-fall at 125 m depth in the north east North Atlantic (Dahlgren et al., 2006), and report on dense populations of two additional Ophryotrocha species previously described from nutrient rich substrates of anthropogenic origin (e.g. cellulose fiber discards from a pulp mill; Åkesson, 1973). Worms from the dorvilleid genus Ophryotrocha are often found in organically enriched or even heavily polluted areas, such as in harbours and beneath marine aquaculture plants. The genus has a complicated systematic history. It was erected with Ophryotrocha puerilis Claparède & Mecznikov, 1869 as type species although the authors described a mixture of characters from O. puerilis and the species that was later to be Accepted by P. Hutchings: 20 Aug. 2009; published: 11 Sept. 2009 43 formally described as Ophryotrocha labronica La Greca & Bacci, 1962. Recently, both these species have been redescribed and neotypes have been assigned to them (Paxton & Åkesson, 2007). These authors also point at morphological and behavioural characters to help separate the subspecies O. puerilis siberti (McIntosh, 1885) from O. puerilis puerilis Claparède & Mecznikov, 1869, e.g. sclerotization of mandibles and reproductive differences. The two subspecies are included in our study as two different taxa to estimate the molecular differences between them and test the validity of the current subspecies status of the two forms. Ophryotrocha has traditionally been placed within the polychaete family Dorvilleidae Chamberlin, 1919. Orensanz (1990) moved Ophryotrocha from Dorvilleidae to Iphitimidae Fauchald, 1970. He also erected three new genera within Iphitimidae and moved some Ophryotrocha species to two of the new genera (Orensanz, 1990). However, Hilbig (1995), and Eibye-Jacobsen & Kristensen (1994) both refuted the moving of Ophryotrocha to Iphitimidae, based partly on finds of new species that possessed characters from both family definitions. More recent, higher-level molecular analyses including dorvilleid taxa also suggest major problems in delineating the taxon (e.g. Struck et al., 2006). Here we follow Eibye-Jacobsen & Kristensen (1994) and consider Ophryotrocha and the other genera from Iphitimidae as belonging to Dorvilleidae, which consists of 33 genera as defined by Eibye-Jacobsen & Kristensen (1994). The first phylogenetic study based partly on genetic data done on Ophryotrocha combined morphological characters with investigations on chromosome counts of 20 Ophryotrocha and three outgroup taxa (Pleijel & Eide, 1996). It was later followed by Dahlgren et al. (2001) who used 16S as the molecular marker in their study containing 18 Ophryotrocha species and five outgroup taxa. Heggoy et al. (2007) undertook a molecular study of Ophryotrocha with both 16S and cytochrome c oxidase I (COI), and they also included one species from the genus Iphitime Marenzeller, 1902 to investigate its position. In their study, Iphitime fell within Ophryotrocha (Heggoy et al., 2007), as has been suggested previously, e.g. by Hoisaeter & Samuelsen (2006). In this study, phylogenetic relationships of the new dorvilleid species are investigated using one nuclear (H3) and two mitochondrial (16S and COI) markers in analyses containing 18 species from the genus Ophryotrocha, two Iphitime species and seven outgroup taxa. Furthermore we have included two species from Palpiphitime Orensanz, 1990, Palpiphitime lobifera (Oug, 1978), which Orensanz moved from Ophryotrocha and used as type species when he erected Palpiphitime, and the newly described species Palpiphitime lipovskyae Paxton, 2009. Material and methods (a) Sample collection and morphological analysis Polychaetes were sampled using remotely operated vehicle (ROV), from a minke whale carcass at 125 m depth that was implanted in October 2003 in Kosterfjord off the Swedish west coast, 58° 53.1’ N; 11° 06.4’ E (Dahlgren et al., 2006). Bones from the whale-fall were collected using the manipulator arm of the ROV and placed in a sealed plastic box on the seafloor. On