Logout succeed
Logout succeed. See you again!

WAVE2 Regulates High-Affinity Integrin-Binding by Recruiting PDF
Preview WAVE2 Regulates High-Affinity Integrin-Binding by Recruiting
MCB Accepts, published online ahead of print on 25 June 2007 Mol. Cell. Biol. doi:10.1128/MCB.00136-07 Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. WAVE2 Regulates High-Affinity Integrin-Binding by Recruiting Vinculin and Talin to the Immunological Synapse D Jeffrey C. Nolz1, Ricardo B. Medeiros3, Jason S. Mitchell3, Peimin Zhu4, Bruce D. E Freedman4, Yoji Shimizu3 and Daniel D. Billadeau1,2,5 T D o w P n lo a From the Department of Immunology1 and the Division of Oncology Research2, Mayo d e E d f Clinic College of Medicine, Rochester, MN 55905, r o m C the Department of Laboratory Medicine and Pathology3, Center for Immunology, Cancer ht t p : / / Center, UnivCersity of Minnesota Medical School, Minneapolis, MN 55455 and m c b . the Department of Pathobiology4, School of Veterinary Medicine, University of a s A m . o Pennsylvania, Philadelphia, PA 19104, r g / o n A p r il 1 3 , 2 0 Corresponding author5: Daniel D. Billadeau 1 9 Department of Immunology and b y Division of Oncology Research g 200 First Street SW u e Rochester, MN 55905 s t Tel: (507)-266-4334 Fax: (507)-266-5146 Email:[email protected] Running Head: WAVE2 Regulates TCR-Mediated Integrin Activation ABSTRACT T cell receptor (TCR)-mediated integrin activation is required for T cell – antigen D presenting cell (APC) conjugation and adhesion to extracellular matrix components. E While it has been demonstrated that the actin cytoskeleton and its regulators play an essential role in this process, no mechanism has been establisThed which directly links D o w TCR-induced actin polymerization to the activation of integrins. Here, we demonstrate P n lo a that TCR-stimulation results in WAVE2-ARP2/3-dependent F-actin nucleation and the d e E d f formation of a complex containing WAVE2, ARP2/3, vinculin and talin. The verprolin- r o m C h connecting-acidic (VCA) domain of WAVE2 mediates the formation of the ARP2/3- t t p : / / vinculin-talin signaCling complex and talin recruitment to the immunological synapse (IS). m c b . a Interestingly, although vinculin is not required for F-actin or integrin accumulation at the s A m . o IS, it is required for the recruitment of talin. In addition, suppression of either WAVE2 or r g / o vinculin inhibits activation-dependent induction of high-affinity integrin binding to VCAM- n A p r 1. Overall, these findings demonstrate a mechanism in which signals from the TCR il 1 3 , produce WAVE2-ARP2/3-mediated de novo actin polymerization, leading to integrin 2 0 1 9 clustering and high-affinity binding through the recruitment of vinculin and talin. b y g u e s t 2 INTRODUCTION Reorganization of the actin cytoskeleton is an essential process required for many aspects of T cell biology (45). Besides providing the mechanical force for variouDs basic biological functions including cell migration and polarization, the actin cytoskeleton E serves a specialized role in T cells during the formation of the Immunological Synapse T D (IS) between the T cell and an antigen-presenting cell (APC) decorated with appropriate o w P n peptide-MHC complexes. Signaling cascades originating from the engaged T cell lo a d e E receptor (TCR) initiate IS formation causing dynamic cytoskeletal reorganization, d f r o m changes in gene transcription, and activation of cell surface integrins (25). C h t t p Integrins are heterodimeric cell surface receptors that are responsible for cell : / / C m c adhesion, including T cell – APC conjugation and attachment to extracellular matrix b . a s A m components such as fibronectin. TCR-mediated activation of integrins occurs as a . o r g result of physical conformational changes within the receptor (affinity) as well as / o n A clustering of individual subunits on the cell surface (avidity) in response to signals