Logout succeed
Logout succeed. See you again!

When activated, endothelial cells express adhesion molecules, including vascular adhesion PDF
Preview When activated, endothelial cells express adhesion molecules, including vascular adhesion
JBC Papers in Press. Published on October 5, 2001 as Manuscript M108363200 Thrombin Stimulation of the VCAM-1 Promoter in Endothelial Cells is Mediated by Tandem NF-κκκκB and GATA Motifs Takashi Minami, William C. Aird ¶, D ow n lo a d From the Department of Molecular Medicine, Beth Israel Deaconess Medical Center, ed fro m Boston Massachusetts 02215, USA http ://w w w .jb c .o rg b/ y g u ¶ To Whom All Correspondence Should be Sent: Beth Israel Deaconess Medical Center, es t o n J a RW-663, Boston MA 02215 Tel: 617-667-1031; Fax: 617-667-2913; email: nu a ry 5 [email protected] , 20 1 9 Running Title: Thrombin-mediated induction of the VCAM-1 promoter 1 Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc. SUMMARY The goal of this study was to delineate the transcriptional mechanisms underlying thrombin-mediated induction of vascular adhesion molecule-1 (VCAM-1). Treatment of human umbilical vein endothelial cells with thrombin resulted in a 3.3-fold increase in VCAM-1 promoter activity. The upstream promoter region of VCAM-1 contains a thrombin-response element (TRE), two NF-κB motifs and a tandem GATA motif. In transient transfection assays, mutation of the TRE had no effect on thrombin induction. In D contrast, mutation of either NF-κB site resulted in a complete loss of induction, while a ow n lo a d e mutation of the two GATA motifs resulted in a significant reduction in thrombin d fro m h stimulation. In electrophoretic mobility shift assays, nuclear extracts from thrombin- ttp ://w w treated endothelial cells displayed markedly increased binding to the tandem NF-κB and w .jb c .o GATA motifs. The NF-κB complex was supershifted with anti-p65 antibodies, but not brg/ y g u e s with antibodies to RelB, c-Rel, p50 or p52. The GATA complex was supershifted with t o n J a n u antibodies to GATA-2, but not GATA-3 or GATA-6. A construct containing tandem a ry 5 , 2 copies of the VCAM-1 GATA motifs linked to a minimal TK promoter was induced 2.4- 01 9 fold by thrombin. Taken together, these results suggest that thrombin stimulation of VCAM-1 in endothelial cells is mediated by the coordinate action of NF-κB and GATA transcription factors. 2 INTRODUCTION Vascular adhesion molecule-1 (VCAM-1)1 is a 110-kDa cell surface glycoprotein that was first identified as an adhesion molecule expressed by cytokine-activated endothelial cells (1). In response to inflammatory mediators, VCAM-1 interacts with its integrin counter receptor, VLA-4 (very late antigen-4) to mediate the recruitment of mononuclear leukocytes to the endothelium. In addition to its physiological role in cell trafficking, VCAM-1 has been implicated in a number of chronic inflammatory disease D states, including rheumatoid arthritis and atherosclerosis (2-5). o w n lo a d e d fro m The VCAM-1 promoter has been cloned and well characterized (6). Previous h ttp ://w studies have shown that two tandem NF-κB elements located at position –77 and –63, ww .jb c .o relative to the transcriptional start site are necessary for mediating response to rg b/ y g u inflammatory mediators (6-8). Other studies have invoked an important role of co- es t o n J a stimulators in mediating cytokine response, including Sp1 (9), activating protein-1 (AP- nu a ry 5 1) (10), interferon regulatory factor (IRF)-1 (11), and GATA binding proteins (12,13). , 20 1 9 Thrombin, a multifunctional serine protease derived from the zymogen prothrombin, is a key component of the coagulation cascade, serving to catalyze the conversion of fibrinogen to fibrin. In addition, thrombin plays a role in inflammation by activating a variety of cell types, including endothelial cells, smooth muscle