loading

Logout succeed

Logout succeed. See you again!

ebook img

Variable Bone Fragility Associated With an Amish COL1A2 Variant and a Knock-in Mouse Model PDF

pages15 Pages
release year2010
file size0.42 MB
languageEnglish

Preview Variable Bone Fragility Associated With an Amish COL1A2 Variant and a Knock-in Mouse Model

JJBMR ORIGINAL ARTICLE Variable Bone Fragility Associated With an Amish COL1A2 Variant and a Knock-in Mouse Model Ethan Daley,1 Elizabeth A Streeten,2 John D Sorkin,3 Natalia Kuznetsova,4 Sue A Shapses,5 Stephanie M Carleton,6 Alan R Shuldiner,2,3 Joan C Marini,4 Charlotte L Phillips,6 Steven A Goldstein,1 Sergey Leikin,4 and Daniel J McBride Jr2 1OrthopaedicResearchLaboratories,DepartmentofOrthopaedicSurgery,UniversityofMichigan,AnnArbor,MI,USA 2DivisionofEndocrinology,Diabetes&Nutrition,UniversityofMarylandBaltimore,Baltimore,MD,USA 3DivisionofGerontology,UniversityofMarylandBaltimoreandtheBaltimoreVAMedicalCenter,GeriatricResearch,Educationand ClinicalCenter(GRECC),Baltimore,MD,USA 4NationalInstituteofChildHealthandHumanDevelopment,NationalInstitutesofHealth,Bethesda,MD,USA 5DepartmentofNutritionalSciences,RutgersUniversity,NewBrunswick,NJ,USA 6DepartmentofBiochemistry,UniversityofMissouri–Columbia,Columbia,MO,USA ABSTRACT Osteogenesis imperfecta (OI) is a heritable form of bone fragility typically associated with a dominant COL1A1 or COL1A2 mutation. VariablephenotypeforOIpatientswithidenticalcollagenmutationsiswellestablished,butphenotypevariabilityisdescribedusingthe qualitativeSillenceclassification.PatterninganewOImousemodelonaspecificcollagenmutationthereforehasbeenhinderedbythe absenceofanappropriatekindredwithextensivequantitativephenotypedata.WebenefitedfromthelargesibshipsoftheOldOrder Amish(OOA)todefineawiderangeofOIphenotypesin64individualswiththeidenticalCOL1A2mutation.Stratificationofcarrierspine (L1–4)arealbonemineraldensity(aBMD)Z-scoresdemonstratedthat73%hadmoderatetoseveredisease(lessthan(cid:1)2),23%hadmild disease((cid:1)1to(cid:1)2),and4%wereintheunaffectedrange(greaterthan(cid:1)1).Alineofknock-inmicewaspatternedontheOOAmutation. Bone phenotype was evaluated in four F lines of knock-in mice that each shared approximately 50% of their genetic background. 1 Consistentwiththehumanpedigree,thesemicehadreducedbodymass,aBMD,andbonestrength.Whole-bonefracturesusceptibility wasinfluencedbyindividualgenomicfactorsthatwerereflectedinsize,shape,andpossiblybonemetabolicregulation.Theresults indicatethattheG610COI(Amish)knock-inmouseisanoveltranslationalmodeltoidentifymodifyinggenesthatinfluencephenotype andfor testingpotential therapies forOI. (cid:1) 2010AmericanSociety for Boneand MineralResearch. KEYWORDS: OSTEOGENESISIMPERFECTA;BONE;COLLAGEN;KNOCK-IN;RODENT Introduction COL1A2mutationshavebeenidentifiedinOIpatients,withmany examples of recurrent mutations in unrelated individuals.(3) Osteogenesis imperfecta (OI) is a heritable form of bone However, there are no large pedigrees with quantitative fragility with an overall spectrum of disease severity that phenotype datafor OIpatients with theidenticalmutation. ranges from a perinatal lethal form to mild disease that can The predominant type I collagen isotype in the extracellular remain clinically silent.(1–3) Multiple fractures is the principal matrix(ECM)isaheterotrimericmoleculecomprisedoftwoa1(I) clinicalpresentationthatbringsOIpatientstomedicalattention. chains and one a2(I) chain. A homotrimeric isotype of type I Additional phenotype traits can include bone deformity (e.g., collagen,comprisedofthreea1(I)chains,isalsofoundintissues long bone bowing), short stature, blue sclerae, dentinogenesis insmallamountsinthenonpathologicstate.Thehomotrimeric imperfecta(DI),andhearingloss.SillenceoriginallyclassifiedOI isotypeisassociatedwithautosomalrecessiveconnectivetissue into types I to IV on the basis of clinical presentation, disordersinhumanswhennoa2(I)chainsoronlynonfunctional radiographic features, and mode of inheritance.(4,5) OI types I a2(I) chains are synthesized.(6,7) The amino acid sequences of toIVtypicallyareassociatedwithheterozygousmutationsinthe both a1(I) and a2(I) chains are homologous and have a genes(COL1A1andCOL1A2)thatencodetheachainsoftypeI characteristic [Gly-X-Y]338 repeat within their respective triple- procollagen molecules. Currently, more than 800 COL1A1 and helical domains. The small side chains of glycine residues ReceivedinoriginalformMarch18,2009;revisedformMay20,2009;acceptedJuly6,2009.PublishedonlineJuly13,2009. Addresscorrespondenceto:DanielJMcBride,Jr.,642MontgomeryWoodsDrive,Hockessin,DE19707,USA.E-mail:[email protected] JournalofBoneandMineralResearch,Vol. 25,No.2,February2010,pp247–261 DOI:10.1359/jbmr.090720 (cid:1)2010AmericanSocietyforBoneandMineralResearch 247 positioned at every third position of the repeat are sterically (GGT)toacysteine(TGT)codon.