p r il 1 generated from TCR ligation, a process known as “inside-out” signaling (25). Among 3 , 2 0 the various integrin heterodimers expressed by T cells, LFA-1 (α β ) plays a critical role 1 L 2 9 b y during T cell – APC conjugation and eventually localizes to the pSMAC of the IS where g u e s it binds to its ligand ICAM found on the surface of the APC (9). The α β integrin (VLA- t 4 1 4) also localizes to the pSMAC (33). In addition, VLA-4 binds to extracellular matrix proteins, such as fibronectin, and cell surface ligands, such as VCAM-1, in response to TCR stimulation (34). An array of signaling proteins are required for TCR-mediated integrin activation, including the Guanine Nucleotide Exchange Factor (GEF) VAV1 3 (26), the small GTPase RAP1 (8, 40), adhesion and degranulation-promoting adaptor protein (ADAP, a.k.a. SLAP-130/Fyb) (18, 38), and the non-conventional PKC isoform, D PKD (a.k.a. PKCµ) (30). However, the exact molecular mechanism by which these proteins regulate TCR-mediated integrin activation remains largely unknown. E Actin cytoskeletal reorganization is also required for TCR-mediated integrin T D activation (39). Interestingly, T cells from WASP-/- mice are unimpaired in their ability to o w P n form T cell – APC conjugates, adhere to fibronectin, or cluster integrins in response to lo a d e E TCR stimulation, whereas T cells lacking VAV1 are defective in all three processes (26). d f r o m Recently, we have demonstCrated that the actin regulatory protein WAVE2 is an h t t p essential component of “inside-out” signaling required for TCR-mediated integrin : / / C m c activation (36). Additionally, WAVE2 participates in TCR-stimulated actin cytoskeletal b . a s A m dynamics needed for lamellipodial formation and accumulation of F-actin at the IS. . o r g / Structurally, WAVE2 contains an N-terminal WAVE-homology domain (WHD), which o n A links WAVE2 to a complex of associated protein components that includes ABI-1/2, p r il 1 NAP/HEM-1, and SRA-1/PIR121 (13). A basic region (BR) and a proline-rich region 3 , 2 0 (PR) in WAVE2 play roles in both the localization as well as the activation of WAVE2 1 9 b y (32, 37). Finally, similar to WASP, WAVE2 has a C-terminal verprolin (also known as g u e s WH2)-connecting-acidic (VCA) domain, which binds the ARP2/3 complex and G-actin t and promotes de novo actin polymerization. However, the exact mechanism or structural feature of WAVE2 that is required to link TCR-initiated signaling to integrin activation is not known. 4 In this report, we use biochemical, cellular and genetic approaches to define the molecular mechanism by which WAVE2 regulates integrin activation downstream of the TCR. We show that the interaction of the WAVE2 VCA domain with the ARP2D/3 complex links WAVE2 to the integrin scaffolding proteins vinculin and talin. The E formation of a WAVE2-ARP2/3-vinculin complex leads to talin recruitment to the IS and T D high-affinity integrin binding. Overall, these findings establish a molecular mechanism o w P n by which WAVE2 and de novo actin polymerization control integrin activation in lo a d e E response to TCR stimulation. d f r o m C h t t p : / / C m c b . a s A m . o r g / o n A p r il 1 3 , 2 0 1 9 b y g u e s t 5 MATERIALS AND METHODS Reagents and antibodies. Unless otherwise stated, all chemicals were obtained from Sigma-Aldrich. The antisera against WAVE2 (36) and VAV1 (15) have been previousDly described. Antibodies for RAC1 (clone 23A8), p34-Arc/ARPC2, vinculin (clone V284) E and phosphotyrosine (clone 4G10) were purchased from Upstate Biotechnology. The T D antibody against β1 integrin (clone P5D2) was purchased from Chemicon, the antibody o w P n for talin (clone 8d4) and FLAG epitope were purchased from Sigma, the antibody for lo a d e E CDC42 was purchased from BD Biosciences, and the antibody for ARP2 was d f r o m purchased from Santa Cruz BCiotechnology. The antibody against β2 integrin is clone h t t p MHM23. The