loading

Logout succeed

Logout succeed. See you again!

ebook img

Three new species of the freshwater snail genus Tylomelania (Caenogastropoda: Pachychilidae) from the Malili lake system, Sulawesi, Indonesia PDF

release year2008
file size2.3 MB
languageEnglish

Preview Three new species of the freshwater snail genus Tylomelania (Caenogastropoda: Pachychilidae) from the Malili lake system, Sulawesi, Indonesia

Zootaxa 1852: 37–49 (2008) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ ZOOTAXA Copyright © 2008 · Magnolia Press ISSN1175-5334(online edition) Three new species of the freshwater snail genus Tylomelania (Caenogastropoda: Pachychilidae) from the Malili lake system, Sulawesi, Indonesia THOMAS VON RINTELEN1 & MATTHIAS GLAUBRECHT Museum für Naturkunde, Humboldt-Universität zu Berlin, 10115 Berlin, Germany 1Corresponding author. E-mail: [email protected] Abstract The ancient Malili lake system on the Indonesian island Sulawesi hosts a large species flock of the viviparous freshwater gastropod Tylomelania. Molecular and morphological data have previously shown that this species flock resulted from three independent lake colonizations and subsequent adaptive radiations. In a recent taxonomic revision of these radia- tions 25 species have been recognized. Here we describe three new species from the system found during new sampling campaigns. Despite their highly distinct shell morphology, these species were previously overlooked because of their very restricted distribution range and, in one case, the very small size. Of these new species, two are endemic to a section of the Larona River, which drains the entire lake system, while the third species has only been found at one locality in central Lake Mahalona. The discovery of these species can contribute significantly to our understanding of evolution in the entire species flock, as two of the species form a basal branch of an entire clade and all show a high degree of habitat specialization. The local endemism of the Larona River species in particular makes them highly vulnerable to extinction caused by habitat destruction. Key words: ancient lakes, freshwater, adaptive radiation Introduction The Indonesian island Sulawesi is the largest, ecologically most diverse (Whitten et al. 2002) and possibly also oldest (Hall 2002) island in the oceanic island area commonly known as Wallacea (Dickerson 1928). Its fauna is particularly rich in endemic taxa and has its fair share of endemic genera as well (Whitten et al. 2002). Among these is the viviparous pachychilid freshwater gastropod Tylomelania Sarasin & Sarasin, 1898 (Caenogastropoda: Cerithioidea). This group is mainly known for its speciose species flocks in the ancient lakes of Sulawesi, viz. Lake Poso and the Malili lakes (Fig. 1). These have recently been shown to constitute model cases of adaptive radiation (Rintelen et al. 2004; Rintelen & Glaubrecht 2005). In the Malili lakes the detailed taxonomic study of new material collected since 1991 has led to a consid- erable revision of previous species diversity estimates in these lakes. Bouchet (1995) considered the number of 23 originally described species from both Lake Poso and the Malili lakes (species described by Sarasin & Sarasin 1897; 1898; Kruimel 1913) to be too high and suggested that only twelve biospecies occur in all ancient lakes of Sulawesi. Rintelen & Glaubrecht (2003) described two new lacustrine species from the Malili lakes and proposed 16 valid taxa to occur there alone, which is also the number described by the Sarasins