(24)Wealsoreportthecreationof required for helix formation, and mutations in these glycine the first glycine-substitution knock-in Col1a2 mouse that residuesaccountfor80%oftheknowntriple-helicalmutations replicates the gene and protein phenotypes observed in the thatcause moderatelysevere tolethal formsof OI. OOAkindred.Theknock-inG610COI(Amish)mouserepresentsa Over the past two decades, several laboratories have uniquetranslationalmodelforevaluatingthemolecularbasisof developedmurineOImodelsbasedonmutationsintheproa1(I) phenotypevariabilityandtotestpotentialtherapeuticstrategies chain of type I collagen patterned after those described in forOI. humanOItoextendourunderstandingofOIpathobiology.All the existing mouse models have a moderate-to-severe bone phenotypewithimpairedviability.Thetwoearlymodelsofnote Materials and Methods are the Col1a1 null allele Mov-13 mice(8–10) and the ‘‘protein suicide’’ or collagen minigene model.(11–13) The homozygous Ethical considerations Mov-13 mouse produces no type I collagen, and this is lethal. Allhumansubjectresearchwasreviewedandapprovedbythe HeterozygousMov-13micedepositreducedamountsofnormal Institutional Review Board of the University of Maryland typeIcollagenintheECMthatisassociatedwithanosteopenic Baltimore (UMB). Informed consent was obtained for all study phenotypeandabnormalskeletalbiomechanics.Theminigene participants.Allanimalprocedureswerereviewedandapproved modelconstructexpressesaversionofthehumanCOL1A1gene by theUMBInstitutional Animal Careand UseCommittee. that is missing the central 41 exons that encode a significant portion of the triple-helical domain. The shortened human proa1(I) chains associate with normal murine proa1(I) and Recruitment of family members and phenotype proa2(I)chains,depletingtheamountofnormaltypeIcollagen assessment and altering ECM organization. Most recently, the Cre/lox recombination system was used to develop a Col1a1 G349C The study had three stages of informed consent: (1) mutation substitution to reproduce a human OI type IV (moderately screening, (2) clinical assessment, and (3) skin-biopsy harvest. severe) phenotype termed BrtlIV.(14–17) The BrtlIV mouse The screening enrollment age requirement of 6 years or older represented a major advance in OI mouse models because it was waived if one parent was mutation-positive by sequence istheonlyCol1a1 modelwith atriple-helicalglycinemutation. analysis. After obtaining informed consent (or assent from the The OI phenotype pattern of proa2(I) glycine substitutions children), buccal cells were harvested as a source of genomic appears to be different from proa1(I) substitution.(3) Generally, DNA (gDNA) for genotyping. All gDNA- and cDNA-derived proa2(I) mutations are less severe. They also may represent sequence data (see below) were analyzed, using Sequencher an easier target for treatment because only 50% of collagen software (GeneCodes, AnnArbor, MI,USA). moleculesareaffectedinCOL1A2heterozygotesversus75%in All volunteers verifiedbygDNAsequence analysistocarry a COL1A1 heterozygotes. However, the only reported mouse singlecopyoftheTallele(OIgroup)andtheircontrol(Gallele) modelforOIwithaCol1a2mutationisosteogenesisimperfecta- nuclear family members (age(cid:2)6 years) were invited to murine(oim).Homozygousoimmiceexhibitskeletaldiseasewith participate in the clinical assessment and skin-biopsy phases. clinical and biochemical features of Sillence type III (severe The phenotype assessment consisted of a medical and family progressive) OI. The oim mutation and its biologic conse- history, physical examination, blood draws for serum procolla- quences(18–21)arestrikinglysimilartothosefoundinaGerman gen type I C-terminal propeptide (PICP) and CrossLaps child with type III OI.(6,22,23) In both instances, a frame-shift measurements (markers of bone formation and resorption), mutation in the region of the COL1A2 gene that encodes the andmeasurementofarealbonemineraldensity(aBMD).Lumbar terminal portion of the proa2(I) C-propeptide predicts the spine (L1–4) and proximal femur (total and subregions) aBMD synthesis of nonfunctional proa2(I) chains. Despite being the wasmeasuredbydual-energyX-rayabsorptiometry(DXA)ona onlynaturallyoccurringOImousemodel,theoimmousehasa QDR 4500W instrument (Hologic, Bedford, MA, USA), and the rarely observed type of mutation and an atypical biochemical results reviewedby a singleclinician (EAS) and another author phenotypebecauseonlyproa1(I) homotrimericmoleculesare (DJM). The in vivo coefficient of variation for replicate aBMD 3 formed. measurementswas0.8%forthelumbarspine,0.9%fortotalhip, The absence of a COL1A2 murine OI model with autosomal and1.5%forthefemoralneck.TheHologicPediatricReference dominantinheritance,mildtomoderatedisease,andphenotype Curve Option (hip: 5 to 20 years; spine: 3 to 20 years) and variation represents a major gap in our tools to understand OI Caucasian reference (age>20 years) were used to obtain age- pathobiology and to develop effective treatment. Defining the specific Z-scores. Since OI is frequently associated with short molecularbasisofphenotypevariationalsohasbeenlimitedby stature and bone mineral content (BMC) and aBMD are the absence of large numbers of OI patients carrying the influenced by bone size, volumetric bone mass [bone mineral identicalcausativemutationwithquantitativephenotypedatato apparent density (BMAD)] also was estimated to minimize the useasaprototypeforanewOImousemodel.Herewereportthe influence of small bone size.