OKT3 mAb antibody was obtained from the Mayo Pharmacy and the anti- :/ / C m c b CD28 mAb was purchased from BD Biosciences. . a s A m . o r g / Plasmids and cloning. The pCMS4 “suppression/re-expression” vectors used for o n A shRNA silencing and re-expression of resistant cDNAs has been described previously p r il 1 (15). The following 19-nucleotide sequence was generated to target human WAVE2 3 , 2 0 1 (GAGAAGAGAAAGCACAGGAA). The DNA sequence encoding full length WAVE2 9 b y was amplified from Jurkat cDNA using the following set of oligonucleotides: (5’- g u e s GCACACGCCGACGCGTATGCCGTTAGTAACGAGGAACATCGAGCCA-3’ and 5’- t GACGATGCGAGCGGCCGCTTAATCGGACCAGTCGTCCTCATCAAATTC-3”). Underlined sequence indicates unique restriction sites used for subcloning. An shRNA resistant form of WAVE2 was created using the Quick Change Site-Directed Mutagenesis kit from Strategene, where the targeting sequence within the DNA was 6 changed to GAaAAaAGgAAaCACAGGAA (lowercase letters indicates a changed nucleotide that does not affect amino acid sequence). The ∆BR mutant of WAVE2 was D created by deleting amino acids 172-209 (37) and the ∆PR mutant by deleting amino acids 247-419 using Site-Directed Mutagenesis. The ∆VCA version of EWAVE2 was created by deleting the C-terminal end of the protein beginning with amino acid 436. T D The following 19- and 21-nucleotide sequences were generated to target human o w P n lo vinculin (A: GGTAGCCATCCCATGAACA, B: GCCTTCCTCCACATCCTTTCT). a d e E d Human vinculin cDNA was a gift from Dr. Tina Izard (St. Jude’s Children's Hospital, f r o m Memphis, TN) and was subCcloned into the pCMS4 vector. Since the both of the h t t p : shRNA’s used to target human vinculin lied in the 3’ UTR of the primary transcript, / / C m c b generation of resistant cDNA for vinculin was not necessary. The P878A mutant of . a s A m human vinculin was generated using site-specific mutagenesis. The following sequence . o r g / was generated to target human ARP2 (GTGGGTAAATCTGAGTTTA). o n A p r il 1 3 Cell culture and transfection. Jurkat T cells, NALM6 B cells and Raji B cells were , 2 0 1 grown in RPMI-1640 supplemented with 5% fetal bovine serum, 5% fetal calf serum, 9 b y and 4mM L-glutamine. Human CD4+ T cells were purified from buffy coats obtained g u e s from the Mayo Clinic Blood Bank using RosetteSep purification (StemCell t Technologies). Following purification, human CD4+ cells were cultured in serum containing media along with 5 µg/ml PHA and IL-2 for 24 hours. Cell were then washed and cultured in serum containing media with IL-2 for 72 hours. Transient transfections in Jurkat were performed using 1 x 107 cells per sample along with 30-40 µg of plasmid 7 DNA as previously described (5). Transfected Jurkat cells were used 48-72 hours following transient transfection. D E Cell stimulation and immunoblot analysis. For the stimulation timecourse studies, 10 x 106 Jurkat T cells or 25 x 106 human CD4+ T cells were staiTned on ice with 5 µg/ml D o w anti-CD3 (OKT3, mAb) and 5 µg/ml anti-CD28 and Pthen crosslinked using goat anti- n lo a mouse over the indicated time course at 37°C. After each time point the cells were d e E d f r immediately washed in ice cold PBS and lysed in NP-40 lysis buffer (20 mM HEPES, o m C h pH 7.9, 100 mM NaCl, 5 mM EDTA, 0.5 mM CaCl, 1% NP-40, 1 mM PMSF, 10 µg/ml tt p : / / C m leupeptin, 5 µg/ml aprotinin, 1 mM Na3VO4, and 5 µM MG-132) for 10 min on ice. c b . a LysateAs were clarified by centrifugation at 18k x g for 5 min at 40C and then transferred sm . o r to antibody-coated beads. The protein complexes were then washed twice with NP-40 g / o n lysis buffer, eluted in 60 µl of SDS-sample buffer, resolved by SDS-PAGE, and A p r il transferred to Immobilon-P membranes (Millipore). For activation of GTPases, cells 1 3 , 2 were lysed in GTPase activation buffer (50 mM TRIS, pH 7.5, 500 mM NaCl, 5 mM 0 1 9 b MgCl , 0.5% NP-40, 10% glycerol, 1 mM PMSF, 10 µg/ml leupeptin, 5 µg/ml