retrieval, polychaetes were either sampled from the bones directly or from sieving the water from the box that the bones were enclosed in on a 90 μm sieve. Bones from the carcass were kept in experimental aquaria with sand-filtered running sea water at 7°C, and some individuals were collected from the whale bones in these tanks. Animals were relaxed in 7% magnesium chloride in distilled water, photographed alive, and preserved for scanning electron microscopy (SEM), DNA analyses and standard morphology. Specimens for SEM were fixed in 1% osmium tetraoxide in filtered seawater for 15 minutes, rinsed in distilled water and stored in 70% ethanol, critical point dried, gold-coated and imaged using a Hitachi S-4300. Specimens for DNA sequencing were preserved in 95% ethanol and stored in –20°C, and specimens for standard morphology were fixed in 10% formalin in seawater for one hour, and transferred to 70% ethanol. The holotypes and vouchers for the sequenced species in this study are deposited at the Swedish Museum of Natural History (SMNH) in Stockholm, Sweden, voucher numbers in Table 1. Paratypes are deposited at the Natural History Museum (NHM) in London, UK. All animals not deposited as type material or specimen vouchers are in the first author's collection. 44 · Zootaxa 2228 © 2009 Magnolia Press WIKLUND ET AL. TABLE 1. Taxa, collection sites, voucher numbers and NCBI GenBank accession numbers. Terminal taxa Locality Voucher H3 16S COI Dorvillea albomaculata Åkesson & Rice, 1992 GenBank --- AF380115 EF464550 Dorvillea erucaeformis (Malmgren, 1865) GenBank --- AY838827 AY838868 Dorvillea rubrovittata (Grube, 1855) Istra, Croatia SMNH106071 GQ415490 GQ415457 --- Dorvillea similis (Crossland, 1924) GenBank --- DQ317915 DQ317857 Eunice pennata (O.F. Müller, 1776) GenBank DQ779731 AF321418 AY838870 Iphitime hartmanae Kirkegaard, 1977 Koster Area, Sweden SMNH106072 GQ415491 GQ415458 GQ415472 Iphitime paguri Fage & Legendre, 1934 GenBank --- --- EF464549 Ophryotrocha alborana nom. nud. Ceuta, Spain SMNH106073 GQ415492 AF321422 GQ415473 O. craigsmithi sp. nov. Sweden and Norway SMNH106087 GQ415493 GQ415459 GQ415474 O. eutrophila sp. nov. Koster Area, Sweden SMNH106088 GQ415494 GQ415460 GQ415475 O. geryonicola (Esmark, 1874) Väderöarna, Sweden SMNH106074 GQ415495 GQ415461 GQ415476 O. globopalpata Blake & Hilbig, 1990 Juan de Fuca Ridge SMNH106075 GQ415496 GQ415462 GQ415477 O. gracilis Huth, 1933 Sylt, Germany SMNH106076 GQ415497 AF321424 EF464545 O. hartmanni Huth, 1933 GenBank --- AF321419 EF464546 O. japonica nom. nud. Tsutsumi, Japan SMNH106077 GQ415498 GQ415463 GQ415478 O. labronica La Greca & Bacci, 1962 Hurghada, Egypt SMNH106078 GQ415499 AF321429 GQ415479 O. lipovskyae (Paxton, 2009) British Columbia, SMNH106238 --- --- GQ415480 Canada O. lobifera Oug, 1978 Sweden and Norway SMNH106079 GQ415500 GQ415464 GQ415481 O. longidentata Josefson, 1975 Koster Area, Sweden SMNH106080 GQ415501 GQ415471 GQ415482 O. maculata Åkesson, 1973 Koster Area, Sweden SMNH106081 --- GQ415465 GQ415483 O. notoglandulata Pfannenstiel, 1972 GenBank --- AF321431 EF464542 O. permanni nom. nud. Xiamen, China SMNH106082 GQ415502 AF321432 GQ415484 O. puerilis puerilis Claparède & Mecznikow, Malaga, Spain SMNH106083 GQ415503 GQ415466 GQ415485 1869 O. puerilis siberti (McIntosh, 1885) Malaga, Spain SMNH106084 GQ415504 GQ415467 GQ415486 O. robusta nom. nud. GenBank --- AF321433 EF464547 O. rubra nom. nud. Ceuta, Spain SMNH106085 GQ415505 GQ415468 GQ415487 O. scutellus sp. nov. Sweden and Norway SMNH106086 GQ415506 GQ415469 GQ415488 Parougia eliasoni (Oug, 1978) Koster Area, Sweden SMNH106089 GQ415507 GQ415470 GQ415489 Protodorvillea kefersteini (McIntosh, 1869) GenBank DQ779759 DQ779634 AY598738 (b) DNA analysis In the molecular analyses, 29 taxa were included (Table 1), 18 from Ophryotrocha, ten taxa from other genera within Dorvilleidae, and one outgroup taxon. The outgroup taxon was chosen from another eunicid family, Eunice pennata, since Eunicidae in some phylogenetic studies has been suggested to be