(25,26) A subset of the phenotype clinical and biochemical phenotype of a COL1A2 gene variant assessment volunteers also provided 3mm dermal punch found among a Lancaster County, Pennsylvania, Old Order biopsies from the posterior upper arm from which fibroblasts Amish (OOA) kindred. This COL1A2 variant is a G-to-T werederivedandstoredatUMBand/orsubmittedtotheCoriell transversion at nucleotide 2098 that alters the gly-610 codon Institute (OIfamilies 1997,1998, 2187, and 2229). 248 JournalofBoneandMineralResearch DALEYETAL. Generation of knock-in mice glycerol buffer (pH 7.5) were recorded in a Nano II differential scanning calorimeter (Calorimetry Sciences Corp. Lindon, UT, Knock-inmicewerecreatedusingembryonicstemcellsandCre/ USA) at several different scanning rates. The apparent melting loxPtechnology.A13kbgenomicclonecontainingtherelevant temperature T was defined at the maximum of the melting segmentofthemurineCol1a2genewasisolatedfromalphage m peak after baseline subtraction. library constructed with gDNA of the 129Sv/Ev Taconic mouse Total RNA was extracted from fibroblast cultures, and cDNA strain. PCR site-directed mutagenesis was used to change the was synthesized using RACE1 [50-GAT GGA TCC TGC AGA AGC targeted codon from GGT to TGT. The Col1a2 G610C-positive (T)17-30]. An aliquot of cDNA and forward exon primer and embryonicstemcellswereinjectedintoblastocystsofC57BL/6J downstreamreverseexonprimer(selectedtocrossintron-exon) (B6)mice.Foundermicethatretaintheneotargetingvectorare boundaries were used for second-strand synthesis and PCR termedneoþorG610CNeomice.Progenyobtainedbybreeding amplification.PCRproductsoftheexpectedsizewereconfirmed a founder male with a female that expressed Cre recombinase by agarose gel size separation prior to purification for direct (JacksonLaboratory,BarHarbor,ME,USA,StockNumber003724) nucleotide sequencing. aretermedneo–orG610COImice.TheG610COImouselineis available to the research community through the Jackson Phenotype assessment of F G610C OI Mice Laboratory Mouse Repository (JaxStock Number:007248). 1 FourF strainsofG610COImicewereusedtodeterminethe aBMD measurements 1 effectofgeneticbackgroundonphenotypein2-month-oldmale The aBMDs of right femurs were measured by DXA (GE-Lunar mice. Incipient congenic G610C OI B6 ((cid:3)98% B6 genetic densitometer, PIXImus; software version; 2.10, GE Medical background)malebreedersweregeneratedbysixgenerations Systems, WI, USA). Femur measurements were obtained by of backcrosses to Jackson Laboratory B6 mice (Stock Number placing an excised femur on a Delrin block. The percent 000664). Experimental heterozygous B6 male breeders were coefficientofvariation(CV)was1.3%forBMCand1.4%forBMD. crossed with A/J (Stock Number 000646), BALB/cByJ (Stock Number001026),C3H/HeJ(StockNumber000659),andFVB/NJ Confocal Raman microspectroscopy (Stock Number 001806) females purchased from the Jackson Laboratory. Progeny of these crosses are designated, respec- Segments of cortical bone from the femur diaphysis were tively,asA.B6,Cby.B6,C3.B6,andFVB.B6.Experimentalmicewere embeddedinCryo-gel(Instrumedics,Inc.,St.Louis,MO,OSA)and housedatUMBinasinglespecific-pathogen-freeroomandwere cutlongitudinallynormaltothebonesurfaceonaCryo-CutOne exposedtoidenticalenvironmentalconditionsconsistingofa12 cryostat(Vibratome,Bannockburn,IL,USA).The30mmsections hour light/dark cycle, an ambient temperature of 238C, and were examined with a Senterra confocal Raman microscope adlibitumaccesstowaterandlaboratorymousechow.Genotype (Bruker Optics, Billerica, MA, USA). Raman spectra from 40 to wasassignedusingaPCRassaythatcandiscriminatethethree 4500cm(cid:1)1werecollectedwith9to18cm(cid:1)1resolutionusinga possible G610C OI mouse genotypes. The forward primer (TCC circularly polarized 20mW (9mW at the sample), 532nm laser CTGCTTGCCCTAGTCCCAAAGATCCTT)andthereverseprimer beam, X40/0.95 NA objective, and a 50mm confocal pinhole. (AAGGTATAGATCAGACAGCTGGCACATCCA)willgeneratea Thespectrawereacquiredat12pointsvisuallyselectedoutside 165bp (wild type) or a 337 and a 165bp (heterozygous) or a osteocytesalongtheperiostealtoendostealaxisinthemidplane 337bp(homozygous)PCRproductusingG610COImicegDNA. of the sections. The accumulation time for each point was All animalswere euthanizedby CO asphyxiation. 