cells and leukocytes. Most of these cellular effects are mediated by PAR1, a G-protein coupled 3 receptor. Thrombin cleaves the receptor, unmasking a tethered ligand, which is then free to activate the receptor (14,15). Thrombin-stimulated endothelial cells bind more avidly to polymorphonuclear cells (PMN) (16-19), and monocytes (20). The effect of thrombin on endothelial-PMN interactions may be explained, at least in part, by the ability of thrombin to induce expression of E-selectin (21), P-selectin (17,19), and intercellular adhesion molecule-1 (ICAM-1) (18,21), while the effect on monocyte adhesion has been attributed to D increased levels of ICAM-1 and VCAM-1 (20). Given that chronic inflammation is o w n lo a d characterized by increased monocyte-endothelial cell interactions, an understanding of e d fro m the molecular mechanisms by which thrombin induces VCAM-1 expression may provide h ttp ://w w important insight about the link between coagulation and chronic inflammatory disease w .jb c .o states. rg b/ y g u e s t o n J a In the present study, we have examined the transcriptional mechanisms that n u a ry 5 underlie thrombin-mediated induction of VCAM-1 in endothelial cells. We show that the , 2 0 1 9 effect of thrombin on VCAM-1 expression is mediated by a combination of NF-κB and GATA motifs in the upstream promoter region. These findings are the first to demonstrate a link between thrombin signaling and GATA binding activity. 4 EXPERIMENTAL PROCEDURES Materials. Human thrombin, leech hirudin, angiotensin II and thrombin receptor activation peptide (TRAP; SFLLRNPNDKYEPF) were obtained from Sigma (St. Louis, MO). Human vascular endothelial growth factor (VEGF) and platelet-derived growth factor (PDGF)-BB were obtained from Peprotec (RockyHill, NJ). Mouse tumor necrosis factor (TNF)-α was obtained from Life technologies (Rockville, MD). Anti-TNF-α antibody was obtained from Calbiochem (San Diego, CA). D ow n lo a d Cell culture. Human umbilical vein endothelial cells (HUVEC) (Clonetics, La Jolla, CA) ed fro m were cultured in EGM-2 MV complete medium. Human embryonic kidney (HEK)-293 http ://w w cells (ATCC CRL-1573) were cultured in Dulbecco's modified Eagle's medium (DMEM) w .jb c .o supplemented with 10 % heat-inactivated fetal bovine serum (FBS). HUVEC were used rg b/ y g u within the first 8 passages. es t o n J a nu a ry 5 Plasmids. For construction of the VCAM-1-luc plasmid, human VCAM-1 promoter, a , 20 1 9 region spanning –1716 to +119 bp (generously provided by Dr. Tatsuhiko Kodama, Tokyo University, Japan) was cloned into pGL3-basic vector (Promega, Madison, WI). A series of point mutations were introduced into the VCAM-1 promoter by polymerase chain reaction (PCR) methodology. To generate NF-κB mut-luc, two PCR fragments (A and B) were amplified from VCAM-1-luc. Fragment A was generated from forward primer with an NsiI site (5’-AAAATCATGCATTAGATATTGTAGAAGTAG-3’) and reverse primer with a PstI site (5’-CTTTTTTCCCTGGCTCTGCAGTGGGTT-3’). 5 Fragment B was generated from forward primer with PstI and NF-κB point mutation sites (5’- TGGCTCTGCAGAGTGCCTTTCCGGTTGAAGCCATTTCGGTCCGCCTCTGCAAC- 3’) and reverse primer with a SacII site (5’-CAGATACCGCGGAGTGAAATAGAAAG TCTG-3’). Fragment A was digested with NsiI and PstI, while fragment B was digested with PstI and SacII. Fragments A and B were then inserted into NsiI/SacII-digested VCAM-1-luc in a three-way ligation. The resulting plasmid introduced two NF-κB point mutations; GGGTTTCCCC→GCCTTTCCGG and GGGATTTCCC→GCCATTTCGG. D o A similar strategy was used to introduce the following mutations into 5’NF-κB mut; w n lo a d e GGGTTTCCCC→GCCTTTCCGG, 3’NF-κB mut; GGGATTTCCC→GCCATTTCGG, d fro m h thrombin response element (TRE) mut; CCCACCCC→CCCATATG, GATA mut; ttp://w w w TTATCT→ TTAAAT and AGATAG→ ATTTAG. All point mutations were confirmed .jb c .o rg b/ by automated DNA sequencing. To generate the