and Kruimel for these lakes. Finally, 25 taxa have been recognized in a recent revision of the Malili lakes taxa including the description of nine new species (Rintelen et al. 2007). Intensive new sampling from 2002–2005 in the Malili lake area has provided a hitherto unparalleled cov- erage of the system. As a first result from the analysis of this new material we here describe three new species Accepted by B. Ruthensteiner: 29 Jul. 2008; published: 18 Aug. 2008 37 lacking from the recent revision of the Malili species flock and discuss their impact on the understanding of evolution in the entire radiation. FIGURE 1. Sulawesi and the Malili lake system with sample sites. Locality numbers are the original field numbers and correspond to those in Tab. 1. Material and methods Material. This study is based on material collected by the authors in the Malili lake system in 1999, 2002 and 2003, respectively (Tab. 1). All samples are preserved in 70% or 95% ethanol and have been deposited in the Museum Zoologi Bogor (MZB) and the Museum für Naturkunde Berlin (ZMB). Methods. Shells were measured to 0.1 mm using an electronic calliper. Standard shell parameters were taken following Dillon (1984). Embryonic shells were measured to 0.1 mm using an ocular micrometer; parameters were taken as in adult specimens. 38 · Zootaxa 1852 © 2008 Magnolia Press VON RINTELEN & GLAUBRECHT TABLE 1. List of sampling stations with locality details. The locality numbers correspond to those in Fig. 1. Locality number Locality Coordinates Collection date (Field code) 58-99 Larona River, at road Malili-Soroako 2°70.29‘S, 121°9.81‘E Aug. 27, 1999 14-02 Larona River, at road Malili-Soroako 2°40.36‘S, 121°9.79‘E Oct. 25, 2002 15-02 Larona River, at road Malili-Soroako 2°40.55‘S, 121°9.54‘E Oct. 25, 2002 71-02 Larona River, at road Malili-Soroako 2°40.42‘S, 121°9.91‘E Dec. 2, 2002 56-03 Lake Mahalona, NW shore, at rocky cape 2°34.72‘S, 121°29.12‘E Sept. 9, 2003 Anatomy was studied with a stereo microscope; the sex ratio is given as the proportion of males among sexed individuals. Radulae and embryonic shells were studied by scanning electron microscopy (SEM). The radulae were cleaned enzymatically with proteinase K as described by Holznagel (1998), sonicated and then mounted on aluminium specimen stubs with adhesive pads. Embryonic shells were cleaned mechanically, sonicated, and mounted on adhesive carbon-coated pads. Both radulae and embryonic shells were coated with gold-palla- dium and studied on a LEO 1450VP scanning electron microscope (software: 32 V02.03) at 10 kV. The dimensions of the initial whorl of embryonic shells were measured to 1 μm by SEM using the attached soft- ware. In radulae, teeth were counted and total radula length measured to 0.1 mm. Polymerase chain reaction (PCR) was used to amplify a ~890 bp region of the mitochondrial 16S riboso- mal RNA gene using primers 16SF 5' TCGCACCAGCGATAGCTAGTT (this study) and H3059 5' CCG- GTYTGAACTCAGATCATGT (Wilson et al. 2004) in four specimens of two of the new species. The molecular methods have been described in detail by Rintelen et al. (2004). The sequences were combined with the dataset from Rintelen et al. (2004) including two species of Pseudopotamis Martens, 1894 from the Torres Strait Islands as outgroup and were aligned with Clustal X 1.8.1 for Windows (Thompson et al. 1997) using default settings. The resulting alignment was corrected manually. The phylogeny was estimated by Maximum Likelihood (ML) with Treefinder (Jobb 2005). For the ML analyses an appropriate model