1minute.Themineralcontentofbonematrix(PO :CH),collagen 2 4 contentofbonematrix(amideIII:CH),andmineral:collagenratio Human and mouse collagen analysis (PO :amide III) were determined from the areas under n -PO 4 1 4 (integratedfrom901to987cm(cid:1)1),amideIII(1214to1305cm(cid:1)1), Pepsin-soluble collagen was purified from mouse tail tendons and CH (2824 to 3035cm(cid:1)1) Raman peaks. Relative collagen andhumanfibroblastculturemediumforanalysisbySDS-PAGE contentfromPro:CHratio(833to867cm(cid:1)1)wasconsistentwith and differential scanning calorimetry (DSC). Purified collagen thatevaluatedfromtheamideIII:CHratiobutlessaccurateowing samples were labeled by fluorescent monoreactive Cy5 NHS to low intensityof thePro peak. ester(GEHealthcareBio-SciencesCorp.,Piscataway,NJ,USA)or double-labeledbyCy5andfluorescentBODIPY-L-Cys(Molecular Femur mCT Probes,Invitrogen,Inc.,Carlsbad,CA,USA).(27)Labeledproteins weresize-separatedbySDS/PAGEonprecast3%to8%gradient Micro-computed tomography (mCT) was used to quantify Tris-acetateminigels(Invitrogen).Followingelectrophoresis,the femoralgeometry,morphology,andmineralization(GEMedical gelswerebrieflyrinsedindistilledwaterandscannedonaFuji Systems,London,ON,Canada).FemursfromF male2-month- 1 FLA5000fluorescencescanner(FujiMedicalSystems,Stamford, old mice were scanned over 200 degrees of rotation and CT,USA)usinga473nmexcitationlaserforBODIPY-L-Cysanda reconstructedon18mmvoxels.Corticalandtrabecularanalyses 635nm laser for Cy5. For DSC, collagen was redissolved (1 to includedmeasuresofbonemineralcontentanddensity,cortical 2mg/mLfinalcollagenconcentration)in2mMHCl(pH2.7)orin andtrabecularthickness,andtrabecularspacing.Corticalregions 0.2M sodium phosphate/0.5M glycerol (pH 7.5) and then of interest (ROIs) consisted of cylindrical segments (radius dialyzed extensively against the same buffer to remove excess 1.35mm,height3mm)ofthemiddiaphyses.TrabecularROIsalso salt.DSCthermograms(28)ofapproximately0.1mg/mLofpepsin- consistedofcylindricalsegments(radius0.57mm,heightequal treated collagen in 2mM HCl (pH 2.7) and in the phosphate/ to10%oftotalfemurlength)ofthedistalfemoralmetaphyses, AMISHOIMUTATION JournalofBoneandMineralResearch 249 proximaltothegrowthplates.Separatethresholdswereapplied to the cortical and trabecular ROIs (2000 and 1200 HU, respectively). Ex vivo mechanical testing Femursweremechanicallytestedatroomtemperatureusinga four-point bending apparatus (858 Mini-Bionix, MTS, Eden Prairie,MN,USA)inamannerdescribedpreviouslybyJepsen.(10) With posterior femoral surfaces kept in tension, displacement wasappliedat0.05mm/s.Theupperandlowertinesofthefour- pointsupportwereseparatedby6.35and2.2mm,respectively. Custom software was used to determine stiffness, yield, maxi- mum load, and pre- and postyield fracture energy. Standard beam theory was used to calculate yield stress and Young’s modulus based on the mechanical testing data and femoral geometryasmeasured by mCT. Fig.1.OOA COL1A2 G610C putative founder couple pedigree. The Statistical analysis COL1A2 variant is a G-to-T transversion at nucleotide 2098 that alters Statistical analysis was performed using InStat and Prism thegly-610codon(GGT)toacysteine(TGT)codon.ThemutantTallele statistical software packages (Graphpad, La Jolla, CA, USA) or has been mapped in 64 heterozygous descendants of the putative SASstatisticalsoftware(SASInstitute,Cary,NC,USA).Atwo-tailed foundercouplebornapproximately150yearsago.Fourofthefounder couple’soffspringhaveanestimated800livingdescendants,whereas p value of .05 or less for any single analysis was considered statistically significant. Outliers (defined as values exceeding(cid:4) theotherfiveoffspringproducednoprogeny.(Controlgenotype¼GG; OIgenotype¼GT.) 2sfromthegroupmean)wereremovedfromthemCTandfour- pointbending datasets. Results an average of approximately 6 individuals. The overall sibship genotype distribution exhibited a normal Mendelian 1:1 ratio OOA kindred genotyping/pedigree structure expectedforoffspringfromonecarrierparentandonewild-type parent. No homozygous individuals and no carrier(cid:5)carrier Putative founder couple identification coupleswere identified. A54-year-oldwomanwithahistoryoffracture,lowhipandspine aBMD,andadifferentialdiagnosisofidiopathicosteoporosisor OOA kindred phenotype OI was identified in the Amish Family Osteoporosis Study (AFOS).(29,30) A brother and a niece of the woman also were Standing height identified with a history of fracture and low aBMD. gDNA was Standingheightasafunctionofage(Fig.2)suggestedthatOI extracted from blood of the proband’s brother for analysis of family members tended to be shorter than their unaffected COL1A1 and COL1A2 genes.