closely related to Dorvilleidae (e.g. Struck et al., 2006). Five of the Ophryotrocha species in this study are not yet formally described. They are presented under the names they will be described (Paxton & Åkesson, in prep.), followed by nom. nud. Some sequences in the study were obtained from NCBI GenBank (Table 1). Extraction of DNA was done with DNAeasy Tissue Kit (Qiagen) following the protocol supplied by the manufacturer. About 400 bp of 16S, 330 bp of H3, and 600 bp of cytochrome c oxidase subunit I (COI) were amplified. PCR mixtures contained ddH2O, 1 μl of each primer (10μM), 2 μl template DNA and puReTaq Ready-To-Go PCR Beads (GE Healthcare) in a mixture of total 25 μl. The temperature profile was as follows: 96ºC/240s –(94ºC/30s– 48ºC/30s–72ºC/60s)*45cycles–72ºC/480s. PCR products were purified with the E.Z.N.A. Cycle-Pure Kit (Omega Bio-tek). Sequencing was performed by the Macrogen Sequencing System in Korea, on an ABI 3730XL DNA Analyser (Applied Biosystems), using primers listed in Table 2. THREE NEW OPHRYOTROCHA SPECIES Zootaxa 2228 © 2009 Magnolia Press · 45 Overlapping sequence fragments were merged into consensus sequences using Geneious (Drummond et al., 2007) and aligned using Clustal X 2.0 (Thompson et al., 1997) with default settings (15/6.66 as gap/gap length penalties). All regions that could not be unambiguously aligned were excluded. Alignments are available at TreeBase, http://www.treebase.org, accession number SN2462. The datasets were tested for incongruence using the Shimodaira-Hasegawa (SH) test in PAUP*, with RELL (resampling estimated log- likelihood) 1000 bootstrap replicates. The trees within the 95% confidence interval from the separate analyses made in MrBayes were used in the test. The SH test showed that the partitions were not incongruent and the three datasets were combined. The computer program PAUP* 4.0b10 (Swofford, 2002) was used for the parsimony (PA), and Maximum Likelihood (ML) analyses, with heuristic search and TBR (tree bisection and reconnection) branch swapping. Clade support was assessed using non-parametric bootstrap with 5000 replicates and ten random additions in PA, and with 100 replicates in ML. For the ML analysis, the three molecular datasets were combined and run in ModelTest (Posada, 1998), which suggested GTR+I+G as the best model. Bayesian phylogenetic analyses (BA) were conducted with MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003). Analyses were run three times with the combined dataset with four chains for 2,000,000 generations. 400,000 generations were discarded as burn-in. The results from each dataset were compared, and when values approached similar mean values for all parameters they were considered to have converged. The evolutionary models used for the molecular data in BA were obtained by running the separate datasets in MrModelTest (Nylander, 2004), and for 16S the optional model was GTR+I+G. For COI and H3, the data was partitioned into codon positions. For COI, position 1 and 3 followed GTR+G, while GTR+I+G was used for position 2, while for H3 position 1 followed GTR+I, position 2 followed JC+I and GTR+G was used for position 3. In the combined Bayesian analysis, the data was partitioned into the three parts (16S, H3, COI), the evolutionary models mentioned above were applied to each partition and corresponding codon position respectively, and the parameters used for the partitions were unlinked. TABLE 2. PCR and sequencing primers. Primer Sequence 5'-3' References 16SarL CGCCTGTTTATCAAAAACAT Palumbi (1996) 16SbrH CCGGTCTGAACTCAGATCACGT Palumbi (1996) H3F ATGGCTCGTACCAAGCAGACVGC Colgan et al. (2000) H3R ATATCCTTRGGCATRATRGTGAC Colgan et al. (2000) LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COI-E TATACTTCTGGGTGTCCGAAGAATCA Bely and Wray (2004) Results (a) Systematics Dorvilleidae Chamberlin, 1919 Ophryotrocha Claparède and Mecznikow, 1869 Ophryotrocha scutellus sp. nov. (Figs 1A–D) Material examined: Northern North Atlantic, coastal Skagerrak, 58° 53.1’ N; 11° 