Logout succeed
Logout succeed. See you again!

Using workflows for genomic ancestry analysis PDF
Preview Using workflows for genomic ancestry analysis
Using HTC for genomic ancestry analysis Megan Frayer Ph.D. Student, Genetics July 21, 2017 Genetics of Speciation The house mouse hybrid zone can tell us about how speciation is proceeding between these subspecies M. m. domesticus M. m. musculus The house mouse hybrid zone can tell us about how speciation is proceeding between these subspecies M. m. domesticus M. m. musculus ATCGTCAGTCAGTCGATCGATACGTAGCATGCAGTACGATGCAGTACGATGATACG TAGCAGTCAGACACGTAGCTATGCATCGTACGTCATGCTACGTCATGCTACTATGC DAG for Junction Inference Phase the Create the Run the source input files inference population and panels analysis chr1.dag SPLICE beagle.dag Create Inputs Population 1 Population 2 Population 3 Population 4 Create Next DAG SUBDAG_EXTERNAL inputs.dag Split Chromosome into Pieces Piece 1 Piece 2 Piece 3 Piece 4 Piece 5 Piece n Recombine the Output Files Run Inference Program Analyze the Output chr1.dag SPLICE beagle.dag Create Inputs Population 1 Population 2 Population 3 Population 4 Create Next DAG SUBDAG_EXTERNAL inputs.dag Split Chromosome into Pieces Piece 1 Piece 2 Piece 3 Piece 4 Piece 5 Piece n Recombine the Output Files Before HTC: 72 hours/test Run Inference Program 57 days/19 tests With HTC: 14 hours/test 4 days/19 tests Analyze the Output 57 days 4 days Parameter grid search • What is the combination of input parameters with the highest likelihood? Parameter grid search Parameter Values to be tested defaultRate 0.8 0.86 0.99 1.15 timeSince Admixture 1000 3750 6500 9250 12000 14750 ancestryProp1 0.4 0.5 0.6 ancestralRate1 41000 69250 97500 ancestralRate2 14000 23650 33290 20815 35158 49500 mutation1 1E-04 1E-05 1E-06 1E-07 1E-08 mutation2 3.4E-05 3.4E-06 3.4E-07 3.4E-08 3.4E-09 5.1E-05 5.1E-06 5.1E-07 5.1E-08 5.1E-09 miscopyRate 0.01 0.001 1E-04 1E-05 1E-06 Miscopy Mutation 0.01 0.001 1E-04 1E-05 1E-06 108,000 combinations of parameters to be tested