(31–33) Nucleotide sequencing familymembers.StandingheightwasconvertedtoZ-scoresto identified a G-to-T substitution that converts the triple-helical better assess the effect of the T allele across the wide age codonforglycine-610(GGT)tocysteine(TGT).Sequenceanalysis range of study participants. OOA-specific standing height confirmedthattheproband,brother,andniececarriedasingle Z-scores were generated separately for women and men from copyofthemutantTallele.ThreeadditionalAFOSDNAsamples height data obtained from 1687 females and 1416 males (a grandmother, mother, and granddaughter) were found (age>20 years) enrolled in non-OI research studies (unpub- subsequentlyto carrysingle copies ofthevariant Tallele. lishedUMBdata).SinceOOA-specificdatawereunavailablefor The Anabaptist Genealogy Database (AGDB4)(34,35) was studyparticipants6to20yearsofage,standingheightZ-scores queriedusingPedHunter(36)software tolinkthesixindividuals were generated using the National Health and Nutrition withthemutantTalleletoaputativefoundercouple(Fig.1)born Examination Survey (NHAHES) data (https://web.emmes.com/ approximately 150 years ago. AGDB genealogic records listed study/ped/resources/htwtcalc.htm).MeanstandingheightZ-score approximately 1200 descendents from four of the putative was significantly less (p<.001) for carriers of the T allele as founder couple’s children, of which approximately 800 are compared with control family members but with appreciable estimated to be alive today. Genotype status was obtained for overlap in Z-scores between control and OI study participants 195 study participants; 149 were direct descendants of the (see Fig.2). putativefoundercouple,19weredirect-descendantmarried-in spouses, and 27 were descendants of the putative founder Biomarker measurements couple’ssiblingsormoredistantrelatives.ThevariantTallelewas identifiedin64descendantsin22sibshipsranginginagefrom PICPvaluesforOIfamilymemberswererelativelyconstantasa 3weeksto86years.Sibshipsrangedfrom2to11individualswith function of age (see Fig. 2). However, PICP for control family 250 JournalofBoneandMineralResearch DALEYETAL. Fig.2.OOAkindredstanding-heightandserumbiomarkermeasurements.Height(leftfourpanels):Male(left)andfemale(right)carriers(GT)ofthe COL1A2G610Callele(OI)tendtohavereducedstandingheightcomparedwithcontrol(GG)familymembers.StandingheightZ-scoresforindividuals youngerthan20yearsofagewerecalculatedusingNHANESnormativedata,whereasanOOA-specificZ-scorewascalculatedforindividualsolderthan 20yearsofage.ThemeanOIZ-scoreforstandingheightwassignificantlyreduced(p<.0001)comparedwithfamilycontrolsforbothagegroups. Biomarkers (right four panels): PICP (left) and CrossLaps (right) are serum biomarkers associated with collagen metabolism. PICP reflects collagen biosynthesisinbone.PICPvaluesexhibitedvariationswithageanddiseasestatus.TheparticipantsheterozygousfortheG610CCOL1A2allele(OI)who wereyoungerthan20yearsofageexhibitedsignificantlyreducedPCIPascomparedwithnormalcontrolfamilymembers.CrossLapslevelsreflectthe degradationofbonecollagenandcanbeconsideredasurrogateforboneresorption.Noobviousassociationwithageordiseasestatuswasobservedfor theCrossLapsdata. members younger than 20 years of age were markedly higher Genome Informatics (MGI) ID 3805459] contains 2712 nucleo- compared with OI family members. Genotype (p<.0001) and tides, whereas the wild-type B6 allele contains 730 age(p<.0086)werefoundtomakesignificantcontributionsina nucleotides.F foundermicecDNAsequenceanalysisconfirmed 1 multiple regression model using age, sex, and genotype as expression of mutant and wild-type mRNA. Offspring carrying variablesforPICP.Incontrast,onlyage(p<.0001)wasfoundto one or two copies of the knock-in Col1a2tm1Mcbr allele from F 1 make asignificant contribution to serum CrossLaps. founder breeding survived without any detectable lethality at birth orbeyond weaningand werefertile. BMD measurements GenomicDNAsequenceanalysisconfirmedtheCre-mediated excisionoftheFloxedneocassetteinanF malemousethatwas 2 subsequently used to sire G610C OI mice progeny on a B6 Lumbarspine(L1–4)andfemoralneck(FN)BMADbyageshown background. Intron 33 in G610C OI mice is comprised of 852 formalesandfemalessuggestedthattheOIgrouphasreduced nucleotides,anditsMGIalleledesignationisCol1a2tm1.1Mcbr(MGI BMAD compared with family controls. Age, sex,genotype, and AccessionIdentifier3711122).Itdiffersinsizefromthewild-type weight were used as predictor variables in multiple regression models for lumbar spine and FN BMAD. Sex (p<.03) and B6 sequence by the addition of 144bp of residual targeting genotype (p<.0001) made significant contributions to lumbar vectorsequencethatflankedtheloxPsitesandthelossof22bp spine and FN BMAD. Weight (p<.0001) also contributed to of B6 sequence (GenBank Accession Identifier DQ377844). lumbar spine BMAD, and age (p<.0001) contributed to FN Heterozygous(cid:5)wild-type breeding produced litters with both expectedgenotypes.However,noviablehomozygousoffspring BMAD.BMDassessedasZ-scoresforthespineandhipareshown wereobtainedfromheterozygousmatings.Genotypeanalysisof