06.4’ E, female with eggs, 6 mm long, 29 chaetigers, preserved in formaldehyde from experimental tank with bone material sampled from a minke whale carcass, which was implanted at 125 m depth, holotype (SMNH T-7816); same location, 2 specimens, preserved in formaldehyde, paratypes (NHM2009.25); same location, one specimen preserved in 46 · Zootaxa 2228 © 2009 Magnolia Press WIKLUND ET AL. osmium for SEM, and several specimens preserved in ethanol for DNA extraction. Fishfarm in Mele, Hardangerfjord, 60°21.27’N; 6°20.89’E, 104 m depth, several specimens preserved in formalin. Description: Body shape elongated, uniform width for majority of body length, tapering slightly at posterior end. Colour transparent, with white eggs visible in females. (Fig. 1A). Prostomium round and dorso-ventrally flattened, disc-like. Eyes lacking. Long cirriform paired antennae inserted dorsally, reaching to first chaetiger, equally long palps cirriform inserted lateroventrally on prostomium. Jaws of P-type, mandibles rod-like without any serration. Maxillae with seven pairs of free denticles (Fig. 1B). Two peristomial achaetous segments. Parapodia uniramous with long dorsal and ventral cirri and cirriform acicular lobe, supraacicular chaetae simple, subacicular chaetae compound with serrated blades (Figs 1C–D). Subacicular chaetal lobe with simple chaeta. FIGURE 1. Ophryotrocha scutellus sp. nov., (A) live photo, (B) light micrograph of jaws, (C) light micrograph of parapodium, (D) SEM micrograph of chaetae. Scale bars in (B) and (C) are 100 μm, in (D) 20 μm. Pygidium with terminal anus, two pygidial cirri as long as antennae and palps laterally and a short, nub- like unpaired appendage ventrally. Distribution: Known from a minke whale carcass at 125 m depth (58°53.1’N; 11°06.4’E) in the Koster area in Sweden, and from sediment sampled at 104 m depth beneath a fish farm in Hardangerfjord (60°21.27’N; 6°20.89’E) in Norway. THREE NEW OPHRYOTROCHA SPECIES Zootaxa 2228 © 2009 Magnolia Press · 47 Reproduction: Eggs present in females from chaetiger 5 and in all segments to posterior end of body. No data available on the presence of sperm. Ecology: Live observation in aquarium experiments show adult specimens crawling on filamentous bacterial mats on the whale bones, and bacterial pellets are present in the worms guts, indicative of a bacterial diet. Etymology: Ophryotrocha scutellus is named after its flattened disc-like head, scutella is the latin word for flat dish or saucer. Remarks: Ophryotrocha scutellus has a rounded dorso-ventrally flattened head-form, shaped like a disc. Another Ophryotrocha that is reported to have flattened prostomium is O. platykephale, from which O. scutellus differs in jaw morphology, form of parapodia and absence of branchiae. Accession numbers for DNA sequences from O. scutellus, published on GenBank: GQ415469 (16S), GQ415488 (COI), GQ415506 (H3). Ophryotrocha craigsmithi sp. nov. (Figs 2A–D) Material examined: Northern North Atlantic, coastal Skagerrak, 58° 53.1’ N; 11° 06.4’ E, female with eggs, 7 mm long, preserved in formaldehyde, from experimental aquaria containing bones sampled from a Minke whale carcass, which was implanted at 125 m depth, holotype (SMNH T-7817); same location, one specimen, not complete, preserved in formaldehyde, paratype (NHM2009.26), same location three specimens preserved in ethanol for DNA extraction. Fishfarm in Svåsand, Hardangerfjord, 84 and 150 m depth, ten specimens preserved in ethanol for DNA extraction. Description: Colour pale red or transparent with red branchia-like structures on dorsal and ventral sides, the dorsal being very large and rounded in form, partly covering the dorsum (Fig. 2A). Body shape elongated, tapering slightly at posterior end. Prostomium with digitiform paired antennae inserted dorsally. Palps papilliform with palpophores, inserted laterally on prostomium. No eyes. Jaws of P-type, mandibles L-shaped with serration anteriorly. Maxillae with 7 free denticles (Fig. 2B) Two peristomial achaetous