pGEM-hVCAM1, a 254-bp of human y g u e s VCAM-1 cDNA fragment, a covered region 1755-to 2009-bp, was amplified from t on J a n u a reverse transcribed HUVEC total RNA and subcloned into pGEM-T easy vector ry 5 , 2 0 1 (Promega). pTRI-hGAPDH was purchased from Ambion (Austin, TX). For construction 9 of the herpes simplex virus thymidine kinase (TK)-luc, a BglII/ Hind III fragment of pRL-TK (Promega) was cloned into the pGL3-basic vector. To generate GATA -TK-luc, 4 a double stranded oligonucleotide containing 2 copies of the tandem GATA motifs from the VCAM-1 promoter (5’-ATTGTCCTTTATCTTTCCAGTAAAGATAGCCTT-3’) was cloned into NheI digested TK-luc plasmid vector. Insert direction was confirmed by automated DNA sequencing. 6 RNA isolation and RNase protection assays. HUVEC were cultured in 100 mm culture dishes, then the culture medium was replaced with serum-starved medium (EBM-2 plus 0.5 % FBS). 18 h later, HUVEC were incubated with 1.5 units/ml human thrombin (Sigma), with 20 ng/ml TNF-α (Life technologies) or with serum-starved medium alone. Cells were harvested for total RNA 4 h, 7 h and 24 h following thrombin treatment and 4 h following TNF-α treatment, using the Trizol reagent (Life Technologies). For in vitro transcription, VCAM-1- and GAPDH-specific 32P–labeled riboprobes were synthesized from pGEM-hVCAM1 and pTRI-hGAPDH, respectively. Both riboprobes were D o synthesized using SP6 RNA polymerase (Ambion) and purified with a G-50 spun column w n lo a d e (Amersham Pharmacia, Piscataway, NJ). RNase protection assays were performed with a d fro m h RPA III kit (Ambion), according to the manufacture’s instructions. ttp ://w w w .jb c .o Transfections and analysis of luciferase activity. HUVEC and HEK-293 cells were brg/ y g u e transfected using FuGENE 6 reagent (Roche Molecular Biochemicals, Indianapolis, IN) st o n J a as instructed by the manufacturer. Either 1 x 105 cells/well of HUVEC or 2 x 105 nu a ry 5 , 2 cells/well of HEK-293 cells were seeded in 12-well plates 18-24 h before transfection. 0 1 9 For HUVEC transfections, 0.5 µg of the reporter gene construct and 50 ng of a control plasmid containing the Renilla luciferase reporter gene under the control of a cytomegalovirus (CMV) enhancer/promoter (pRL-CMV) (Promega) were incubated with 2 µl FuGENE6. 24 h later, the cells were washed with phosphate-buffered saline two times and cultured for 18 h in serum-starved medium (EBM-2 plus 0.5% FBS). The cells were then incubated in the presence or absence of cytokines for 6 h, at which time cells were lysed and assayed for luciferase activity using the Dual-luciferase reporter assay 7 system (Promega) and Lumat LB 9507 luminometer (Berthold, Gaithersberg, MD). For HEK-293 cell transfections, 0.05 pmol of the test construct, 0.075 pmol of the GATA expression vector, and 30 ng of pRL-CMV were incubated with 1.5 µl of FuGENE 6. Two days later, the cells were lysed and assayed for luciferase activity as described above. Nuclear extracts and Electrophoretic mobility shift assays. Nuclear extracts were prepared as previously described (22). Double-stranded oligonucleotides were labeled D with [α-32P] dCTP and Klenow fragment and purified by spun column (Amersham ow n lo a d Pharmacia). 5 µg of HUVEC nuclear extracts were incubated with 10 fmol 32P-labeled ed fro m h probe, 1 µg poly (dI-dC), and 3 µl of 10x binding buffer (100 mM Tris HCl (pH 7.5), 50 ttp ://w w w % glycerol, 10 mM DTT, 10 mM EDTA) for 20 min at the room temperature, followed .jb c .o rg by 30 min at 4 °C. To test the effect of antibodies on DNA-protein binding, nuclear b/ y g u e s extracts were pre-incubated with antibodies of p65, RelB, c-Rel, p50 and p52 (Santa t o n J a n u Cruz, Santa Cruz, CA) for 30 min at room temperature, or with antibodies of GATA-2 (a ary 5 , 2 0 generous gift from Dr. Stuart Orkin, Harvard Medical School, Boston, MA), GATA-3 1 9 (Santa Cruz) for 1 h at 4 °C. In competition studies, nuclear extracts were pre-incubated with 50-fold molar excess of unlabeled wild-type or mutant oligonucleotides for 20 min at room temperature, then added to the reaction mixture. DNA-protein complexes were resolved on a 5% non-denaturing polyacrylamide gel containing 5% glycerol in 0.5 X TBE (50 mM Tris, 50 mM boric acid and 1 mM EDTA). The loaded gel was fixed with 10% methanol and 10% acetic acid, then autoradiographed. 