inFig.3.MeanZ-scoredifferencesbetweentheOIandcontrol deadpupsrecoveredwithin24hoursofbirthdiddemonstrate groups at the lumbar spine and the FN were significant (p<.0001). The mean Z-score at the lumbar spine was thepresenceofpupshomozygousfortheCol1a2tm1.1Mcbrallelein (cid:1)2.63(cid:4)0.99fortheOIgroupand(cid:1)0.24(cid:4)0.82forthecontrol the litters. group.MeanFNZ-scoreswere(cid:1)1.18(cid:4)0.91fortheOIgroupand 0.26(cid:4)0.78for thecontrol group. Human and mouse SDS-PAGE analysis DoublelabelingwithCy5andBodipy-L-CysrevealedintenseCys Production of the knock-in mice staining of a2(I) chains from all mutant animals and proband Nucleotide gDNA sequence (GenBank Accession Identifier collagens(Fig.4A,B),indicatingthepresenceofexposedreactive DQ377843) analysis demonstrated that F founder mice Cys-SH residues ina2(I)chains oftype Icollagentriplehelices. 1 (male¼1, female¼2) were heterozygous for the knock-in Interestingly,SDS-PAGEalsorevealedthepresenceofreducible mutationinCola2exon33(equivalenttoCOL1A2exon35).Intron a2-Cys-S-S-Cys-a2dimersintendonsofallmutantanimals(see 32 for the F founder knock-in allele [Col1a2tm1Mcbr; Mouse Fig.4C,D).SincetypeIcollagentriplehelixcontainsonlyonea2 1 AMISHOIMUTATION JournalofBoneandMineralResearch 251 Fig.3.OOAkindredbonemineraldensity(DXA)measurements.TheprincipalquantitativemeasureofphenotypeseveritywasaBMDusingDXA.BMAD wascalculatedfromL1–4spine(A,B)andfemoralneck(C,D)DXAaBMDmeasurementsasanestimateofvolumetricbonedensity.Bothmale(left)and female(center)Talleleindividuals(OI)tendedtohavereducedBMADcomparedwithfamilycontrolsasafunctionofage.MeanZ-scoresusingHologic normativedatearereducedinOIfamilymembersascomparedwithcontrolsinboththespine(E)andhip(F). chain,suchdimersmustformbetweentwodifferentmolecules. thatofnormalheterotrimers.(28,37)Thus,totestwhetherthehigh The intermolecular dimers likely form prior to fibrillogenesis a1(I):a2(I) ratio was consistent with homotrimer formation, we becauseinthefibrilstheCysresiduesofadjacenttriplehelices performed DSC scans of collagen from all mouse tendons and areaxiallyseparatedbyatleastoneDperiod.Dimerformation humanfibroblastculturesin2mMHCl(pH2.7).Inadditiontothe likely occurs in the Golgi stack by nonspecific side-by-side denaturation peak of normal type I heterotrimers, the DSC interactionsofprocollagenmolecules.Surprisingly,theaberrant thermograms of collagen from neoþ animals (see Fig. 4E) did intermolecular dimers are incorporated into the tissues of reveal a low-temperature peak consistent with mutant hetero- mutantanimals.Fromtheintensitiesofthebandscontainingthe trimers and a high-temperature peak. The high-temperature S-S dimers and corresponding bands without the dimers, the peakwasidenticaltooimandartificialhomotrimersmeasuredat estimatedfractionofmutantchainsinvolvedinthedimerswas thesameconditions.(28,38)Thispeakwasabsentincollagenfrom approximately1%inheterozygousneoþ,approximately1.5%in neo–animals(seeFig.4F)andfromhumanprobandfibroblasts heterozygousneo–,andapproximately9%inhomozygousneoþ (seeFig.4G).DeconvolutionoftheDSCthermogramssuggested animals(Table1). approximately 24% and approximately 62% content of homo- SDS-PAGE analysis also demonstrated an abnormally high trimers in heterozygous and homozygous neoþ animals, ratioofa1(I):a2(I)fluorescenceintensitiesinneoþ(Col1a2tm1Mcbr respectively, inagreementwith SDS-PAGE. allele) animals, approximately 3:1 in heterozygous neoþ and To evaluate the effect of the G610C substitution on the approximately 8:1 in homozygous neoþ versus approximately thermal stability of mutant collagen, we measured similar DSC 2:1 in wild-type and heterozygous neo– (Col1a2tm1.1Mcbr allele) thermogramsin0.2Msodiumphosphateand0.5Mglycerol(pH animals.Mostlikelythiswascausedbyinsufficientsynthesisof 7.5), which can be used to evaluate the T under physiologic m mutant a2(I) chains and formation of a1(I) homotrimers [e.g., conditions by subtraction of 1.78C. From the buffer-corrected owing to partial degradation and/or slower transcription, thermograms(seeFig.4H–J),weestimatethattheincorporation splicing, and/or translation of the neoþ (Col1a2tm1Mcbr) mRNA ofthemutanta2(I)chainresultsinaT reductionby2.38Cinmouse m containing the intron 33 targeting vector]. Based on this andapproximately18Cinhumancollagenscorrespondingly. assumption,weestimatedthehomotrimer contentasapproxi- mately23%andapproximately67%intendonsofheterozygous F G610C OI mouse phenotype 1 andhomozygous neoþ animalscorrespondingly (see Table1). Breeding Atotalof301experimentalmicewereobtainedfrom48litters. Human and mouse DSC analysis Genotypewasdeterminedforthemice,exceptforoneB6.Cby Previousdifferentailscanningcalorimetry(DSC)studiesshowed femalemouse.MeanlittersizesdifferedamongthefourF stains 1 that the denaturation temperature T of type I collagen (one-wayANOVAp¼.0039).Themeanlittersizeswere7.9(cid:4)1.9 m homotrimers at acidic pH is approximately 2.58C higher than (FVB.B6),6.5(cid:4)2.5(Cby.B6),5.0(cid:4)2.2(C3.B6),and5.0(cid:4)1.5(A.B6). 