of sequence evolution was selected using MrModeltest 2.2 (Nylander 2004) and PAUP*4.0b10a (Swofford, 2002), and consequently based on both the Hierarchical Likelihood Ratio tests and the Akaike Information Γ Criterion the GTR + I + model was chosen. The ML analysis was done with the Treefinder default settings, as was an additional bootstrap analysis with 1000 replicates. All new sequences have been deposited in GenBank (accession numbers EU881923-EU881926). Results Systematic account Caenogastropoda Cerithioidea Pachychilidae Tylomelania Sarasin & Sarasin, 1898 Tylomelania baskasti sp. nov. THREE NEW SPECIES OF TYLOMELANIA Zootaxa 1852 © 2008 Magnolia Press · 39 Type material. Indonesia, Sulawesi, Larona River: Holotype (Fig. 2A; 52.3 mm x 17.7 mm, loc. 71-02), MZB Gst. 12.109; paratypes (Fig. 2B-D): loc. 14–02, MZB Gst. 12.110, n=5; ZMB Moll. 190533, n=7; loc. 15-02, MZB Gst. 12.111, n=12; ZMB Moll. 190534, n=16; loc. 71-02, MZB Gst. 12.112, n=14; ZMB Moll. 190535, n=17. FIGURE 2. T. baskasti sp. nov.; A–D. shells, A. holotype, MZB Gst. 12.108 (loc. 71-02), B. paratypes, ZMB Moll. 190535 (loc. 71-02), C. paratypes, ZMB Moll. 190534 (loc. 15-02), D. paratypes, ZMB Moll. 190533 (loc. 14-02). Scale bar = 1 cm. E–F. opercula, E. paratype, ZMB Moll. 190534 (loc. 15-02), F. paratype, ZMB Moll. 190533 (loc. 14-02). Scale bar = 0.5 cm. Etymology. The new species has been named baskasti in honour of Bas Kast, who has generously sup- ported research on these snails at the Museum für Naturkunde. Description. Shell (Fig. 2A–D): Medium sized to large, brown, elongate conic, spire angle 13–25°. Top whorls in adult specimens always corroded to a varying degree, 4–9 remaining whorls, can reach up to 54.7 mm (Tab. 1). With spiral ribs only. Aperture oval, pointed at top and slightly siphonated at base. Columella and interior of aperture brown, in few specimens slightly whitish coating. External morphology: Headfoot black with fine orange dots, sometimes rather dense, foot more intensely pigmented, mantle edge serrated to a varying degree. Body coiled in 3–6 whorls. Operculum(Fig. 2E,F): roundish-ovate, last whorl inflated, multispiral with 5–7 whorls (n=3). 40 · Zootaxa 1852 © 2008 Magnolia Press VON RINTELEN & GLAUBRECHT Radula (Fig. 3A,B): 160–194 rows, 16.4–24.2 mm long, on average 8.8 teeth per mm (n=12). Central tooth with pointed and enlarged major denticle. Glabella with very slightly rounded base. Lateral teeth with pointed and enlarged major denticles and 2–3 minor denticles on each side. Marginal teeth shovel-like, inner and outer marginals with three almost equal-sized denticles each. FIGURE 3.T. baskasti sp. nov., ZMB Moll. 190534 (loc. 15-02). A–B. radula, A. segment, frontal, B. segment, apical (45°). Scale bar = 0.1 mm. C–E. embryonic shells, C. lateral view, D. apical whorls, lateral, E. apical view. Scale bar = 1 mm. Reproductive biology: Brood pouch contains 4–12 embryos, their size can reach 8.4 mm (n=5) (Tab. 3). Embryonic shells (Fig. 3C–E): Elongate-conic, axial ribs emerging on the 2nd to 3rd whorl and fading on the 5th whorl. Spiral striae emerge on 3rd to 4th whorl (Tab. 3). Distribution and habitat. South Sulawesi, lower reaches of Larona River (Fig. 1B). This species was collected in shallow water (0.1–0.5 m depth) in less turbulent zones at the river bank on soft substrate. As deeper parts of the river were not accessible for sampling because of strong currents, T. baskasti must not necessarily be restricted to shallow water. Taxonomic remarks. Shell shape and radula of T. baskasti are