segments. Parapodia uniramous with dorsal and ventral cirri and cirriform acicular lobe, supraacicular chaetae simple, subacicular chaetae compound with serrated blades (Figs 2C–D). Subacicular setal lobe with simple chaetae. Pygidium with terminal anus and two pygidial cirri, unpaired appendage absent. Distribution: Known from the minke whale carcass at 125 m depth (58°53.1’N; 11°06.4’E) in the Koster area in Sweden, and from sediment sampled at 84 and 150 m depth beneath a fish farm in Hardangerfjord in Norway. Etymology: Ophryotrocha craigsmithi is named after Professor Craig R. Smith in recognition of his encompassing work with whale fall habitats. Remarks: This species is similar to Palpiphitime lipovskyae, O. platykephale Blake, 1985, O. wubaolingi Miura, 1997 and P. lobifera in having branchial structures both dorsally and ventrally. It differs from O. platykephale in the form of prostomium and parapodia, from O. wubaolingi in the shape of the parapodia, and from P. lobifera in the form of the dorsal branchial structures, and in the absence of eyes. It seems to be most similar to the recently described P. lipovskyae from sediment beneath fish farms in western Canada. Palpiphitime lipovskyae is reported to have jaws of both P- and K-type. So far no specimens of O. craigsmithi have been found with K-type jaws, but it can not be ruled out that it does not possess them. Ophryotrocha craigsmithi differs from P. lipovskyae genetically, and in the presence of a prominent ventral chaetal lobe with a protruding simple chaeta in O. craigsmithi. Accession numbers for DNA sequences from O. craigsmithi, published on GenBank: GQ415459 (16S), GQ415474 (COI), GQ415493 (H3). 48 · Zootaxa 2228 © 2009 Magnolia Press WIKLUND ET AL. FIGURE 2. Ophryotrocha craigsmithi sp. nov., (A) live photo, (B) light micrograph of jaws, (C) light micrograph of parapodium, (D) light micrograph of compound chaetae. Scale bar in (B) is 500 μm, in (C) 100 μm, in (D) 25 μm. Ophryotrocha eutrophila sp. nov. (Figs 3A–F) Material examined: Northern North Atlantic, coastal Skagerrak, 58° 53.1’ N; 11° 06.4’ E, female with eggs, 8 mm long, 32 chaetigers, preserved in formaldehyde from experimental tank with bone material sampled from a minke whale carcass, which was implanted at 125 m dept, holotype (SMNH T-7818); same location, four specimens, two males and two females, preserved in formaldehyde, paratype (NHM2009.27); same location, seven specimens preserved in formaldehyde, two specimens preserved in osmium for SEM, and several specimens preserved in ethanol for DNA extraction. Description: Colour transparent, females with eggs distinctly larger than males (Figs 3A, B). Body shape elongated, of generally uniform width, tapering slightly at posterior end. Prostomium with digitiform paired antennae inserted dorsally. Palps papilliform, inserted laterally on prostomium. No eyes. Mandibles rodlike, with anterior dentition. K-type maxillae with smooth forceps and 7 pairs of free denticles (Fig. 3D). Maxillae of P-type with 7 free denticles (Fig. 3E). Two peristomial achaetous segments, parapodia uniramous with short dorsal and ventral cirri (Fig. 3F), supraacicular simple chaetae with serration distally, subacicular chaetae compound, blades with serration (Fig. 3C), subacicular chaetal lobe with simple chaeta. Pygidium with terminal anus, two pygidial cirri laterally inserted and an unpaired appendage ventrally placed. THREE NEW OPHRYOTROCHA SPECIES Zootaxa 2228 © 2009 Magnolia Press · 49 Distribution: Known from an aquarium containing bones taken from a minke whale carcass at 125 m depth (58°53.1’N; 11°06.4’E) in the Koster area in Sweden. Reproduction: Egg masses form a tube in which the female crawl, the tube loosely attached and not covered by a hard surface like in O. labronica (Paxton & Åkesson, 2007). No data on the distribution of eggs or sperm among the segments of the worms. Etymology: Ophryotrocha eutrophila is named after its habitat choice, seemingly liking organically enriched environments (eutrophic=organically