Logout succeed
Logout succeed. See you again!

Title Page Title: Inhibition of thromboxane A2-induced arrhythmias and intracellular calcium ... PDF
Preview Title Page Title: Inhibition of thromboxane A2-induced arrhythmias and intracellular calcium ...
JPET Fast Forward. Published on September 9, 2009 as DOI: 10.1124/jpet.109.157677 JPET FaTshti sF aortircwle ahrads n. oPt buebenli csohpyeeddi toedn a nSde fportmeamttebd.e Trh 9e ,f i2na0l 0ve9r saiosn mDaOy Id:i1ff0er. 1fr1om2 4th/jisp veetr.s1io0n.9.157677 JPET #157677 Title Page Title: Inhibition of thromboxane A -induced arrhythmias and intracellular calcium 2 changes in cardiac myocytes by blockade of the IP pathway 3 Authors: Wacker MJ, Kosloski LM, Gilbert WJR, Touchberry CD, Moore DS, Kelly JK, D Brotto MA, Orr JA o w n lo a d e d fro m jp e Affiliations: t.a s p e tjo u Muscle Biology Research Group, Schools of Medicine and Nursing, University of rn a ls .o rg Missouri-Kansas City, Kansas City, MO (LMK, CDT, MAB, MJW) a t A S P E T J o u Department of Molecular Biosciences, University of Kansas, Lawrence, KS (WJRG, rn a ls o n JAO) M a rc h 1 3 , 2 0 2 Microscopy and Analytical Imaging Core, University of Kansas, Lawrence, KS (DSM) 3 Department of Ecology and Evolutionary Biology, University of Kansas, Lawrence, KS (JKK) 1 Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics. JPET Fast Forward. Published on September 9, 2009 as DOI: 10.1124/jpet.109.157677 This article has not been copyedited and formatted. The final version may differ from this version. JPET #157677 Running title page Running title: TXA -mediated arrhythmias and the role of IP 2 3 Corresponding Author: Michael J. Wacker, PhD Muscle Biology Research Group D Dept. Basic Medical Science o w n lo a d School of Medicine e d fro m University of Missouri-Kansas City jp e t.a s p Health Sciences Building e tjo u rn a 2464 Charlotte St. ls .o rg a Kansas City, MO 64108 t A S P E T [email protected] J o u rn a 816-235-6069 phone ls o n M a 816-235-6517 fax rc h 1 3 , 2 0 2 3 Text pages: 34 Number of tables: 1 Number of Figures: 6 Number of References: 40 Number of words in the Abstract: 227 2 JPET Fast Forward. Published on September 9, 2009 as DOI: 10.1124/jpet.109.157677 This article has not been copyedited and formatted. The final version may differ from this version. JPET #157677 Number of words in the Introduction: 681 Number of words in the Discussion: 1460 Abbreviations: TXA = Thromboxane A 2 2 TXA R= Thromboxane A receptor 2 2 IP = Inositol trisphosphate 3 D o IP R= Inositol trisphosphate receptor w 3 n lo a d e PIP2= phosphatidylinositol 4,5-bisphosphate d fro m TNT= Troponin T jpe t.a s p e 2-APB= 2-aminoethoxydiphenyl borate tjo u rn a TBST= Tris-buffered saline with tween 20 ls.o rg a t A HBSS= Hank’s buffered salt solution S P E T J MABP= Mean arterial blood pressure o u rn a ls HR= Heart rate on M a rc RT-PCR= Reverse transcriptase polymerase chain reaction h 1 3 , 2 0 23 Recommended Section Assignment: Cardiovascular 3 JPET Fast Forward. Published on September 9, 2009 as DOI: 10.1124/jpet.109.157677 This article has not been copyedited and formatted. The final version may differ from this version. JPET #157677 Abstract We have recently reported that left atrial injections of the thromboxane A (TXA ) 2 2 mimetic, U46619, induced ventricular arrhythmias in the anesthetized rabbit. Data from this study led us to hypothesize that TXA may be inducing direct actions on the 2 myocardium to induce these arrhythmias. The aim of this study was to further elucidate the mechanism responsible for these arrhythmias. We report that TXA R is expressed 2 D o at both the gene and protein levels in atrial and ventricular samples of adult rabbits. In w n lo a d addition, TXA2R mRNA was identified in single, isolated, ventricular cardiac myocytes. ed fro m Furthermore, treatment of isolated cardiac myocytes with the TXA2 mimetic, U46619, jp e t.a s increased intracellular calcium in a dose dependent manner and these increases were pe tjo u rn blocked by the specific TXA R antagonist, SQ29548. Pretreatment of myocytes with an a 2 ls .o rg inhibitor of inositol trisphosphate (IP3) formation, gentamicin, or