similar to that of T. lalemae (Kruimel, 1913) from Lake Towuti. The shell of T. baskasti is more fragile and always lacks the conspicuous white aper- ture of T. lalemae, though. The radula of T. baskasti also closely resembles that of all other described riverine species of Sulawesi such as e.g. T. perfecta (Mousson, 1849). T. baskasti can be unambiguously distinguished from those taxa by its characteristic shell and the molecular data clearly confirm its relationship to the Malili lakes species flock (compare also below, Discussion). THREE NEW SPECIES OF TYLOMELANIA Zootaxa 1852 © 2008 Magnolia Press · 41 Tylomelania sinabartfeldi sp. nov. Type material. Indonesia, Sulawesi, Larona River: Holotype (Fig. 4A; 24.0 mm x 18.5 mm, loc. 58-99), MZB Gst. 12.112; paratypes (Fig. 4B): loc. 58-99, MZB Gst. 12.113, n=53; ZMB Moll. 108315, n=65; loc. 71-02, ZMB Moll. 112690, n=2; loc. 58-99 (leg. Rainer Masche 2007), ZMB Moll. 192697, n=3. Etymology. The new species has been named sinabartfeldi in honour of Sina Bartfeld, who contributed to supporting malacological research. Description. Shell (Fig. 4A,B): Medium sized, brown, two shapes: conic or subglobose, transitory forms exist. Spire angle 45–85°. Top whorls in adult specimens always corroded to a varying degree, 3–6 remaining whorls, can reach up to 27.2 mm (Tab. 2). With spiral ribs only. Aperture oval, pointed at top and slightly siphonated at base. Columella and interior brown. TABLE 2. Shell parameters of the three new species. Values represent, from top, range, mean and standard deviation, and sample size. h—shell height; w—shell width; aph—aperture length; apw—aperture width; bwl—body whorl; angle—spire angle; n.a.—not applicable. Species h w aph apw bwl whorls angle axial ribs (mm) (mm) (mm) (mm) (mm) (N) (°) (N, on bwl) T. baskasti 9.5–54.7 4.2–18.1 4.2–16.0 2.1–9.4 6.2–25.8 4–9 13–25 n.a. 37.47 ±9.864 13.84 ±2.794 11.70 ±2.481 7.00 ±1.424 19.04 ±4.284 7.1 ±1.31 20.4 ±2.51 69 69 69 69 69 69 67 T. sinabartfeldi 14.4–27.2 10.6–20.8 8.3–14.0 4.9–9.4 11.1–23.7 3–6 45–85 n.a. 20.86 ±2.499 16.40 ±1.754 10.92 ±1.107 7.26 ±0.801 16.70 ±2.180 4.5 ±0.90 63.5 ±6.80 118 118 118 118 118 118 112 T. hannelorae 10.6–13.9 5.5–6.8 3.9–4.6 2.3–2.7 6.9–7.9 3–5 11–17 15–21 12.31 ±1.022 5.91 ±0.398 4.3 ±0.254 2.57 ±0.138 7.34 ±0.375 4.3 ±0.71 13.3 ±2.00 17.7 ±2.19 9 9 9 9 9 9 9 8 TABLE 3. Embryonic shell parameters of Malili lake system Tylomelania. Values represent, from top, range, mean and standard deviation, and sample size. juv.—juveniles in broodpouch; h max—embryo shell height; ax 3rd—axial ribs on third whorl; n.a.—not applicable. Species juv. h max whorls axial ribs ax 3rd (N) (mm) (N) (N) (N) T. baskasti 1–4 5.7–8.4 5.50–6.25 25–30 8–9 2.5 ±1.05 7.16 ±1.062 6.0 ±0.35 27.8 ±2.22 8.8 ±0.50 6 5 4 4 4 T. sinabartfeldi 11–67 1.2–2.9 3.0–4.0 9–15 n.a. 31.0 ±31.24 2.67 ±0.321 3.3 ±0.35 12.6 ±2.30 3 3 10 7 T. hannelorae 1–2 2.4–3.1 4.5 18 10 1.3 ±0.58 2.70 ±0.361 - - - 3 3 1 1 1 External morphology: Headfoot black, mantle edge serrated to a varying degree. Body coiled in 2.5 whorls. Operculum(Fig. 4C): roundly-ovate, last whorl inflated, multispiral with 4–5 whorls. Radula (Fig. 5A–D): 176–231 rows, 18.9–25.5 mm long, on average 9.6 teeth per mm (n=9). Central tooth with very large and almost squarish major denticle and two minor denticles on each side. Glabella with slightly rounded base. Lateral teeth with very much enlarged squarish major denticles and two minor denticles 42 · Zootaxa 1852 © 2008 Magnolia Press VON RINTELEN & GLAUBRECHT on each side. Marginal teeth