loading

Logout succeed

Logout succeed. See you again!

ebook img

Validation of IMP dehydrogenase inhibitors in a mouse model of cryptosporidiosis PDF

pages45 Pages
release year2013
file size0.96 MB
languageEnglish

Preview Validation of IMP dehydrogenase inhibitors in a mouse model of cryptosporidiosis

AAC Accepts, published online ahead of print on 23 December 2013 Antimicrob. Agents Chemother. doi:10.1128/AAC.02075-13 Copyright © 2013, American Society for Microbiology. All Rights Reserved. 1 Validation of IMP dehydrogenase inhibitors 2 in a mouse model of cryptosporidiosis 3 4 Running Title: In vivo antiparasitic activity of CpIMPDH inhibitors 5 D o w 6 Suresh Kumar Gorla1, Nina N. McNair2, Guangyi Yang3, Song Gao3, Ming Hu3, Venkatakrishna n lo 7 R. Jala4, Bodduluri Haribabu4, Boris Striepen 5, Gregory D. Cuny3,6, Jan R. Mead2 and Lizbeth ad e d 8 Hedstrom1,7 # f r o 9 m h t 10 tp : / / 11 1 Departments of Biology and 7Chemistry, Brandeis University, 415 South St., Waltham, MA a a c . 12 02454 a s m 13 2 Atlanta VA Medical Center and Department of Pediatrics, Emory University School of . o r g 14 Medicine, Atlanta, GA 30322 / o n 15 3 Department of Pharmacological and Pharmaceutical Sciences, College of Pharmacy, A p r 16 University of Houston, Houston, TX 77204 il 1 3 17 4 Department of Microbiology & Immunology, University of Louisville, School of Medicine, , 2 0 18 Louisville, KY 40202 1 9 19 5 Center for Tropical and Emerging Global Diseases and Department of Cellular Biology, by g 20 University of Georgia, Athens, GA 30602 u e s 21 6 Laboratory for Drug Discovery in Neurodegeneration, Brigham & Women’s Hospital and t 22 Harvard Medical School, Cambridge, MA 02139 23 24 25 # to whom correspondence should be addressed: [email protected] 26 Abstract 27 28 Cryptosporidium parasites are a major cause of diarrhea and malnutrition in the developing 29 world, a frequent cause of waterborne disease in the developed world and a potential 30 bioterrorism agent. Currently available treatment is limited and Cryptosporidium drug discovery D 31 remains largely unsuccessful. As a result, the pharmacokinetic properties required for in vivo o w n 32 efficacy have not been established. We have been engaged in a Cryptosporidium drug lo a d 33 discovery program targeting inosine 5’-monophosphate dehydrogenase (CpIMPDH). Here we e d f 34 report the activity of eight potent and selective inhibitors of CpIMPDH in the IL-12 knockout ro m 35 mouse model, which mimics acute human cryptosporidiosis. Two compounds displayed h t t p 36 significant antiparasitic activity, validating CpIMPDH as a drug target. The best compound, : / / a a 37 P131 (250 mg/kg-day), performed equivalently to paromomycin (2000 mg/kg-day) when c . a 38 administered in a single dose, and better than paromomycin when administered in three daily s m . o 39 doses. One compound, A110, appeared to promote Cryptosporidium infection. The r g / 40 pharmacokinetic, uptake and permeability properties of the eight compounds were measured. o n A 41 P131 had the lowest systemic distribution, but accumulated to high concentrations within p r il 42 intestinal cells. A110 had the highest systemic distribution. These observations suggest that 1 3 , 43 systemic distribution is not required, and may be a liability, for in vivo antiparasitic activity. 2 0 1 44 Intriguingly, A110 caused specific alterations in fecal microbiota that were not observed with 9 b y 45 P131 or vehicle alone. Such changes may explain how A110 promotes parasitemia. g u e 46 Collectively, these observations suggest a blueprint for the development of anticryptosporidial s t 47 therapy. 