aprotinin, 1 y 2 g u e mM Na VO ), vortexed, and immediately clarified and transferred to glutathione agarose s 3 4 t previously bound to GST-Pak CRIB. Lysates were allowed to rotate for 10 minutes and washed once before elution and analysis as described above. In cases where whole cell lysates were prepared, 50-100 µg of protein was resolved by SDS-PAGE. For immunoblots, mAbs were detected using goat anti-mouse IgG coupled to horseradish 8 peroxidase (Santa Cruz), and polyclonal rabbit antisera were detected using goat anti- rabbit coupled to horseradish peroxidase (Santa Cruz) and SuperSignal Enhanced Chemiluminescence (Pierce, Rockford, IL). D E Immunofluorescence microscopy. B cell/T cell conjugates were formed essentially as T D described previously (4). Briefly, NALM6 or Raji cells were stained with CellTracker o w P n Blue CMAC (7-amino-4-chloromethylcoumarin, Molecular Probes) and pulsed with or lo a d e E without 2 µg/ml SEE or 2 µg/ml of a cocktail of Staphylococal superantigens (SEA, SEB, d f r o m SEC3, SEE; Toxin TechnologCies). B cells were centrifuged together with the same h t t p number of T cells, incubated at 37°C for 15 min, plated onto poly-L-lysine-coated :/ / C m c b coverslips, and fixed with 4% paraformaldehyde/PBS for 10 minutes at room . a s A m temperature. Fixed cells were quenched with 50 mM NH4Cl and permeabilized in 0.3% .o r g / Triton X-100. Blocking and antibody incubations were performed in PBS/0.05% o n A saponin/0.25% fish skin gelatin. Slides were labeled with primary antibodies followed p r il 1 by goat anti-rabbit FITC or goat anti-mouse TRITC (Molecular Probes). F-actin was 3 , 2 0 1 visualized with fluorescein or rhodamine phalloidin (Molecular Probes). Coverslips were 9 b y mounted in Mowiol 4-88 (Hoeschst Celanese) containing 10% 1,4-diazobicyclo [2.2.2] g u e s octane. Quantification of F-actin polarization and protein localization was performed by t an individual blinded to the experimental conditions. To minimize bias, 50 conjugates were chosen at random, based upon DIC and CMAC images, disregarding cell morphology or protein distribution, and only conjugates consisting of 1 green (GFP- transfected) T cell and 1 blue (CMAC stained) B cell were scored. Those conjugates 9 showing a distinct, bright band of labeling at the cell-cell contact site were scored as positive. Typically, this band was much brighter than any other portions of either cell, however, where necessary, the pixel intensity was determined, and only thosDe interfaces with pixel intensity greater than the sum of the two cell surfaces away from E the interface were scored as polarized. T D o w P n Conjugate analysis. Conjugate assays were performed essentially as described lo a d e E previously (35). Briefly, Raji B cells were stained with PKH26 according to d f r o m manufacturers directions. After quenching with media containing serum, cells were C h t t p incubated in the presence or absence of 2 µg/ml SEE for 1 hour, washed and : / / C m c resuspended at 0.5 x 106 cells/ml in RPMI. Jurkat T cells transfected with GFP- b . a s A m expressing plasmids were also resuspended at 0.5 x 106 cells/ml in RPMI. For . o r g / conjugation, equal volumes of B and T cells were pelleted together at a speed of 500 o n A RPM for 5 minutes, then incubated at 37°C for 10 – 15 min. Cells were vortexed for 5 – p r il 1 10 seconds and then fixed by adding an equal volume of 4% paraformaldehyde. The 3 , 2 0 relative proportion of red, green, and red/green events in each tube was determined by 1 9 b y two-color flow cytometric analysis using a FACScalibur flow cytometer (BD g u e s Biosciences). The number of gated events counted per sample was at least 15,000. t Adhesion assays. Adhesion assays were performed as previously described (10, 46). Briefly, Jurkat T cells were transfected with the indicated GFP-suppression vector and adhesion analysis was performed 48-72 hours later using a 96-well plate pre-coated 10