252 JournalofBoneandMineralResearch DALEYETAL. Fig.4.TypeIcollagenanalysis.TypeIcollagenfromhumanfibroblastculturesandfrommousetailtendonswasanalyzedbySDS-PAGE(A–D)andDSC(E– J).G610CgenotypestatusisrepresentedasGG(control),GT(heterozygous),andTT(homozygous).NeoþrepresentstheCol1a2tm1McbralleleinG610C mice, and neo– represents the G610C OI mouse Col1a2tm1.1Mcbr allele. The gels labeled by Cy5 and Bodipy-Cys are shown only in the Bodipy-Cys fluorescence(A,B).TheCy5fluorescenceofthesegelswasusedforidentificationofthebandsandcorrectionfornonspecificBodipy-Cyslabeling(the residualnonspecificlabelingstillcanbeobservedinthedimerbands).DTTwasincludedinthesampleloadingbufferinpanel(C)andexcludedfromthe samplebufferinpanels(A),(B),and(D).NormalizedDSCthermogramsofpurifiedpepsin-treatedcollagenfromG610C(neoþ)andG610COI(neo–)mouse tailtendonsandhumanfibroblastsweremeasuredatpH2.7(2mMHCl;E–G)andpH7.5(measuredin0.2Msodiumphosphateand0.5Mglyceroland correctedby1.78Ctorepresentphysiologicalconditions;H–J).EachpeakrepresentstheheatofdenaturationofadistinctmolecularformoftypeI collagen.Relativeareasunderthepeaksoneachthermogramrepresentthefractionofthecorrespondingmoleculesinthemixture.Thesuperscriptm identifiesmutanta2(I)chains. Goodness-of-fit testing indicated a significant deviation from squaredbothp<.0001).Wild-typeanimalswereheavierthanOI expected genotype ratios looking at data from all litters animals (difference 1.77g,SE 0.3279, p<.0001).The A.B6 mice (p¼.008). However, no individual strains had a significant had the lowest and the FVB.B6 mice had the greatest body deviation fromexpected ratios. weight. FVB.B6 mice were significantly heavier than A.B6 mice (difference 2.07g, p<.0001), FVB.B6 mice were significantly heavier than Cby.B6 mive (difference 1.37g, p<.003 (both p Body weight values adjusted for multiple comparisons using Tukey-Kramer). Therewasacurvilinearrelationbetweenbodyweight(measured There was no evidence of a strain-by-genotype interaction longitudinally on days 21 to 60) and age (Fig. 5; age and age (strain(cid:5)genotypep<.8). AMISHOIMUTATION JournalofBoneandMineralResearch 253 Table1. Differential ScanningCalorimetry (DSC) and SDS-PAGE Analysis ofType ICollagen DSC SDS-PAGE Sample Genotype a1 a2, % a1 a2m,%a a1 ,% a1 ,% ReactiveCys-SH a2m–S–S–a2m,%a 2 2 3 3 Mouse GG 100 0 0 0 0 0 Mouseneoþ GT 59(cid:4)5b 17(cid:4)1b 24(cid:4)5b 23(cid:4)5 Yes 1(cid:4)0.3 Mouseneoþ TT 0 38(cid:4)1b 62(cid:4)1b 67(cid:4)5 Yes 9(cid:4)3 MouseNeo– GT 51(cid:4)1b 49(cid:4)1b 0 0 Yes 1.5(cid:4)0.3 Human GG 100 0 0 0 No — Human GT 50(cid:4)10b 50(cid:4)10b 0 0 Yes — aThesuperscriptmidentifiesmutantchains. bEstimateddeconvolutionerror. aBMD of G610C OI mouse femurs mineral content and bone location (p¼.0065). The miner- al:collagen ratio (PO :amideIII) also was found to have a G610COImicehadlowerBMC(D¼0.005g,p<.001)andBMD 4 significantgenotype(p<.0001)effectandacurvilinearrelation- (D¼0.005g/cm2,p¼.001).MeanaBMDrankorderoftheG610C ship between mineral content and location (p¼.047) but no OImicebymaternalbackgroundstrainforwasA.B6<Cby.B6< evidenceofastraineffect(p¼.36).Thecurvilinearrelationships FVB.B6<C3.B6.PairwisecomparisonsoftheG610COImiceusing forPO :CHandPO :amideIIIhadpeakvalueslocatedaroundthe the Scheffe multiple-comparisons adjustment procedure 4 4 middleofthecorticalbone.Onlygenotypewasfoundtohavea resulted in a statistically significantly difference between significant (p<.0001) effect for the collagen content of bone A.B6 OI and C3.B6 OI (D¼0.007g/cm2, p¼.0061). A strain-by- matrix(amideIII:CH).Mousestrain-by-genotypeinteractionwas genotypeinteractionwasnotsignificantforeitherBMCorBMD notsignificant for any oftheRaman data. (p(cid:6).9). Confocal Raman microspectroscopy mCT Mineralcontentofbonematrix(PO :CH)(Fig.6)wasfoundtobe Table 2 shows mean values of selected trabecular and cortical 4 affectedbygenotype(p<.0001)andmousestrain(p¼.009).A boneparametersobtainedfromisolatedfemora.Corticalshape significant curvilinear relationship was observed between and femur length were qualitatively very similar for each Fig.5.F G610COImousegrowthcurves.Body-weightcurvesdemonstratedacurvilinearrelationbetweenweightandageforallgroupsofmice.Strain 1 andgenotypewereindependentpredictorsofweight.Thewild-type(control;blacksquares)micewere1.77gheavierthantheOImice(heterozygousfor theCol1a2tm1.1Mcbrallele;graydiamonds),withthegreatestdifferenceinbodyweightbetweentheFVB.B6andtheA.B6groups. 