48 49 2 50 Introduction 51 52 Cryptosporidium parasites, especially C. parvum and C. hominis, are frequent causes of 53 diarrheal disease (1-4). Cryptosporidium oocysts are highly resistant to most methods of water 54 treatment, so outbreaks occur with regularity even in the developed world. In fact, D 55 Cryptosporidium was identified as the cause of 87% of cases of waterborne illness in the US in o w n 56 2007 (5). Disease is self-limiting in healthy adults, but can be chronic and fatal in lo a d 57 immunocompromised individuals. Small children, especially infants, are also highly susceptible. e d f 58 The recent GEMS epidemiological study found Cryptosporidium second only to rotavirus as a ro m 59 cause of childhood diarrhea (6). Cryptosporidium was highly associated with moderate to h t t p 60 severe diarrhea and death in infants over the study period. Cryptosporidium infection can also : / / a a 61 cause an unrecoverable growth deficit in young children, making these parasites a major cause c . a 62 of the “vicious cycle” of diarrhea and malnutrition in the developing world (7). C. parvum s m . o 63 oocysts can be obtained with relative ease, and the water supply is readily accessed, so there is r g / 64 also a credible concern that these organisms could be used maliciously (8). The 1993 natural o n A 65 Milwaukee outbreak illustrates the potential damage of such an act of bioterrorism: p r il 66 contaminated drinking water resulted in approximately 403,000 cases of disease, the 1 3 , 67 hospitalization of 4,400 patients and an estimated 69 deaths (9). 2 0 1 68 9 b y 69 Although hundreds of antiparasitic and antimicrobial drugs have been evaluated for g u e 70 anticryptosporidial activity, the current treatment options are limited to one approved drug, s t 71 nitazoxanide, which hastens the resolution of symptoms in immunocompetent patients (10). 72 Nitazoxanide is less efficacious in malnourished children and shows no benefit in 73 immunocompromised patients (11). Importantly, the target of nitazoxanide is undefined in 74 Cryptosporidium, so no clinically validated targets exist for the treatment of cryptosporidiosis 3 75 (12). Paromomycin is effective in rodents and has also been used to treat cryptosporidiosis, 76 though a significant benefit has not been demonstrated in humans (13). Approximately twenty 77 additional compounds have displayed at least some anticryptosporidial activity in animal models 78 (14-26). Unfortunately, like nitazoxanide, the targets of most of these compounds have not 79 been identified, which makes further development difficult. Several promising targets have D 80 emerged with the sequencing of the C. parvum and C. hominis genomes (27-37), but only two o w 81 target-based drug discovery programs have reported activity in an animal model (26, 37). n lo a 82 Adding to the challenge, given the limited efficacy of these compounds, the pharmacokinetic d e d 83 and physicochemical properties required for in vivo efficacy have not been established. Clearly f r o m 84 new strategies are needed to combat cryptosporidiosis in immunocompetent and especially h t t 85 immunocompromised patients. p : / / a 86 a c . a 87 Cryptosporidium spp. are obligate intracellular parasites (38, 39). Infections can occur when s m 88 as few as 1-10 oocysts are ingested. Oocysts release sporozoites in the intestine, where .o r g 89 infections are predominately localized to the jejunum and ileum, but can extend to other parts of / o n 90 the gastrointestinal tract in immunocompromised patients. Biliary and other organ involvement A p r 91 also occurs in approximately 20% of immunocompromised patients (39-41). The parasite il 1 3 92 resides within a parasitophorous vacuole that protrudes out of the host cytoplasm into the , 2 0 1 93 intestinal lumen. The routes of nutrient and drug uptake, whether direct from the intestinal 9 b 94 lumen or via the host cell, are largely unknown. Unfortunately, Cryptosporidium parasites y g u 95 cannot be cultured continuously in vitro and genetic tools do not yet exist to construct transgenic e s t 96 reporter parasites that would greatly facilitate screening efforts. Tissue culture models of 97 Cryptosporidium infection provide an imperfect window to measure drug effects and certainly do 98 not recapitulate the complex environment of the gastrointestinal tract, which includes a myriad 99 of commensal organisms that may influence infection (42). Several animal models exist that 100 mimic either acute or chronic human disease, though these generally require 4 101 immunosuppression to permit Cryptosporidium infection. These conditions constrain drug 102 discovery efforts. 