enriched, philus=like). Remarks: This species resembles O. puerilis in jaw morphology. Ophryotrocha eutrophila is dimorphic, with males commonly smaller than females and possess K-type maxillae, similar to O. puerilis.Ophryotrocha eutrophila is genetically different from O. puerilis and differsin the absence of eyes and the presence of a well developed median pygidial stylus. Ophryotrocha eutrophila is also similar to O. fabriae Paxton & Morineaux, 2009 described from a hydrothermal vent on the Mid-Atlantic Ridge. It differs from O. fabriae in the form of the mandibles. Accession numbers for DNA sequences from O. eutrophila, published on GenBank: GQ415460 (16S), GQ415475 (COI), GQ415494 (H3). FIGURE 3. Ophryotrocha eutrophila sp. nov., (A) live photo of male specimen, (B) live photo of smaller male and larger female, (C) SEM micrograph of chaetae, (D) light micrograph of K-type jaws, (E) light micrograph of P-type jaws, (F) light micrograph of parapodium. Scale bar in (C) is 20 μm and in (D), (E) and (F) 100 μm. 50 · Zootaxa 2228 © 2009 Magnolia Press WIKLUND ET AL. Palpiphitime lobifera (Oug, 1978) (Fig. 4) Material examined: Northern North Atlantic, coastal Skagerrak, 58° 53.1’ N; 11° 06.4’ E. Specimens recovered from minke whale bones in experimental aquarium tanks. Remarks: The most abundant dorvilleid on the whale bones is Palpiphitime lobifera. We here include a live photo of the species (Fig. 4) to show the presence of eyes, which were not reported in the original description (Oug 1978). The eyes are easily visible on live animals, but may be difficult to see in preserved specimens. FIGURE 4. Live photo of Palpiphitime lobifera from whale-fall in Sweden. Ophryotrocha maculata Åkesson, 1973 Material examined: Northern North Atlantic, coastal Skagerrak, 58° 53.1’ N; 11° 06.4’ E. Specimens recovered from minke whale bones in experimental aquarium tanks. Remarks:As with Palpiphitime lobifera this species was abundant on the whale bones. Both species have been described from anthropogenically enriched sediments such as pulp mill discharge. The discovery of dense populations of these two species actively feeding on mat-forming filamentous bacteria at whale falls suggest that they are important species for ecosystem function in terms of the degradation of high molecular weight organic compounds. (b) Phylogenetic analyses The combined dataset consists of 1384 characters, 732 are variable, of which 643 are parsimony-informative. The three Bayesian analyses (BA) converged on similar log-likelihood values, mean values for all parameters, and clade probabilities. The 50%-majority rule consensus tree from the BA supports 23 nodes, of which 20 with clade credibilities >95% (Fig. 5). The ML 50%-majority rule consensus tree supports 23 nodes, all of which were also recovered by the BA, and 12 of these have bootstrap values above 95%. The bootstrap of the parsimony analysis (PA) provided >50% support for 16 nodes (not shown), all of which are present in the BA and ML. There are no topological incongruencies between the three analyses, and the differences between them relate solely to weaker or no support in ML and PA for some groups that were recovered in the BA. The Ophryotrocha clade including two Iphitime species has a strong support in all analyses (Fig. 5). Dorvillea albomaculata is sister to Parougia eliasoni instead of clustering with the other Dorvillea Parfitt, 1866, supporting the hypothesis that D. albomaculata belong to the genus Parougia Wolf, 1986 based on the absence of maxillary basal carriers (Paxton, pers comm). THREE NEW OPHRYOTROCHA SPECIES Zootaxa 2228 © 2009 Magnolia Press · 51 FIGURE 5. Phylogenetic analyses of a combined dataset with three genes, majority rule consensus tree from the Bayesian analyses with posterior probability /bootstrap values from the analyses in MrBayes/Maximum Likelihood respectively, '*' indicates support value of 100, '-' indicates that the node is not supported. 52 · Zootaxa 2228 © 2009 Magnolia Press WIKLUND ET AL.