254 JournalofBoneandMineralResearch DALEYETAL. Fig.6.F G610COImouseRamanmicrospectroscopy.ThecollagencontentoftheOI(heterozygousfortheCol1a2tm1.1Mcbrallele)femurswasreduced 1 relativetowild-type(WT)controlfemurs,andthecollagenwashypermineralized.ArepresentativeRamanspectrumillustratesthepeaksusedfordata analysis(upperleft),andcomparisonofchemical-specificratiosinWT(blackbars)andG610COI(graybars)femursdeterminedfromtheRamanspectraare showninthebalanceofthefigure. backgroundstraincontrol-OIpair(datanotshown).Overall,the ment,andenergytofailure.ThepresenceoftheCol1a2tm1.1Mcbr mCT trabecular and cortical data show that all G610C OI mice alleleresultedinastrikingreductioninfailureloadforallF OI 1 carryingonecopyoftheCol1a2tm1.1Mcbrallelehadlessboneas mice compared with their strain-specific controls. The mean measured by bone volume fraction. The trabecular bone was failure load range was greater for control mice (24N for A.B6 distinguished by fewer and more widely spaced trabeculae. mice to 35N for C3.B6) compared with OI mice (15N for A.B6 ExceptfortheFVB.B6mice,themeancorticalthicknessandarea mice to18N forC3.B6mice).TheimpactoftheCol1a2tm1.1Mcbr werereducedbythepresenceoftheCol1a2tm1.1Mcbrallele.The alleleonthemagnitudeoftheintrastraincontrol-OIdifferencein FVB.B6controlandOIgroupshadsimilarmeanvaluesforcortical stiffness was variable. The greatest intrastrain OI-control mean thickness and area. All the OI femurs had reduced moment of difference was found in the C3.B6 group, where the inertia (I ) compared with age-matched genetic background Col1a2tm1.1Mcbr allele was associated with a 71% reduction in yy controls. The cortical volumetric tissue mineral content (vTMC) meanstiffness.TheOImiceintheotherthreegroupshadmean was lower in all OI mice relative to their genetic background stiffnessvaluesof82%(A.B6),91%(Cby.B6),and98%(FVb.B6)of controls,exceptfortheFVB.B6OIgroup,whichwasthesameas their intrastrain controls. Mean values for postyield ultimate theFVB.B6controlgroup.Thecorticalvolumetrictissuemineral displacement forOI micewere 45%(Cby.B6), 52%(C3.B6), and density(vTMD)waselevatedinallmicecarryingCol1a2tm1.1Mcbr 59% (FVB.B6) of strain-matched control values. However, the allele relative to their genetic background controls. The meanvalueforA.B6OImicewas95%ofthecontrolvalue.Failure trabecular vTMD was statistically the same for each genetic energyrangedfrom0.78(Cby.B6)to1.14N-mm(C3.B6)fortheOI background pair. mice and from3.11(A.B6) to 6.3N-mm (FVB.B6) forcontrols. Ultimate stress and Young’s modulus had statistically Four-point bending biomechanics significant genotype and strain differences, but the genotype- by-genetic-background interaction was not significant (see Isolated femurs were loaded to failure in a four-point bend- Table 3). Mean ultimate stress was reduced for all OI groups testing apparatus to assess the impact of a single copy of the relative to their genetic background controls and ranged from Col1a2tm1.1Mcbralleleandtheroleofgeneticbackgroundonthe 67%(Cby.B6OImice)to81%(C3.B6OImice).Young’smodulus structural phenotype (Table 3). Specifically, femurs from mice was increased across all OI groups carrying the Col1a2tm1.1Mcbr withonecopyofthevariantalleleweresignificantlyweakerand allele relative to their genetic background controls. The more brittle than femurs from control mice. In addition, a magnitude of the mean Young’s modulus was not different genotype-by-genetic-background (strain) interaction was sig- between OI-control pairs but varied by genetic background of nificant for failure load, stiffness, postyield ultimate displace- the strain. AMISHOIMUTATION JournalofBoneandMineralResearch 255 n 01 01 01 01 ai 0 0 0 0 Str <.0 <.0 <.0 <.0 e alu pe 1 1 1 v y 0 0 0 VAp Genot <.00 <.00 <.00 O C N A n o cti 09 94 54 24 52 a 3 0 1 1 0 nter .0 .0 .0 .0 .0 I 16 73 00 4 4 7 31 92 41 09 31 01 27 82 90 37 00 27 76 10 20 70 00 23 82 OI 0.0. 2.0. 4.8. 0.0. 0.0. 0.0. 0.0. 2.0. 6.6. 33 52 5 0 1 6 B 3. C 28 17 00 6 5 46 2 76 59 05 61 31 08 32 49 11 WT 0.10.0 4.01.1 3.38.5 0.10.0 0.20.0 0.90.0 0.10.0 2.80.2 8.24.2 31 41 5 0 1 34 13 00 1 1 1 35 81 67 02 31 91 46 01 60 36 00 54 20 10 10 70 10 22 34 OI 0.0. 2.0. 3.2. 0.0. 0.0. 0.0. 0.0. 2.0. 5.2. 72 22 4 0 6 1 B B. V F 3 7 80 14 06 8 6 7 4 WT 0.140.02 4.500.43 9.907.09 0.140.00 0.180.00 0.760.04 0.120.01 2.280.15 9.323.26 5 61 4 9 66 59 00 4 6 9 66 04 45 08 21 81 87 81 38 7 10 88 79 10 10 60 00 12 70 OI 0.0. 2.0. 3.1. 0.0. 0.0. 0.0. 0.0. 2.0. 1.1. 14 42 5 0 6 1 B y. b C 06 34 00 9 9 2 7 07 91 03 51 01 10 32 58 03 WT 0.20.0 4.71.1 6.03.3 0.10.0 0.20.0 0.80.1 0.10.0 2.50.3 9.22.8 23 12 5 0 1 T C m m 6 9 dFro OI 0.0590.026 1.7980.491 8.5005.650 0.100.003 0.170.007 0.580.018 0.0610.004 1.800.07 1.563.20 Derive A.B6 483 1031 s arameter WT 0.0820.026 2.9230.781 469.40010.860 0.120.0076 0.180.0084 0.660.044 0.0820.0090 2.000.14 999.489.51 P al c Corti (%) n d o 2.Trabecularan cularBV/TV(%) cularnumber cularvBMD albonevol.fracti althickness(mm) 2alarea(mm) 4alI(mm)yy alvTMC(mg) alvTMD(mg/mL) e n e e e c c c c c c Tabl MeaSD Trab Trab Trab Corti Corti Corti Corti Corti Corti 256 JournalofBoneandMineralResearch DALEYETAL.

See more

The list of books you might like