shovel-like, inner and outer marginals with three denticles each, the outermost ones considerably wider than the inner ones. Inner marginals larger than outer ones. Reproductive biology: Brood pouch contains 11–67 embryos, their size can reach 5.0 mm (Tab. 3). Embryonic shells (Fig. 5E–K): Conic, with no or few and comparatively weak axial ribs emerging on the 2nd whorl and fading on the 3rd whorl (Tab. 3). FIGURE 4.T. sinabartfeldisp. nov. (loc. 58-99). A–D. shells, A. holotype, MZB Gst. 12.112, B. paratypes, ZMB Moll. 108315. Scale bar = 1 cm. C. opercula, ZMB Moll. 108315. Scale bar = 0.5 cm. Distribution and habitat. South Sulawesi, lower reaches of Larona River (Fig. 1B). On submerged logs exposed to strong current, collected in 0.1–1 m depth. As with T. baskasti, the inac- cessibility of deeper parts of the river because of the strong currents does not allow us to estimate its depth range with any certainty. Taxonomic remarks. The two extremely distinct shell forms encountered in this species are suggestive of two morphs or even two taxa at first glance. A comparison of the entire series revealed transitions between both forms, though, and as a consequence an attempt to unambiguously sort the sample into the two forms failed (compare Fig. 4). Radula and embryonic shell comparisons between specimens chosen from both extremes of shell form also failed to show any difference (Fig. 5) and both forms were sampled from the same THREE NEW SPECIES OF TYLOMELANIA Zootaxa 1852 © 2008 Magnolia Press · 43 FIGURE 5. T. sinabartfeldi sp. nov., ZMB Moll. 108315 (loc. 58-99). A–D. radula, A,B, keeled shell morph, A. seg- ment, frontal, B. segment, apical (45°); C,D. round shell morph, C. segment, frontal, D. segment, apical (45°). Scale bar = 0.1 mm. E–K. embryonic shells, E–G, round shell morph, E. lateral view, F. apical whorls, lateral, G. apical view; H–K, keeled shell morph, H. lateral view, I. apical whorls, lateral, K. apical view. Scale bar = 0.5 mm. 44 · Zootaxa 1852 © 2008 Magnolia Press VON RINTELEN & GLAUBRECHT log without any observable difference in distribution. We thus suggest that T. sinabartfeldi as described here represents one highly variable species with respect to shell form. If this variability is an expression of ecophe- notypic variation remains open to speculation at this point. Despite the high intraspecific variability in shell shape, both the subglobose and conic form of T. sinabar- tfeldi do not resemble any other speciesof Tylomelania. FIGURE 6.T. hannelorae sp. nov. (loc. 57-03). A–B. shells, A. holotype, MZB Gst. 12.114, B. paratypes, ZMB Moll. 190713. Scale bar = 1 cm. C. opercula, ZMB Moll. 190713. Scale bar = 1 mm. D–E. radula, ZMB Moll. 190713. D. seg- ment, frontal, E. segment, apical (45°). Scale bar = 0.1 mm, F–H. embryonic shells, ZMB Moll. 190713. F. lateral view, G. apical whorls, lateral, H. apical view. Scale bar = 0.5 mm. THREE NEW SPECIES OF TYLOMELANIA Zootaxa 1852 © 2008 Magnolia Press · 45 Tylomelania hannelorae sp. nov. Type material. Indonesia, Sulawesi, Lake Mahalona, loc. 56-03: Holotype (Fig. 6A; 11.8 mm x 5.5 mm), MZB Gst. 12.114; paratypes (Fig. 6B), MZB Gst. 12.115, n=3; ZMB Moll. 190713, n=5. Etymology. The new species has been named hannelorae in honour of Hannelore Glaubrecht, for her emotional participation in our Sulawesi research. Description. Shell (Fig. 6A,B): Small, dark brown, elongate conic, spire angle 11–17°. Top whorls in adult specimens always corroded to a varying degree, 3–5 remaining whorls, can reach up to 13.9 mm (Tab. 2). Axial and spiral