103 104 We have been engaged in a program to develop inhibitors of C. parvum IMPDH (CpIMPDH) 105 as potential treatment for cryptosporidiosis. This enzyme is a promising target because D 106 Cryptosporidium relies on CpIMPDH for the biosynthesis of guanine nucleotides (note that C. o w 107 hominis contains the identical enzyme and the same guanine biosynthetic pathway; (27-29)). n lo a 108 Moreover, the CpIMPDH gene was obtained from an ε-proteobacterium by lateral gene transfer, d e d 109 and thus is very different from host IMPDHs (30, 43). We have developed several structurally f r o m 110 distinct classes of CpIMPDH inhibitors, achieving nanomolar potency and selectivity in excess h t t 111 of 1000-fold versus the human enzymes (44-50). Here we report the antiparasitic activity of our p : / / a 112 eight most promising compounds in the IL-12 knockout mouse model. Infection is confined to a c . a 113 the intestine in this model, and resolves in two weeks, which is similar to acute human s m 114 cryptosporidiosis (51). One compound, P131, displays greater antiparasitic activity than .o r g 115 paromomycin, validating CpIMPDH as a target. Our results also provide insights into the / o n 116 properties required for anticryptosporidial activity. A p r 117 il 1 3 118 Materials and Methods , 2 0 1 119 9 b y 120 Materials. Compounds were synthesized as previously described (45, 48, 50). Properties g u e 121 were calculated using ChemBioDraw Ultra version 12.0.3.1216 (www.cambridgesoft.com). s t 122 123 Cell culture model of C. parvum infection. In vitro evaluation was performed as described 124 previously (52). C. parvum oocysts were kindly supplied by Dr. Michael Arrowood (Centers for 125 Disease Control and Prevention). C. parvum oocysts (IOWA bovine isolate) were collected, 5 126 purified through discontinuous sucrose and cesium chloride gradients and stored as previously 127 described (53). Before use, purified C. parvum oocysts were washed free of 2.5% aqueous 128 potassium dichromate (K Cr O , a storage buffer) with phosphate-buffered saline (PBS, pH 7.4). 2 2 7 129 Oocysts were then resuspended in Dulbecco's modified Eagle's medium (DMEM) base with 130 0.75% sodium taurocholate and incubated for 10 min at 37°C. The excystation mixture was D 131 diluted with Ultraculture™ medium (BioWhittaker Inc., Walkersville, MD) and approximately 1 × o w 132 105 oocysts and sporozoites were allowed to infect confluent human ileocecal adenocarcinoma n lo a 133 epithelial cells (HCT-8) or Madin-Darby canine kidney cells (MDCK). The monolayer was d e d 134 washed with PBS after 3 h and incubated with fresh Ultraculture™ medium with or without test f r o m 135 compounds, Inhibitor and media were refreshed after 24 h and the parasites were cultured for a h t t 136 total of 48 h. Cultures are fixed and counted using an anti-C. parvum fluorescein-labeled p : / / a 137 monoclonal antibody (C3C3-FITC) or a high content imaging assay (54). The values of EC50 a c . a 138 were calculated using the Hill-Slope model (eq1) using Prism v5 (GraphPad Software Inc., La s m 139 Jolla, CA): .o r g 140 %Growth = (Max-Min)/(1+(EC /[I])n) eq1 / 50 o n 141 where n is the Hill coefficient. A p r 142 il 1 3 143 In vivo toxicity evaluation. Compound toxicity was evaluated at 250 mg/kg in uninfected , 2 0 1 144 C57BL/6 mice treated for 7 days (5 mice/group). Toxicity was assessed by weight loss and 9 b 145 signs of distress (e.g. ruffled fur, hunched shoulders and decreased appetite). No overt signs of y g u 146 toxicity were observed for any of the compounds. No significant changes in weight were e s t 147 observed between treated and vehicle control. 148 149 Mouse model of C. parvum infection. The anticryptosporidial activity of the CpIMPDH 150 inhibitors was assessed in the IL-12 knockout mouse model that resembles the acute human 151 disease (51, 55). The protocol was approved by the Institutional Animal Care and Use 6 152 Committees of Emory University, Atlanta VA Medical Center and Brandeis University. Mice (6- 153 10 per group) were inoculated with 1,000 purified C. parvum oocysts (Iowa isolate, from cattle). 