with an inhibitor of IP3 at A S P E receptors (IP R), 2-aminoethoxydiphenylborate (2-APB), blocked the increase in T 3 J o u intracellular calcium. Subsequently, in vivo pretreatment of anesthetized rabbits with rna ls o n either gentamicin or 2-APB inhibited the formation of ventricular arrhythmias elicited by M a rc h 1 U46619. These data support the hypothesis that TXA induces arrhythmias via a direct 3 2 , 2 0 2 3 action on cardiac myocytes. Furthermore, these arrhythmogenic actions were blocked by inhibitors of the IP pathway. In summary, this study provides novel evidence for 3 direct TXA -induced cardiac arrhythmias and provides a rationale for IP as a potential 2 3 target for the treatment of TXA -mediated arrhythmias. 2 4 JPET Fast Forward. Published on September 9, 2009 as DOI: 10.1124/jpet.109.157677 This article has not been copyedited and formatted. The final version may differ from this version. JPET #157677 Introduction Thromboxane A (TXA ) is a member of the prostaglandin family and is formed 2 2 by the conversion of arachidonic acid to prostaglandin G by cyclooxygenase, which is 2 subsequently converted to TXA by TXA synthase. The well known actions of TXA 2 2 2 include platelet aggregation and vasoconstriction (Hamberg et al., 1975; Moncada and Vane, 1978). Because of these actions, results of clinical trials have suggested non- D o steroidal anti-inflammatory agents, such as aspirin, as a protective therapy to reduce w n lo a d the risk of cardiovascular events (Patrono et al., 2004). There is little doubt that TXA2 ed fro m mediated vasoconstriction and platelet aggregation can contribute to heart disease and jp e t.a s arrhythmias in an indirect manner via the induction of platelet aggregation and coronary pe tjo u rn artery vasoconstriction. What has not been well characterized, however, are the a ls .o rg potential direct arrhythmogenic effects of TXA2 on the heart via stimulation of cardiac at A S P E TXA receptors. T 2 J o u Our research group has previously been interested in the ability of the TXA2 rnals o n mimetic, U46619, to stimulate neurons involved in the autonomic nervous system M a rc h 1 (Wacker et al., 2002). During the course of these in vivo experiments in the 3 , 2 0 2 3 anesthetized adult rabbit, it was noted that left atrial injections of U46619 also induced arrhythmias. These U46619-induced arrhythmias were documented in a subsequent study and found to be ventricular in origin and were inhibited by pretreatment with SQ29548, a specific inhibitor of the TXA receptor (TXA R also known as TP) (Wacker 2 2 et al., 2006). Coronary blood flow was measured during these experiments and was not significantly altered by the injections of U46619 and there were no ST segment changes 5 JPET Fast Forward. Published on September 9, 2009 as DOI: 10.1124/jpet.109.157677 This article has not been copyedited and formatted. The final version may differ from this version. JPET #157677 in the ECG recordings. This would indicate that significant vasoconstriction or myocardial ischemia did not play a role in the genesis of these arrhythmias. Furthermore, we demonstrated that the number of arrhythmias induced by U46619 was not statistically altered by blockade of β-adrenergic receptors; thus U46619 did not augment beta adrenergic signaling to the heart to induce arrhythmias. Therefore, we hypothesized that direct activation of TXA Rs on cardiac myocytes may alter calcium 2 D dynamics, leading to these arrhythmias. o w n lo There is a strong rationale for this hypothesis. Previous studies have shown that ad e d fro there are binding sites for TXA Rs in the heart of various species (Lasserre et al., 1992; m 2 jp e Bowling et al., 1994) and that TXA can induce changes in intracellular calcium in t.as 2 p e tjo u neonatal rat cardiac myocytes (Hoffmann et al., 1993; Dogan et al., 1997). Therefore, rn a ls .o the purpose of this study was to determine the mechanism by which activation of rg a t A S TXA Rs could induce changes in intracellular calcium in vitro and arrhythmias in vivo. P 2 E T J o TXA2R is a G-protein coupled receptor that has been well characterized to activate urn a ls o phospholipase C and