8 RESULTS Thrombin-mediated upregulation of VCAM-1 mRNA. In a previous study, thrombin was shown to induce VCAM-1 expression in endothelial cells (20). To confirm these results, we employed RNase protection assays with a probe that is specific for the human VCAM-1 gene and total RNA derived from control and thrombin-and TNF-α -treated HUVEC. As shown in Fig. 1A and B, the incubation of HUVEC in the presence of 1.5 units/ml thrombin or 20 ng/ml TNF-α for 4 h resulted in 39.8- or 48.0-fold stimulation of D o VCAM-1 mRNA, respectively (Fig. 1A; lanes 3 and 7). Following thrombin treatment, w n lo a d e VCAM-1 mRNA levels remained elevated at 7 h and approached baseline levels by 24 h d fro m h (Fig. 1A; lane 5). ttp ://w w w .jb c .o Thrombin-mediated upregulation of VCAM-1 promoter. We next wished to determine brg/ y g u e whether the effect of thrombin on VCAM-1 mRNA expression was mediated by the st o n J a n VCAM-1 promoter. HUVEC were transiently transfected with the VCAM-1-luc plasmid u a ry 5 , 2 that contains a 1.8-kb region of the human VCAM-1 promoter (between –1716 and +119) 0 1 9 coupled to the luciferase reporter gene. Transfected HUVEC were grown in the absence or presence of thrombin and assayed for luciferase activity 6 h later. As shown in Fig. 2A, thrombin resulted in a dose-dependent stimulation of reporter gene activity, with maximal induction occurring at a concentration of 1.5 units/ml. Furthermore, the addition of the specific thrombin inhibitor, hirudin, resulted in a dose-dependent inhibition of the thrombin-mediated VCAM-1 promoter activity (Fig. 2B). In subsequent studies, we analyzed the effects of TRAP, a 14-amino acid peptide representing the new amino 9 terminus of PAR-1 generated after thrombin cleavage, on VCAM-1 promoter activity. As shown in Fig. 3, thrombin and TRAP induced VCAM-1 promoter activity by 3.3- and 3.5-fold, respectively. These results suggest that thrombin-induced activation of the VCAM-1 promoter is mediated by cleavage of PAR-1. The VCAM-1 promoter was induced 4.3-fold by TNF-α. The addition of VEGF resulted in a slight increase in promoter activity, while PDGF-BB and Angiotensin II had no such effect (Fig. 3). Finally, to rule out the possibility that thrombin stimulation of the VCAM-1 promoter was mediated by TNF-α release, transfected cells were treated with TNF-α or thrombin D in the absence or presence of neutralizing anti-TNF-α antibodies. In these experiments, ow n lo a d e thrombin-mediated induction of promoter activity was unaltered by pre-incubation with d fro m h antibody at concentrations that otherwise inhibited the effects of TNF-α (data not ttp ://w w w shown). .jb c .o rg b/ y g u e s Thrombin-mediated upregulation of the VCAM-1 promoter is not mediated by the t o n J a n u thrombin-response element. The human VCAM-1 promoter contains a consensus a ry 5 , 2 thrombin-response element (TRE) at –319 relative to the start site of transcription (Fig. 01 9 4A). To determine whether this regulatory element was involved in transducing the thrombin signal, a plasmid containing a point mutation of the TRE sequence was transfected into HUVEC. As shown in Fig. 4B, the TRE mutant retained thrombin and TRAP responsiveness, suggesting that this sequence is not essential for thrombin- mediated activation of VCAM-1. In electrophoretic mobility shift assays, a radiolabeled VCAM TRE element probe was incubated with nuclear extracts derived from HUVEC 10