ribs form reticulated pattern. Aperture oval, pointed at top and slightly siphonated at base. Columella and interior dark brown. External morphology: Headfoot black, mantle edge serrated to a varying degree. Operculum(Fig. 6C): ovate, last whorl strongly inflated, multispiral with 10 whorls. Radula (Fig. 6D,E): 28–44 rows, 2.1–3.2 mm long, on average 13.7 teeth per mm (n=5). Central tooth with very large and elongate squarish major denticle and one minor denticle on each side. Glabella narrow, with convex base. Lateral teeth with very much enlarged squarish major denticles and one minor denticle on each side. Marginal teeth shovel-like, inner and outer marginals with three denticles each, the outermost ones considerably wider than the inner ones. Reproductive biology: Brood pouch contains 1–2 embryos, their size can reach 3.1 mm (Tab. 3). Embryonic shells (Fig. 6F–H): Ovate-conic, with strong axial ribs emerging on the 2nd to 3rd whorl and fading on the 5th whorl. Shallow, widely spaced spiral ribs emerge on 3rd to 4th whorl (Tab. 3). Distribution and habitat. South Sulawesi, Lake Mahalona, cape on NW shore (Fig. 1B). This species was collected on rocks in shallow water (less than 0.5 m depth). Taxonomic remarks. T. hannelorae is the smallest species within the Malili lakes species flock. Its size in combination with the reticulate shell sculpture generally can serve to distinguish it unambiguously from all other species in the system. While T. hannelorae might be mistaken for subadult specimens of T. confusa Rin- telen, Bouchet & Glaubrecht, 2007, at first glance, the shell corrosion of the upper whorls characteristic for older animals will allow identifying any specimen as a fully grown adult. Molecular phylogeny. The topology of the 16S ML phylogram based on 851 bp of mitochondrial 16S rDNA (Fig. 7) is basically identical to the tree presented in Rintelen et al. (2004) except for the inclusion of two of the new species described here, T. baskasti and T. sinabartfeldi (all attempts to sequence T. hannelorae failed). Both species belong to a clade of smooth-shelled or spirally-ribbed taxa (clade Malili 2, compare Rin- telen et al. 2004, 2007), where they form a poorly supported subclade which is sistergroup to all remaining species of clade Malili 2 but for one individual of T. sarasinorum (Kruimel, 1913) from the outlet bay of Lake Towuti clustering with T. baskasti and T. sinabartfeldi. While the three haplotypes of T. sinabartfeldi are iden- tical, T. baskasti appears paraphyletic with an intraspecific sequence divergence of 0.6% (p-distance). Discussion Species diversity in the Malili lakes. The gastropod species flock of Tylomelania stands out as the second most diverse ancient lake radiation within a single genus after the Tanganyikan Lavigeria (Rintelen et al. 2007). If endemic species diversity of molluscs per area is considered, the lakes are second only to Lake Ohrid. The addition of the three new taxa described here provides further evidence for the exceptional scope of this radiation. While two of the new species are from the Larona River, which is draining the entire Malili lake system, these species are nevertheless subsumed with the truly lacustrine taxa here. Their shell morphology bears more resemblance to that of the other lacustrine taxa than to the widely occurring riverine species and, more importantly, the molecular phylogeny shows them to be part of the lake radiation. 46 · Zootaxa 1852 © 2008 Magnolia Press VON RINTELEN & GLAUBRECHT

See more

The list of books you might like