induce increases in inositol trisphosphate (IP ) (Baldassare et al., n 3 M a rc 1993; Dorn and Becker, 1993; Walsh et al., 2000). IP3 is a well known byproduct from h 1 3 , 2 0 the enzymatic cleavage of phosphatidylinositol 4,5-bisphosphate (PIP ), acts as an 2 2 3 intracellular signaling molecule that binds to IP receptors (IP R), and releases calcium 3 3 from intracellular stores. Importantly, the role of IP in inducing arrhythmias and other 3 cardiac pathologies has become an increasingly important research area in cardiac muscle physiology (Kockskamper et al., 2008). Therefore, we wanted to investigate if IP and IP receptors (IPR) play a role in TXA R-mediated ventricular arrhythmias. 3 3 2 6 JPET Fast Forward. Published on September 9, 2009 as DOI: 10.1124/jpet.109.157677 This article has not been copyedited and formatted. The final version may differ from this version. JPET #157677 To test our hypothesis, the current study builds on the previous in vivo model of TXA -induced ventricular arrhythmias that we have established (Wacker et al., 2006) 2 and utilizes in vitro calcium imaging experiments with primary cardiac myocytes. Gentamicin and 2-aminoethoxydiphenyl borate (2-APB) have been previously used to inhibit the formation of IP and block IP Rs respectively in other models and are suitable 3 3 for use for in vivo studies. Therefore, we used these inhibitors of the IP pathway to test 3 the role of IP in actions of U46619 in our experiments. We found that both gentamicin D 3 o w n lo and 2-APB inhibited the U46619-induced increases in intracellular calcium in vitro and a d e d the U46619-mediated arrhythmias in vivo. Thus our data support the hypothesis that from jp e TXA can induce arrhythmias via direct stimulation of cardiac myocytes via a t.a 2 sp e tjo mechanism involving IP3. This is a potentially novel mechanism of arrhythmogenesis urn a ls .o and may provide a new therapeutic target for the treatment of arrhythmias. rg a t A S P E T J o Methods: u rn a ls o RT-PCR n M a rc All experimental protocols and procedures using animals in this investigation h 1 3 , 2 0 were reviewed and approved by the Institutional Animal Care and Use Committee 2 3 (IACUC) and carried out in accordance with the Guide for the Care and Use of Laboraory Animals as adopted and promulgated by the U.S. National Institutes of Health. Samples were taken from 4 kg, euthanized, male, New Zealand White rabbits. RNA from atria and ventricles of three rabbits were extracted using the RNeasy Fibrous Tissue Kit (Qiagen; Valencia, CA). RT-PCR was performed on mRNA isolated from 20 7 JPET Fast Forward. Published on September 9, 2009 as DOI: 10.1124/jpet.109.157677 This article has not been copyedited and formatted. The final version may differ from this version. JPET #157677 mg of tissue following the protocol of the Superscript III RT-PCR kit (Invitrogen; Carlsbad, CA). TXA R primer sets were as follows: GCTGGTGCTCAACACCGTGA 2 (forward) and CGTCAGCGCGATGAAGAC (reverse). These primers have been previously used by our laboratory, were designed to span an exon-exon junction, and are expected to yield a product size of 277 bp based on previous sequencing data (Wacker et al., 2005). Western Blot D o w n lo Clamp-frozen atria and ventricular muscles from three rabbits were homogenized a d e d in a 12:1 (volume/weight) ratio of ice-cold cell extraction buffer (Invitrogen) with protease from jp μ e inhibitor cocktail (500 L, Invitrogen), sodium fluoride (200 mM), sodium orthovanodate t.a s p e tjo (200 mM), and phenylmethanesulphonylfluoride (200 mM) added. Homogenized urn a ls .o samples were rotated for 30 min and then centrifuged for 20 min at 3000 x g at 4°C. rg a t A S Samples were diluted (1:1800) and total protein concentration of the samples was P E T J o determined using the micro bicinchoninic acid protein assay (Pierce; Rockford, IL). u rn a ls Samples were prepared in 5x Laemmli buffer containing 100 mM dithiothreitol and on M a heated at 85°C for 5 min. Next 60 μg of protein was subjected to SDS-PAGE (12% gel) rch 1 3 , 2 0 followed by a wet transfer to a PVDF membrane for 90 min (200 mA/tank). Membranes 2 3 were blocked for 1 hr at room