154 Treatment by gavage began 4 h post infection with either vehicle (5% DMSO in corn oil), 250 155 mg/kg compound or 2000 mg/kg paromomycin. Compounds were given for 7 days and mice 156 sacrificed on day 8 (peak infection). Parasite load was quantified by FACS assays for the D 157 presence of the oocysts in the feces at days 0, 4 and 7. Fecal pellets from individual mice were o w 158 routinely collected daily and homogenized in adjusted volumes of 2.5% potassium dichromate. n lo a 159 Samples were processed individually. Aliquots (200 µl) of vortexed samples were processed d e d 160 over micro-scale sucrose gradients as previously described (56). The oocyst-containing fraction f r o m 161 was collected, washed and treated with monoclonal antibody (OW5O-FITC) for 20 min. h t 162 Samples were adjusted to 600 µl and a portion (100 μl) was assayed with a 102-s sampling tp : / / a 163 interval using logical gating of forward/side scatter and OW5O-FITC fluorescence signal on a a c . a 164 Becton Dickinson FACScan flow cytometer (57). Flow cytometry data were evaluated by s m . 165 analysis of variance (KaleidaGraph, Synergy Software, Reading PA; Microsoft Excel; Microsoft o r g / 166 Corporation, Redmond, WA). o n 167 A p r 168 Pharmacokinetics. PK was assessed at either the Stony Brook Translation Experimental il 1 3 , 169 Laboratory Therapeutics (Stony Brook, NY) or GVK Biosciences (Hyderabad, India). C57BL/6 2 0 1 170 mice (12 per analysis) were treated with a single dose of 250 mg/kg compound in 5% DMSO 9 b 171 corn oil by oral gavage. Plasma samples were collected from 3 mice pre-dose and 0.25, 0.5, 1, y g u 172 2,4, 6 and 24 h after administration. Two samples were collected from each mouse. Samples e s t 173 were analyzed by LC/MS/Ms on a Thermo TSQ Quantum Access (Thermo-Fisher) triple 174 quadrupole mass spectrometer. 175 176 Tissue concentrations of P131. C57BL/6 and IL12 knockout mice were treated with three 177 daily doses of 83 mg/kg P131 in 5% DMSO corn oil by oral gavage. Tissues were collected 24 7 178 h after the initial dose and stored in -80°C. Before analysis, the tissues were thawed, weighed, 179 and transferred into a 12 × 75 mm heavy wall glass test tube. A methanol solution (1.0 mL) 180 containing internal standard (0.5 µM of formononetin) was added to the test tube. The tissue 181 was processed (about 20 s) with Tissue TearorTM (Biospec Products, Bartlesville, OK) into a 182 homogeneous mixture and transferred carefully into a 1.5 mL microcentrifuge tube. The tube D 183 was washed twice (200 µL each) with methanol. All solutions were then combined in the o w 184 centrifuge tube and centrifuged for 15 min at 15,500 rpm. Then, 1.0 mL of supernatant was n lo a 185 taken out and dried under nitrogen. The residual was reconstituted in 200 µL of methanol. A d e d 186 standard curve was prepared in blood with the same procedure, and this curve was used for f r o m 187 quantification of P131 in blood and tissues. h t t p 188 :/ / a a 189 Cell culture. Caco-2 TC7 cells were originally a gift of Prof. Monique Rousset of c . a s 190 INSERMU178 (Villejuif, France). Briefly, a cell monolayer was prepared by seeding 250,000 m . o 191 cells per insert (Nunc, surface area=4.2 cm2, 3 μm pore size). Cells were maintained at 37 °C r g / o 192 under 90% humidity and 5% CO2. Monolayers were used between 19 and 22 days after n A 193 seeding. The integrity of each monolayer was checked by measuring the transepithelial p r il 194 electrical resistance (Millicell- ERS) before the experiment. The normal TEER values obtained 1 3 , 195 were between 500 and 750 Ω3 cm2. Cell monolayers with TEER values of<500 Ω3 cm2 were 20 1 9 196 not used. HBSS (9.8 g/mL) supplemented with NaHCO3 (0.37 g/L), HEPES (5.96 g/L), and b y 197 glucose (3.5 g/L) was used for all experiments after the pH had been adjusted to a desired g u e 198 value. Cells were used at passages 41-49. s t 199 200 Transport experiments using the Caco-2 cell culture model. The experiment protocol 201 and calculation were described in our previous reports (58). Briefly, a HBSS solution containing 202 the compound(s) of interest was loaded onto the apical or basolateral (donor) side. Five donor 8 203 samples (500 µL) and five receiver samples (500 µL) were taken at 0, 1, 2, 3, and 4 h followed 204 by the addition of 500 µL of fresh donor solution to the donor side or 500 µL of