temperature in Tris-buffered saline, 0.1% Tween 20 (TBST)-5% nonfat dry milk followed by an overnight incubation at 4°C with the primary antibody (P-20, sc-31260, Santa Cruz) at a concentration of 1:250 in TBST-1% milk. Following three 5 minute rinses in TBST, blots were incubated in TBST 1%-nonfat dry milk with a Cy3 donkey anti-goat secondary antibody (705-165-147, Jackson 8 JPET Fast Forward. Published on September 9, 2009 as DOI: 10.1124/jpet.109.157677 This article has not been copyedited and formatted. The final version may differ from this version. JPET #157677 ImmunoResearch; West Grove, PA) at a concentration of 1:250 for 1 hr at room temperature. Visualization of the protein bands was performed using a florescent imager (GE Healthcare Bio-Sciences Corp.; Piscataway, NJ). Isolation of primary, ventricular cardiac myocytes Rabbit hearts were isolated and immediately attached to a Langendorf perfusion apparatus. Four hundred ml calcium free Hanks Buffered Salt Solution (HBSS; Invitrogen) with heparin was pumped through the heart. HBSS with collagenase type II D o w n lo (2 mg/ml; Worthington Biochemical; Lakewood,NJ ), penicillin, streptomycin, and L- a d e d glutamine was then pumped through the heart for 25 min. or until the heart appeared from jp e soft. The heart was then sliced into pieces of approximately 2-3 mm3 and placed in t.a s p e tjo wash buffer composed of HBSS, penicillin, and streptomycin. If needed, additional urn a ls .o digestion of heart pieces in collagenase was carried out. An underlay of 5% bovine rg a t A S serum albumin, 47.5% Delbecco’s Modified Eagles Medium (Sigma; St. Louis, MO), and P E T J o 47.5% HBSS without calcium was placed below the wash solution and cells were u rn a ls o allowed to gravity filtrate for 10 min. The underlay containing myocytes was then gently n M a rc pipetted on to laminin pretreated plates. After 2 hours of incubation (37°C, 5% CO ) h 2 1 3 , 2 0 myocytes were washed and plated in HBSS with calcium for 30 min. for use in single- 2 3 cell RT-PCR or calcium imaging. Single Cell RT-PCR Protocols for isolating single cardiac myocytes were followed similar to protocols that we have published in single cell isolation of neurons (Wacker et al., 2005). Five individual cardiac myocytes were separately placed in 5 tubes containing SSIII RT-PCR 9 JPET Fast Forward. Published on September 9, 2009 as DOI: 10.1124/jpet.109.157677 This article has not been copyedited and formatted. The final version may differ from this version. JPET #157677 buffer which had primer sets for cardiac troponin T: GAGGAGGAGGAGCTGGTTTC (forward) and CGCCTCCAGGTTATAGATGC (reverse) and TXA R: (forward previously 2 listed) and CAAGATCTGGTTCCAGGTGGC (reverse). The RT step was carried out at 55° C for 20 min. and 35 cycles of PCR were conducted. One ul was then removed from the reaction and placed into 2 tubes containing PCR buffer for a second round of PCR. One tube contained nested primers for TNT: CAAGGACAGGATCGAGAAGC (forward) and CCTTCTCCCTCAGCTGATCTT (reverse) and the other tube contained nested D o w n lo primers for TXA R: ACGCTCTGCCGCGTCTACCA (forward) and a 2 d e d CCACGCGGAGGTAGATGAG (reverse). The expected product size for TNT was 323 from jp e bp and for TXA R was 229. PCR products were run on a 1.8% ethidium bromide t.a 2 sp e tjo agarose gel and visualized using a commercially available UV system (Kodak; urn a ls .o Rochester, NY). This protocol was conducted in three separate hearts. rg a t A S Drugs: P E T J o u The stable TXA R agonist, U46619 (C H O ; Cayman Chemical; Ann Arbor, rn 2 21 34 4 a ls o n MI), was dissolved in ethanol to a concentration of 7.13 mM. SQ29548 (C H N O ; M 21 29 3 4 a rc h Cayman), was dissolved in ethanol to a concentration of 6.45 mM. Gentamicin 1 3 , 2 0 2 (C H N O ; Sigma) was prepared in deionized water at a concentration of 104.7 mM. 3 21 43 5 7 2-APB (C H BNO; Cayman) was dissolved in ethanol to a concentration of 22.21 mM. 14 16 For in vitro cell imaging experiments, U46619, gentamicin, and 2-APB stock solutions were further diluted in HBSS with calcium on the day of the experiment to make lower concentration working stock solutions. Calcium Imaging: 10