fresh buffer to 205 the receiver side. The samples were then analyzed by UPLC-MS/MS. The apparent 206 permeability coefficient (P) was determined by the equation 207 P = (dQ/dt) /(A × C ) o D 208 where dQ/dt is the drug permeation rate (µmol/s), A is the surface area of the epithelium (cm2), o w 209 and C is the initial concentration in the donor compartment at time 0 (mM). n o lo a 210 d e d 211 Uptake experiments. The uptake of tested compounds was determined according to our f r o m 212 previous protocol (58). Briefly, after the transport study, the cell membranes were rinsed three h t t 213 times with ice-cold HBSS, pH=7.4. The cells attached to the polycarbonate membranes were p : / / a 214 cut off from the inserts with a sharp blade. The latter was immersed into 1 mL of HBSS and a c . a 215 sonicated for half an hour at low temperature (iced water bath) to break up the cells. The s m 216 mixture was centrifuged at 15,000 rpm for 15 min, and 500 µL of the supernatant was taken, .o r g 217 which was subjected to LC-MS analysis as described in Table S2. / o n 218 A p r 219 DNA isolation and microbiota sequencing. Fecal samples from 30 individual mice il 1 3 220 (uninfected IL-12 knockout mice) were freshly collected and stored at -20 °C prior to treatment , 2 0 1 221 (Day 0). Mice were randomly assigned to three groups (10/group) and treated with either 9 b 222 vehicle alone, A110 or P131 (250 mg/kg-day in 5% DMSO/corn oil). The fresh fecal pellets y g u 223 were from each individual mouse were collected into sterile effendorf tubes at day 0 (prior to e s t 224 treatment) and day 7 (after 7 days of treatment) and stored at -20 °C. The total genomic DNA 225 was isolated from individual fecal pellets using the Maxwell automated DNA isolation method as 226 implemented in a Promega genomic DNA isolation kit. The 16S rRNA genes were amplified 227 using individual genomic DNA template with the universal primer pair 27f 9 228 (AGAGTTTGATCCTGGCTCAG) and 534r (ATTACCGCGGCTGCTGG), which produce an 229 amplicon containing variable regions V1-V3. The primers were anchored with adapters and 230 barcodes to identify each sample in a multiplexed 454 sequencing reaction. PCR amplification 231 was performed with a FastStart Hifidelity PCR system (Roche) using 0.5 µM primer 232 concentrations. The PCR cycling conditions were 95 ºC for 5 min, followed by 30 cycles of 94 D 233 ºC for 30 sec, 56 ºC for 30 sec, and 72 ºC for 1 min and 30 sec with a final extension period of 8 o w 234 min at 72ºC. Each PCR reaction was performed in triplicate and pooled for gel purification. The n lo a 235 PCR amplicon products were pooled and purified using QIAGEN gel purification columns. The d e d 236 amplicon pool was quantified using a QuatiT Picogreen kit (Invitrogen). The pooled purified f r o m 237 amplicons were sequenced using a 454Roche Jr instrument according to manufacturer’s h t t 238 protocols. p : / / a 239 a c 240 Microbiota sequence analysis: The bacterial 16S rRNA gene sequence analysis was .a s m 241 performed using the QIIME pipeline (QIIME 1.6.0, www.qiime.org) developed and maintained . o r g 242 by the Knight group (59). Briefly, the quality sequences (200-650 bp lengths) were / o n 243 demultiplexed based on their barcodes. The 16S rRNA Operational Taxonomic Units (OTUs) A p 244 were picked based on 97% sequence identity using UCLUST (60) against the GreenGenes 16S ril 1 3 245 rRNA database (http://greengenes.lbl.gov/cgi-bin/nph-citation.cgi) (gg_otus-12_10) (61). The , 2 0 246 GreenGene taxonomies were used to generate the taxa summaries at different levels of 1 9 b 247 phylogeny (phylum, order, class, family, genus and species). Each OTU was represented by a y g 248 single sequence that was aligned by Python Nearest Alignment Space Termination (PyNAST; u e s t 249 (62)) for phylogenetic tree-based analyses. To standardize the sequences across the samples 250 with uneven sampling, the sequences were rarified at 1000 randomly selected sequences per 251 sample. The phylogenetic tree was built with FastTree (63). The beta-diversity (diversity 252 between the samples) was measured using both weighted and unweighted UniFrac 10

See more

The list of books you might like